ID: 1029946153

View in Genome Browser
Species Human (GRCh38)
Location 7:104535283-104535305
Sequence CTCCAAATGATACTTCTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029946153 Original CRISPR CTCCAAATGATACTTCTGTC AGG Intronic
902993850 1:20208706-20208728 CTCCTAATTACACTACTGTCTGG + Intergenic
905145922 1:35886582-35886604 CCCCAAATGATTATTCAGTCTGG + Intronic
905949202 1:41933086-41933108 CTCCAAATGATACTATGTTCTGG - Intronic
907428055 1:54393555-54393577 CTTCAAAGGATTCTACTGTCAGG - Intronic
909405292 1:75281871-75281893 CTCCAAAGCAAACTTCTGCCTGG - Intronic
910241537 1:85091980-85092002 TTCCAAATCATATTTCTTTCTGG - Intronic
916579265 1:166093095-166093117 TTCCAAACAATACTTCTCTCAGG - Intronic
916869091 1:168893005-168893027 CTCCATGTGTTACTTCTGTCTGG + Intergenic
923140630 1:231159580-231159602 CACCAAAAAATACTTCTATCAGG + Intergenic
924318856 1:242827039-242827061 CTTCTAATGAAATTTCTGTCTGG - Intergenic
1064565524 10:16635443-16635465 CTCCAAAGAGAACTTCTGTCTGG + Intronic
1067492460 10:46724112-46724134 ACCCAAATGCTGCTTCTGTCGGG - Intergenic
1067602207 10:47616283-47616305 ACCCAAATGCTGCTTCTGTCGGG + Intergenic
1068250865 10:54438328-54438350 ACCCAAATGCTTCTTCTGTCGGG + Intronic
1070980924 10:80646479-80646501 CTGCAAATGAAATTACTGTCTGG + Exonic
1076019275 10:127057141-127057163 CTCCAAATGAGTCTCCTGTGTGG + Intronic
1076377943 10:130003941-130003963 CCCCAAATCTTACATCTGTCTGG - Intergenic
1079680018 11:23284152-23284174 CTCCAAATGAGAACTCAGTCTGG + Intergenic
1087023881 11:93630555-93630577 CACCAAATGATACTTCTCCAGGG - Intergenic
1088733890 11:112709212-112709234 CTCCTAAGGATTCTTCTTTCTGG + Intergenic
1089103016 11:115980204-115980226 CCCCAAAGGATCCTCCTGTCAGG - Intergenic
1093180032 12:15956173-15956195 ATCCAAATGTTAGCTCTGTCTGG + Intronic
1095783798 12:46088265-46088287 CTCCAAAGGAGACTTCAGTTTGG + Intergenic
1097792534 12:63830018-63830040 CTTGAAATAATACTTATGTCAGG + Intergenic
1109672951 13:65634420-65634442 CTCCAGTTGAAACTGCTGTCTGG + Intergenic
1109939034 13:69335189-69335211 CACAAAATGATACTTCTGTGAGG - Intergenic
1112787141 13:102963601-102963623 CTCCAAACTATAATTCTGTGAGG + Intergenic
1113050945 13:106211276-106211298 CAACAAATTATACTTCTTTCCGG + Intergenic
1116251901 14:42496485-42496507 CTGGAAATGATTCTTCTGGCTGG + Intergenic
1121207029 14:92178274-92178296 CTCAAAATTTTACATCTGTCTGG - Intergenic
1129142020 15:73607795-73607817 CTCCAAATGATTCTGCTGCATGG - Intronic
1135745178 16:25010925-25010947 CTCCAAGGGAAACTTCAGTCAGG + Intronic
1137942673 16:52704204-52704226 CTCCAAGTGATACTTCCGTAAGG + Intergenic
1141084583 16:81083706-81083728 CTCCAAAGGATTTATCTGTCAGG - Intronic
1143951701 17:10637819-10637841 CTGCAAACGAGACTTCTGTGTGG + Exonic
1153482660 18:5563113-5563135 ATCCATTTGATCCTTCTGTCTGG - Intronic
1153683644 18:7524262-7524284 CACAAAACGATACTTCTGACAGG - Intergenic
1154039785 18:10843536-10843558 CTCCAAATGATCATTATGTATGG - Intronic
1155575493 18:27241413-27241435 CTCAAAACAATACTTCTTTCTGG + Intergenic
1157589181 18:48825901-48825923 TTCCAAATGATTCTAATGTCCGG + Intronic
1158301529 18:56058077-56058099 TTCTAAAAAATACTTCTGTCGGG + Intergenic
1159894351 18:73982393-73982415 TTCCTAATGATGCTTCAGTCAGG + Intergenic
1160039166 18:75329958-75329980 TTACAAATGAAACTGCTGTCTGG - Intergenic
1165277743 19:34769537-34769559 CTTCAAATGATACTAATGCCTGG + Exonic
1167192223 19:47999139-47999161 CACCAAAGGAGACATCTGTCAGG + Intronic
926201383 2:10801551-10801573 GTCCAAATGCTAATTCTGTGTGG - Intronic
926869447 2:17396882-17396904 CTCCATATGACACTTCTTACTGG + Intergenic
930971608 2:57402156-57402178 CTCCAAATCAAAGTTCTGTCAGG + Intergenic
931588243 2:63852481-63852503 CTCCAAAAGATACTTCAGCTTGG + Intronic
933326463 2:80844219-80844241 CTCCAGATGTTATTTCTCTCTGG + Intergenic
933545114 2:83699947-83699969 CTCTGAAAGATACTTATGTCTGG + Intergenic
937005190 2:118505536-118505558 CAACAAAGAATACTTCTGTCTGG - Intergenic
939667111 2:144965601-144965623 CCCTAAAGCATACTTCTGTCTGG - Intergenic
944099556 2:196008576-196008598 GGCCAAATGATACTTCAGTATGG - Intronic
944156764 2:196615600-196615622 CTTCAAAGTATACTTCTGTCAGG - Intergenic
945154929 2:206828482-206828504 CTCAACATGACACTTCTGTCTGG + Intergenic
945156227 2:206841694-206841716 CTCTAAATGATACCTCAGACAGG - Intergenic
1170935045 20:20802626-20802648 CTGCATAAGATAATTCTGTCTGG - Intergenic
1173369400 20:42421340-42421362 CTCCAAAAGATACATCTATCTGG + Intronic
1176198602 20:63849298-63849320 CTCCAGATGACACCTCTGCCAGG + Intergenic
1178216037 21:30599321-30599343 ATCCAAATAATACTTTTTTCAGG + Intergenic
1180850056 22:19013672-19013694 CTCTCAATGATATTTCTTTCTGG + Intergenic
1181018613 22:20086188-20086210 CTCCAAAGGATCCTTCTCTAAGG + Exonic
1182951324 22:34378821-34378843 CTTCAAATTAAATTTCTGTCTGG + Intergenic
1183240017 22:36650750-36650772 CTTCAAGTGATCCTTCTGCCTGG + Intronic
949251289 3:1987255-1987277 CTTGAAATGCTACTTATGTCTGG - Intergenic
949729958 3:7097426-7097448 CTCCATATAATACTTCTTTCAGG - Intronic
950156106 3:10722893-10722915 CTCTAAATGATTCATGTGTCAGG - Intergenic
951733029 3:25831909-25831931 CTCCAAATGAAACTTTGGACAGG - Intergenic
956757810 3:72406462-72406484 CTCCATATGACACTTGTGTCAGG - Intronic
957840502 3:85662601-85662623 CTGCAAATGATACTTTTGTCAGG + Intronic
961402536 3:126657274-126657296 CTGCAAAAGCTACTGCTGTCAGG - Intergenic
961752321 3:129104086-129104108 CTCCAGATTATGTTTCTGTCGGG - Intronic
964648309 3:158982797-158982819 CTCCAAATGACACACATGTCTGG - Intronic
964649696 3:158996677-158996699 CTCCAAATAATCCTTGTGCCAGG - Intronic
965344787 3:167535088-167535110 CTCTAAATCATAATTTTGTCTGG - Intronic
966098851 3:176242146-176242168 CTCCAGATGATAGGTCTGCCAGG - Intergenic
966591833 3:181692778-181692800 CTCCAAATAGTACATCTTTCTGG + Intergenic
970181433 4:13400352-13400374 CTCCAAATGGTATTTGTGTGTGG - Intronic
971134395 4:23852217-23852239 CACCAAATGAAACGTATGTCTGG - Intronic
974249690 4:59369258-59369280 CTCCTAATGATAGGTCTCTCTGG - Intergenic
975575366 4:75857311-75857333 CTCCAAATGAGAATGCAGTCTGG - Intergenic
976879906 4:89908021-89908043 TTTAAAATGATATTTCTGTCTGG + Intronic
979770569 4:124520260-124520282 CTTTAAATGAGATTTCTGTCTGG - Intergenic
983701788 4:170605602-170605624 CTCCAAATAATACTTTTCTTTGG - Intergenic
986333594 5:6736230-6736252 CTCCAAATGACTCTTTTGGCGGG + Intronic
987549068 5:19355025-19355047 CTGCAAAGGATACTTCTTCCTGG + Intergenic
990118127 5:52414341-52414363 GTCCCAATGTTTCTTCTGTCTGG - Intergenic
991260668 5:64664312-64664334 TTCAAAATGATAGTTCTGTGGGG - Intergenic
994310524 5:98264301-98264323 ATGCAACTGATAGTTCTGTCAGG - Intergenic
994950516 5:106455361-106455383 CTCCAAATGAGACCTATGTTAGG - Intergenic
999041481 5:148418030-148418052 CTACAGATGATTCTTTTGTCAGG - Intronic
999535983 5:152518129-152518151 TGCCAAATGATCCTTCTTTCTGG + Intergenic
1000603113 5:163298475-163298497 CTCCACAAGACACTTCTATCAGG + Intergenic
1001240793 5:170068471-170068493 CCCCAAATTATACTACTGTGTGG - Intronic
1003950052 6:11108555-11108577 GCCCAAATGCTACTTCTGTGGGG - Intronic
1004505147 6:16241116-16241138 CTCCAGATATTACTTCTGCCAGG - Intronic
1010722794 6:79302820-79302842 CTGCAAATGATCCTCCTGTGTGG - Intergenic
1019037849 6:169076721-169076743 CTCCAAATGCTACTCCTGCGTGG - Intergenic
1020635769 7:10694169-10694191 CTCCAAATGATACTGGTTTCAGG - Intergenic
1021623550 7:22571276-22571298 CTCCAAATCATTCTTCTTTTAGG - Intronic
1025752039 7:64302278-64302300 ATCCAAATGAGACTTCAGTGAGG + Intergenic
1028790931 7:94851865-94851887 CTCCAAATAATGCTTGTGTTGGG - Intergenic
1029946153 7:104535283-104535305 CTCCAAATGATACTTCTGTCAGG + Intronic
1030765595 7:113405500-113405522 CACCAAGTGACACTGCTGTCAGG + Intergenic
1031976871 7:128099587-128099609 TTCTAAATGATACTTCTGTTTGG + Intergenic
1032961285 7:137037712-137037734 CTCCAAATGGTATTTCTCTTGGG + Intergenic
1033874191 7:145794211-145794233 CTCCAAATCCAATTTCTGTCAGG + Intergenic
1041258354 8:55998687-55998709 CTCCACATGATACTTTTGTTAGG + Intronic
1045908512 8:107377383-107377405 CTCCAAGTCATAATCCTGTCTGG + Intronic
1046642640 8:116749782-116749804 CTCCAAATGATACTTTTCTTTGG + Intronic
1049919924 9:353646-353668 CTCCATCTGACAGTTCTGTCTGG + Intronic
1050966212 9:11806411-11806433 CTCCTAATGGCACTTATGTCTGG - Intergenic
1055664807 9:78542742-78542764 CTCCAACTGCTACTGCTGGCAGG - Intergenic
1058437321 9:104974965-104974987 GTCCAGATGATGCTCCTGTCTGG - Intergenic
1059823003 9:117994942-117994964 ATCCAAATGATATATGTGTCTGG + Intergenic
1059941158 9:119361198-119361220 CTCCAAAAGATAGTTCCCTCAGG + Intronic
1186553192 X:10528681-10528703 CTCAAAATGATAATATTGTCTGG + Intronic
1187078716 X:15963501-15963523 TTCCAAATGATACGTATGTCTGG - Intergenic
1189982810 X:46528181-46528203 GTCCAAATGAGGCTTCTGCCTGG - Intronic
1190544343 X:51509935-51509957 CTCTTAATGATACTTCAGCCAGG + Intergenic
1194008402 X:88526861-88526883 CTACAAATGTCACTTCTGTTTGG - Intergenic
1195386539 X:104318856-104318878 GTCCAAAGGTTACTTCCGTCTGG - Intergenic
1195674680 X:107498907-107498929 CTCCTAATTCTGCTTCTGTCTGG - Intergenic
1197147585 X:123186145-123186167 CTCCAAATGATACTGCTGAGGGG + Intronic