ID: 1029945248

View in Genome Browser
Species Human (GRCh38)
Location 7:104526141-104526163
Sequence GGAATTTTCATGCACCATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029945248_1029945252 9 Left 1029945248 7:104526141-104526163 CCCTTATGGTGCATGAAAATTCC 0: 1
1: 0
2: 0
3: 13
4: 105
Right 1029945252 7:104526173-104526195 TTTTGAAAATTCAGATTTGCAGG 0: 1
1: 0
2: 6
3: 70
4: 778

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029945248 Original CRISPR GGAATTTTCATGCACCATAA GGG (reversed) Intronic
907169867 1:52452660-52452682 GGAGTTTTCATGCCCTATCAGGG - Intronic
908760994 1:67511797-67511819 GTAACTTACATGCCCCATAATGG - Intergenic
909421644 1:75473156-75473178 GTAATTTTCATGCATAAAAAAGG - Intronic
922410957 1:225374692-225374714 GGAATTTTCCAACACCTTAATGG - Intronic
923084409 1:230691942-230691964 GGATTTCTCATGCACCATAGAGG - Intronic
1063570593 10:7211368-7211390 GGAAGTCACATGCACCACAATGG + Intronic
1063915285 10:10875922-10875944 GGAATATAAATGCACCATTAAGG - Intergenic
1065538011 10:26733486-26733508 TAAAATTGCATGCACCATAAAGG - Intronic
1065826071 10:29572904-29572926 GTAATTTTCAGGCACAAAAAGGG - Intronic
1068228061 10:54132740-54132762 GGAATTTTCATTCACTAGAGTGG + Intronic
1070424995 10:76277947-76277969 GGAATTTTCATGCCCATTAGAGG + Intronic
1074313455 10:112342187-112342209 GGAATTTTAATGGACCAAAATGG - Intergenic
1079417196 11:20249940-20249962 GCAATTTTCATGCACCAATTTGG - Intergenic
1080492660 11:32783201-32783223 GGAATTTTCAATATCCATAATGG + Intronic
1080646070 11:34188608-34188630 GGAAATTTAATGCACAAAAAGGG + Intronic
1082847769 11:57740396-57740418 GGAATTGTCAGGCACCCTACAGG + Exonic
1083476559 11:62919206-62919228 GGAAGTTTTGTGCACCTTAATGG - Intronic
1089738334 11:120564682-120564704 GGAATACTAATGCACCCTAAAGG + Intronic
1091327718 11:134703751-134703773 GGAGTTTTCATGCACTGTGATGG + Intergenic
1093555868 12:20472905-20472927 GAAATTTTTATTCACCATCATGG + Intronic
1094078181 12:26501691-26501713 CAAATATTCATTCACCATAATGG + Intronic
1094745715 12:33342034-33342056 GGGACTTTCATGCACCAGGAGGG - Intergenic
1095174122 12:39071095-39071117 GGCTTTTTCATTCACCATGAAGG + Intergenic
1095513325 12:42977739-42977761 GGTATTGTCAAGCTCCATAATGG + Intergenic
1099175873 12:79421275-79421297 GGAAGTTTCATCTACCACAATGG - Intronic
1100800309 12:98223899-98223921 GGGCTTTTCATCCTCCATAATGG - Intergenic
1101680532 12:106959970-106959992 GGAATTTTGATACAACATACTGG + Intronic
1106093422 13:26620265-26620287 TAAATTTTTATGCACAATAAAGG + Intronic
1109595941 13:64553585-64553607 GGTCTTTTCTTGCAGCATAACGG + Intergenic
1113223955 13:108138920-108138942 GGATTTTTCAGCCTCCATAACGG - Intergenic
1114910287 14:27185329-27185351 GAAATTCTCATGGAACATAAAGG + Intergenic
1116600829 14:46920394-46920416 GGGATTTTCATCAACCAAAATGG + Intronic
1116681680 14:47978699-47978721 GGAATTCTCATTCACCAAAAGGG + Intergenic
1116761636 14:49022322-49022344 TGCATTTTCATGGACCTTAATGG - Intergenic
1117220526 14:53600134-53600156 TGAAGTTTCATGGCCCATAATGG - Intergenic
1123572095 15:21623953-21623975 AGAATATTCAAGCACCATAATGG - Intergenic
1123608711 15:22066540-22066562 AGAATATTCAAGCACCATAATGG - Intergenic
1126526552 15:49662473-49662495 AGAATTTACTTGCAGCATAAGGG - Intergenic
1126722672 15:51598497-51598519 GGAATTTTCTTTTACTATAAAGG - Intronic
1127499959 15:59546213-59546235 GGAACTTTCATCCACCAGGAGGG - Intergenic
1130782834 15:87062509-87062531 AAAATTTTCATAAACCATAAGGG + Intergenic
1202980952 15_KI270727v1_random:358339-358361 AGAATATTCAAGCACCATAATGG - Intergenic
1140139706 16:72243917-72243939 GGAATTTTAATGAGCCCTAAAGG + Intergenic
1141848334 16:86626536-86626558 GGAATTTTCTTGTTCCATAATGG - Intergenic
1143767129 17:9145102-9145124 GGAAATTTACTGCACAATAAAGG + Intronic
1152523116 17:80872037-80872059 GGAAATTCCATGGACCATCAAGG - Intronic
1153305732 18:3629069-3629091 GGAATTCTCATGCACTGTTATGG - Intronic
1155832343 18:30533429-30533451 GGACTTTTCAAACATCATAAGGG + Intergenic
1158041389 18:53099052-53099074 GGTATTTTGATGCAGAATAACGG + Intronic
1158302714 18:56069949-56069971 GGAAATTTAATACACAATAAAGG + Intergenic
1158787709 18:60735698-60735720 GAAATTTATATGCAACATAATGG - Intergenic
1166623833 19:44331351-44331373 GGAAATTTGAGGCACCAGAAAGG + Intronic
929019157 2:37533187-37533209 AGAATACTCATGCACCTTAATGG - Intergenic
930145470 2:47998424-47998446 GGAAACTTAATGTACCATAAAGG - Intergenic
931193326 2:60026698-60026720 GGAATTTTCTAGCTCCATTATGG + Intergenic
932213380 2:69949635-69949657 AGAATTTTAATGCAGCATGAAGG + Intergenic
938554611 2:132413769-132413791 GGGATTGTGATGCACCAGAAAGG - Intergenic
943657097 2:190521376-190521398 GAAATTTACAGGCTCCATAAAGG + Intronic
946286102 2:218704096-218704118 GGAATTGTCATTCACTAAAATGG + Intergenic
948284122 2:236770688-236770710 GGAATTTACTAGCACCATATGGG + Intergenic
1173696704 20:45022755-45022777 GGAATTTACAAAAACCATAAGGG - Intronic
1184480925 22:44746482-44746504 GGAATAATCATGCAAAATAAAGG - Intronic
954556233 3:51519723-51519745 GCAATTTAAATGGACCATAAGGG - Intergenic
954973694 3:54673364-54673386 GGAATTTTCAAGCACACTAAAGG - Intronic
958350925 3:92809672-92809694 GGAAATTTCAAGCACCTTGAGGG + Intergenic
958390287 3:93454208-93454230 GGAAATTTCAAGCACCTTGAGGG + Intergenic
959831244 3:110865252-110865274 GGAATTTAAATGCACGATTATGG + Intergenic
962019719 3:131485962-131485984 AGAATTATCATGCAACAAAAAGG + Intronic
965934981 3:174097424-174097446 GGAATATTCATGGCCCAAAAGGG + Intronic
970173688 4:13314984-13315006 GGAATCTTCAAGCAACATCAAGG - Intergenic
974976521 4:68900804-68900826 GAATTTGTCATGCACCACAATGG - Intergenic
975020456 4:69480806-69480828 GAATTTGTCATGCGCCATAAAGG - Exonic
976627948 4:87207246-87207268 GCAAATTCCATGCACCGTAAAGG + Intronic
979582183 4:122373626-122373648 GGAGTTCCCTTGCACCATAAGGG + Intergenic
984218011 4:176938356-176938378 GTAAACTTTATGCACCATAAGGG - Intergenic
984683267 4:182635931-182635953 TGATTTTTCATGAAGCATAAAGG - Intronic
985312768 4:188619890-188619912 GGAACTTTCATCCACCAAGAGGG - Intergenic
988427854 5:31084648-31084670 GGGATTTTTATGCACCATACTGG + Intergenic
990578170 5:57143651-57143673 AGAATTTTCTTGGACCACAATGG - Intergenic
991392896 5:66167416-66167438 TGAACTTTGATGCAGCATAATGG + Intronic
993549745 5:89259131-89259153 GGCATTTTCATGCAACAGAAAGG + Intergenic
995550053 5:113272119-113272141 GGATTTTGCTTGCACCAAAAGGG + Intronic
999094805 5:148968467-148968489 GAAAGTTTCAGGCATCATAATGG + Intronic
1009033585 6:58090100-58090122 AGTATTTTCATGTACCAAAATGG + Intergenic
1010583837 6:77633180-77633202 GGAATTTGCAAGAACCAAAATGG - Intergenic
1013700151 6:112757620-112757642 GGAACTTACATGCAACAAAAAGG - Intergenic
1016403779 6:143708838-143708860 AGAATTTTTATGCAGCATCAGGG + Intronic
1016405226 6:143722964-143722986 GGAATATTATTCCACCATAATGG - Intronic
1016408111 6:143753013-143753035 GGAATTTTAAAAAACCATAATGG - Intronic
1017650086 6:156572736-156572758 GGGATTTTCATGAACAAGAACGG + Intergenic
1018319109 6:162587842-162587864 TGAATTATCATGCAGAATAAAGG + Intronic
1021384344 7:20009514-20009536 GGAATATTTTTGCACCATAAGGG + Intergenic
1024375215 7:48629728-48629750 GGAATGTTGAGGCACCAGAATGG + Intronic
1026169741 7:67943626-67943648 GGAATTGTCATCCTCCATGATGG - Intergenic
1027844436 7:83354388-83354410 GGAATATTCATTTCCCATAATGG - Intergenic
1029945248 7:104526141-104526163 GGAATTTTCATGCACCATAAGGG - Intronic
1031463647 7:122081933-122081955 GGAATTTTCGGGCAGCATAAGGG + Intronic
1033219352 7:139517991-139518013 GGAATTTTCTACCCCCATAATGG + Intergenic
1040718280 8:50285740-50285762 GGAATTTACAAAAACCATAAGGG + Intronic
1042338218 8:67651117-67651139 GGAATTTACATGAAACTTAATGG + Intronic
1042940880 8:74106816-74106838 GGGAGTTTCATTCACAATAAAGG + Intergenic
1046859742 8:119076956-119076978 GGGACTTTGATACACCATAAAGG + Intronic
1048502038 8:134987069-134987091 GAGAATTTCATGCACCATAATGG + Intergenic
1048754334 8:137719391-137719413 GGAATTTTGATTCTCCTTAACGG - Intergenic
1049138370 8:140927534-140927556 GGGATTTACATTCACCACAAGGG - Intronic
1051189488 9:14496410-14496432 GAAATTTTCAAGCACCAACATGG - Intergenic
1051226125 9:14900818-14900840 GTGATTTCCATGCACTATAAGGG - Intronic
1053407074 9:37886541-37886563 GGAATTGTCAGGCACCCTACAGG + Intronic
1055468984 9:76592798-76592820 AGAATTTTCTTGCACAATAGTGG - Intergenic
1058775942 9:108283869-108283891 GGAAATTTCATTCACCGTAGTGG - Intergenic
1059896455 9:118871566-118871588 GGAATTTTCAAAAACCAGAAAGG - Intergenic
1186602430 X:11052362-11052384 GCCATTTTCATACATCATAAAGG + Intergenic
1190948926 X:55123262-55123284 GGAACTTTCATCCACCAGGAGGG + Intronic
1195556125 X:106227085-106227107 GGAATTCTCAGTCTCCATAATGG - Intergenic
1196117763 X:112015674-112015696 ACAATTTTCAAGCACTATAAGGG + Intronic
1197153006 X:123240417-123240439 GGATTTTTAATGCAGCAAAAAGG + Intronic
1202251585 Y:22878759-22878781 GGAATTTTGACATACCATAAAGG - Intergenic
1202404573 Y:24512508-24512530 GGAATTTTGACATACCATAAAGG - Intergenic
1202466206 Y:25157574-25157596 GGAATTTTGACATACCATAAAGG + Intergenic