ID: 1029954316

View in Genome Browser
Species Human (GRCh38)
Location 7:104621577-104621599
Sequence TGTCAACTCCCTGGAGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 234}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029954316_1029954320 5 Left 1029954316 7:104621577-104621599 CCTTTCCCTCCAGGGAGTTGACA 0: 1
1: 0
2: 4
3: 15
4: 234
Right 1029954320 7:104621605-104621627 CTTAATCATATTGCCGTCTGTGG 0: 1
1: 0
2: 0
3: 7
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029954316 Original CRISPR TGTCAACTCCCTGGAGGGAA AGG (reversed) Intronic
900472473 1:2861612-2861634 TGCCAGCTCCCTTGAGGGACGGG - Intergenic
901251304 1:7782543-7782565 CGTCAACTCCCTGGGTGGCAGGG + Intergenic
901818845 1:11812500-11812522 GGTCTCCTCCCTGGAGGGATGGG + Intronic
902780689 1:18702974-18702996 TCTCCATTCCTTGGAGGGAAGGG - Intronic
903317351 1:22518726-22518748 TGTAAACTGCTTGGAGGGAAAGG - Intronic
904284468 1:29445056-29445078 TGTGACCTCCCAGGAGGGGAGGG - Intergenic
905356969 1:37391518-37391540 TGCCAACTCCCTGTAGGGGTGGG + Intergenic
905459536 1:38113629-38113651 TGTCAAGTCCCTGGGAGGAGAGG - Intergenic
905804157 1:40863811-40863833 TGTCAAATGCGTGGAGGGTAAGG - Intergenic
906145695 1:43558793-43558815 CCTCAACCTCCTGGAGGGAAAGG - Intronic
909300956 1:74012692-74012714 TGTTAACACCCTGGTGGCAAAGG + Intergenic
910723434 1:90312884-90312906 TGTAAACTCCCCTGAGGGCAGGG + Intergenic
911961016 1:104302111-104302133 ACTCACCACCCTGGAGGGAAAGG + Intergenic
912961069 1:114196401-114196423 TGTCATATCCCTGGAGGGGGAGG + Intergenic
915072860 1:153286786-153286808 TGTCAGCTCTGTGGAGGGTAGGG - Intergenic
917780918 1:178396083-178396105 TGGCAAATACCTGGAGGAAAAGG + Intronic
924708802 1:246518272-246518294 TGTCAATGCCCTGGAGGTGAAGG - Intergenic
924945123 1:248841192-248841214 TGTTAGGTCCCTGGAGGAAAGGG - Intronic
1064623417 10:17238519-17238541 TCTCATCTCCCTGGAAGAAAAGG - Intergenic
1064791893 10:18966835-18966857 TTCCAACTCCCTGTAGGGAATGG - Intergenic
1065748699 10:28865343-28865365 TGTCCACTCCCTGCAGGGAGGGG + Intronic
1066153698 10:32651726-32651748 TGACACCTCTCTGGCGGGAAGGG + Intronic
1068869263 10:61926256-61926278 TGCCAATTCCCTGGGGTGAATGG - Intronic
1070760850 10:79023570-79023592 TGTAAGCTCCCTGGGGGGAGGGG + Intergenic
1072551052 10:96477988-96478010 TATCAGCTCACTGGAGAGAAGGG + Intronic
1073390800 10:103174935-103174957 TGTCAACCTCCTGGAGTGATCGG - Exonic
1073426080 10:103456485-103456507 TGTCACCTCACTGCAGGGCACGG + Intronic
1074523195 10:114243230-114243252 TGTGAACTCCCTGGAGGGTTAGG - Intronic
1075215443 10:120528704-120528726 TGCCAAGTCCCTGGAGGGAATGG + Intronic
1077956882 11:7030625-7030647 TGTAAGCTCCATGGAGGTAAGGG + Intronic
1080311440 11:30897717-30897739 AGAAAACTCCCTGGAGCGAATGG + Intronic
1080419497 11:32097419-32097441 TGACATCTCCCTGAAGGGAGTGG - Intronic
1080988587 11:37502823-37502845 TTACAACTCCCTGGACTGAATGG - Intergenic
1083678868 11:64342281-64342303 CTTCTCCTCCCTGGAGGGAAGGG - Exonic
1085025492 11:73234143-73234165 TGCCATCGCCCTGCAGGGAAGGG - Exonic
1085266991 11:75242905-75242927 GGTCAGCGCCCTGGTGGGAAAGG - Exonic
1085559642 11:77459557-77459579 TTTCAACTCCATGGAGTCAAAGG - Intronic
1085643877 11:78210089-78210111 TGTCCGCTCCCCGGAGGGGATGG - Exonic
1086399395 11:86448180-86448202 AGTCAACTCCCTGGAGGAGGTGG - Exonic
1086470418 11:87103318-87103340 TGGCAAGTACCTGGAGGAAAAGG - Intronic
1086738802 11:90341227-90341249 TCTCAAATCCCTCAAGGGAAGGG - Intergenic
1088952110 11:114582533-114582555 TGTCAGCTCTCTGGAGTGCAAGG - Exonic
1088963880 11:114698511-114698533 TATCAGCTCTCTGGAGGGCAAGG + Exonic
1090853221 11:130588786-130588808 TGTCACATCCCTGGGGGGGATGG - Intergenic
1091665952 12:2418711-2418733 TGTCAGCTCCCTGCAGGCAAAGG - Intronic
1092216704 12:6688871-6688893 GTTCAGCTCCCTGGAGGGGAAGG - Intronic
1092531702 12:9350462-9350484 TGTAAACTCTCTTGAGGGAGTGG + Intergenic
1093962543 12:25290987-25291009 TGTCAAAACCTTGGAGGCAAGGG - Intergenic
1094655816 12:32418785-32418807 ACTCACCACCCTGGAGGGAAGGG - Intronic
1096409697 12:51368256-51368278 TGTGAGATCCCGGGAGGGAAAGG + Intronic
1096995991 12:55838576-55838598 TGCCAACAGCCTGGAGGGGAGGG + Intronic
1097435773 12:59550756-59550778 TGTAATATCCCTGGAGGGACAGG + Intergenic
1098978268 12:76927514-76927536 TTTCAATTCCCTGGGGAGAAAGG + Intergenic
1100845050 12:98649816-98649838 TGTTAACTCTCTGAAGGGAGGGG + Intronic
1101615788 12:106335506-106335528 TGTAAACTCCTTGCAGGGCATGG + Intronic
1106172353 13:27298902-27298924 TGGCAATTCTCAGGAGGGAAGGG - Intergenic
1106454184 13:29912147-29912169 TGTCACTCCCCTGGAAGGAAGGG + Intergenic
1107052629 13:36067785-36067807 TGTCAGCTCCTAGGAGAGAAGGG - Intronic
1108436624 13:50407022-50407044 TGTCAACTCCCAGGGGACAAGGG - Intronic
1108611247 13:52085856-52085878 TTTCAACTCTCTGCAGGGTAAGG - Intronic
1112299568 13:98217774-98217796 TGGCCACTCCTTGGAGGGCAAGG + Intronic
1113791193 13:113029302-113029324 TGGCAACACCCTGGAGGCACGGG - Intronic
1114610407 14:24036454-24036476 TGTCACCTCGCTGGAAGGAGTGG + Intergenic
1114639219 14:24207789-24207811 AGTTAACTCCCTGGAGGGGAAGG - Intronic
1114850497 14:26377529-26377551 TGTCACCACCCTGATGGGAATGG + Intergenic
1115270361 14:31544809-31544831 AATCAACTCCATGGAGGGGAGGG - Intronic
1115292952 14:31793519-31793541 TGTTAACTTCCTGGAGGGCTAGG + Intronic
1118732951 14:68682111-68682133 TGTCAGCAGCCTAGAGGGAAGGG + Intronic
1121112207 14:91320243-91320265 TGTCTCCTCCCTGGAGGTAGGGG - Intronic
1122343365 14:101043220-101043242 TGTGGACTCCCTGGAGGCAGTGG + Intergenic
1124203426 15:27697760-27697782 TGTCAGCTCCCTGGAGTGCTGGG - Intergenic
1125831518 15:42720171-42720193 TGTCTTCTCCTGGGAGGGAAAGG - Exonic
1128484459 15:68071224-68071246 TAGCCACTCCATGGAGGGAAGGG - Intronic
1129169874 15:73801089-73801111 TGAAAACTCCCTGGATGGAGCGG - Intergenic
1129187630 15:73919842-73919864 TGTCAACCCACTGGTTGGAATGG - Intergenic
1130896467 15:88174057-88174079 TCTCACCTCCCTGGAGGGGCAGG - Intronic
1132011217 15:98278060-98278082 TGTGAACTCTCTGCAGGTAAGGG + Intergenic
1132886742 16:2185519-2185541 TATCAGCTCCCTGGAGACAATGG - Intronic
1133612630 16:7447884-7447906 CATCAACCCCCTGGAGGGGAGGG + Intronic
1135550888 16:23397472-23397494 TGTCAATTCCCAGGGGTGAATGG + Intronic
1135773903 16:25239174-25239196 TCTCACCTCCATGGAGGGCAAGG + Exonic
1135864850 16:26091938-26091960 AGTCAAGCCCCAGGAGGGAAGGG - Intronic
1135867616 16:26118746-26118768 TGCCAGGTCCCTGCAGGGAAAGG + Intronic
1136068583 16:27774967-27774989 CGTGAACTCCCTGGAGGGTGTGG + Exonic
1136297925 16:29314213-29314235 TGTCATCTCCCTGGAGGAGCAGG - Intergenic
1141921632 16:87139435-87139457 TGTCAAATCCCATGAGGGCAGGG + Intronic
1142052321 16:87966902-87966924 TGGCAGCTCCCTGGACGGGAGGG + Intronic
1143833569 17:9671761-9671783 TGTGAATGTCCTGGAGGGAATGG + Intronic
1145290977 17:21545683-21545705 AGGCAAGTCCCTGGAAGGAATGG + Intronic
1146160191 17:30555409-30555431 TGTCAGCTCCCGGGAGGCAGAGG + Intergenic
1147674480 17:42195082-42195104 TCTCAACTACCTTGAGGGAGAGG - Intergenic
1147921768 17:43921618-43921640 TGTCATCACCCTGGAGAGGAAGG - Intergenic
1148170175 17:45512774-45512796 TGTCATCACCCTGGAGAGGAAGG - Intergenic
1148170652 17:45516767-45516789 TGTCATCACCCTGGAGAGGAAGG - Intergenic
1148279033 17:46333046-46333068 TGTCATCACCCTGGAGAGGAAGG + Intronic
1148301248 17:46550899-46550921 TGTCATCACCCTGGAGAGGAAGG + Intronic
1148365373 17:47051789-47051811 TGTCATCACCCTGGAGAGGAAGG + Intergenic
1150401261 17:64858370-64858392 TGTCATCACCCTGGAGAGGAAGG - Intronic
1150781372 17:68125377-68125399 TGTCATCACCCTGGAGAGGAAGG - Intergenic
1152781953 17:82230662-82230684 TGGCACCTCACTGGAGGGAGCGG - Intronic
1153741848 18:8137918-8137940 GGTCAACTCCCTGAAGGAAGAGG + Intronic
1157149329 18:45200010-45200032 TCTCAACTCCCTGGTGGCCATGG + Intergenic
1158223913 18:55180806-55180828 TGTCAATTACATGGATGGAAGGG - Intergenic
1158496559 18:57960298-57960320 TACCATCTCCATGGAGGGAATGG - Intergenic
1158727459 18:59986524-59986546 TATCCAGGCCCTGGAGGGAATGG - Intergenic
1160941735 19:1623241-1623263 TCTCATCTCGCTGGAGGGAGAGG - Intronic
1163673806 19:18645214-18645236 TCTAGACTCCTTGGAGGGAAAGG + Intronic
1163733286 19:18962540-18962562 TTTCAAATCCATGGAGGGAGTGG + Intergenic
1166342915 19:42149565-42149587 TTTTAAATCCCTGGAGGGAGAGG + Intronic
1166456249 19:42942453-42942475 TCTCAACTCCCTCGGGGAAAGGG + Intronic
1167333216 19:48868932-48868954 TTCCAAAGCCCTGGAGGGAATGG + Intergenic
1167675431 19:50881498-50881520 TGACAAAGCCCTGGAGAGAAAGG + Intergenic
925331319 2:3060890-3060912 TGTCTACTCTCTGTAGGCAATGG + Intergenic
925834820 2:7934286-7934308 TGGTCACTACCTGGAGGGAATGG + Intergenic
927286372 2:21361211-21361233 TGTCACCTTCCTGGAGAAAATGG - Intergenic
927583027 2:24272295-24272317 TGTCAAATATCTGGAGAGAAAGG - Intronic
929728467 2:44458721-44458743 TCTCATCTCCCTAGAGAGAATGG - Intronic
931697146 2:64879803-64879825 TGTCAGGTTCCTGGAGGGACTGG + Intergenic
932339065 2:70948483-70948505 TGTCATCTCCCTGGAGGTGACGG - Intronic
932825003 2:74930884-74930906 TGTCCACTCCTTGTTGGGAATGG - Intergenic
934494826 2:94788017-94788039 TTTGAGGTCCCTGGAGGGAAGGG - Intergenic
935934906 2:108171152-108171174 TGGCATCTGCCTGGAGGGCAGGG + Intergenic
946305760 2:218856174-218856196 TGTCACCTCCCTGAAGGAATAGG + Intergenic
946917186 2:224535881-224535903 TGTCAAGTCACTGGAGGGTTGGG - Intronic
1168967387 20:1907130-1907152 TGCCACATCCCTGCAGGGAAGGG - Intronic
1171249882 20:23638794-23638816 TGACACCTCTCTGGAGGGCAGGG - Intergenic
1172493808 20:35363556-35363578 TGTTAGTTCCCTGGAGGAAATGG - Intronic
1173859582 20:46274110-46274132 TGTCATCTCCCTTGGGGGAGAGG + Intronic
1173936621 20:46871539-46871561 TCTCATCTCCCTCAAGGGAAAGG - Intergenic
1173993022 20:47317488-47317510 TGTCTCCTCCCTCAAGGGAAAGG + Intronic
1178430849 21:32517654-32517676 TGTCCACTCAGTGGAAGGAAGGG + Intergenic
1178616026 21:34133603-34133625 TGTGGACTCTCTGGAGGGAGGGG + Intronic
1178713268 21:34939677-34939699 TTTCAACTCCCTGGATGGAAAGG - Intronic
1180957373 22:19747048-19747070 TGTCACCTCACTGGAGAGATGGG - Intergenic
1183395676 22:37569466-37569488 TCTAAACTCCCTGGAGGGGAGGG - Intergenic
1183769810 22:39914241-39914263 TGACAACTCCTTGGAGAGAGAGG - Intronic
1184080326 22:42214809-42214831 TGAGCACTCCCTGGAGAGAAAGG + Exonic
1184105486 22:42365369-42365391 TGTCGGCTCCCTGGAAGCAAGGG - Intergenic
950476219 3:13216493-13216515 TGTCCACTCCCTGGACCTAAGGG + Intergenic
952075962 3:29698100-29698122 TGTGAGCTCCCTGAAGGGACAGG + Intronic
953210577 3:40871502-40871524 TGTCAGCTGCCAGGAGGGAGAGG - Intergenic
953396206 3:42572566-42572588 TGTTAACACCCTGGGGGAAAGGG - Intronic
953697949 3:45174388-45174410 TGTCGACTCCTTTGAGTGAAAGG - Intergenic
953718188 3:45333675-45333697 AGTCAACAACCTGGAGGGGACGG - Intergenic
953849361 3:46454453-46454475 TTTCTACTCCCTGCAGGGCAGGG + Intronic
954012052 3:47649830-47649852 TTCCAACTCTCTTGAGGGAAAGG + Intronic
954367567 3:50154731-50154753 ATTCAACTCCCTGGCGAGAAGGG - Intergenic
955656637 3:61251295-61251317 TGTCAACATCCTGGAAGGTAGGG - Exonic
956603850 3:71051802-71051824 TGGTAACTCCCTGGAAAGAAAGG + Intronic
961548911 3:127655749-127655771 TGTCAAGTCACTGGAGTGAGAGG + Intronic
962234301 3:133694281-133694303 TGTCAACTGTGTGCAGGGAAAGG + Intergenic
966915566 3:184582487-184582509 TCGCAACTCCCTGGAGGCATTGG + Intronic
967011702 3:185441428-185441450 TGTAAGCTCCTTGAAGGGAAAGG - Intronic
967946757 3:194810229-194810251 TGTTAAGTCCCTTGAGGGCAGGG + Intergenic
967984400 3:195084509-195084531 TGCCATCTCGCTGGTGGGAAAGG - Intronic
969012939 4:4081902-4081924 TGGTACCTCCCTGGAGTGAATGG - Intergenic
969404895 4:6984605-6984627 TGTGAAGTCTCAGGAGGGAAAGG - Intronic
970978113 4:22064819-22064841 TCCCCACTCCCTGGAGGGATGGG - Intergenic
974017304 4:56659293-56659315 TGTGAACTTCCTGGAAGCAATGG + Intronic
975364059 4:73507634-73507656 TTTCAAGTCCCTGGGGAGAAGGG - Intergenic
976129547 4:81870426-81870448 TGCCAGCTCCATGGAGTGAACGG - Intronic
976358004 4:84143042-84143064 TGTCAGCTCGCTGAAGGGGATGG + Intergenic
977410866 4:96661049-96661071 TTTTAACTCACTGGAGAGAAGGG + Intergenic
978140941 4:105316870-105316892 TCTCTACTCCCTGCAGGGGATGG - Intergenic
979450794 4:120868552-120868574 TATCATCTCTCTGGAGGAAAAGG - Intronic
980512587 4:133812922-133812944 TGTTAACTCCAGGGAGGGGAGGG + Intergenic
981001658 4:139834353-139834375 TGGCAGCTCTCTGGAGGGAGGGG + Intronic
982313208 4:154006537-154006559 TGAGAACTGCCAGGAGGGAATGG + Intergenic
983427455 4:167604898-167604920 TATCAAGTCCCTGGAGTAAATGG - Intergenic
983938826 4:173521698-173521720 GGACAACTCCCTGGAGGGCTGGG + Intergenic
984831889 4:183983612-183983634 TGGCAACTCCCAGGAGGGAAGGG - Intronic
986033067 5:3911262-3911284 TGTGCACCTCCTGGAGGGAATGG - Intergenic
989607060 5:43254655-43254677 TGTGATCTCCCTGGAGGACAGGG + Intronic
991024102 5:62011307-62011329 TCACAACTCCCTGTGGGGAAAGG - Intergenic
993177544 5:84507477-84507499 TGTCAGCTGCCTGTAAGGAAAGG + Intergenic
993588964 5:89770134-89770156 TGTCAACTTTCTTGTGGGAAGGG + Intergenic
994568543 5:101483888-101483910 TGGCAAATCCCAGGGGGGAAAGG + Intergenic
994797940 5:104330602-104330624 TGTGACCTGCCTGGATGGAATGG + Intergenic
997364131 5:133314590-133314612 TGGAATCTCCCTGGAGAGAATGG - Intronic
997381360 5:133440610-133440632 GGTCACCTCCCTGGAGGCACAGG + Intronic
999451431 5:151681179-151681201 TCCCAACTCCCTGGAGGGCCTGG - Intronic
999511373 5:152256146-152256168 TGGGAACTCCTTGGAAGGAAAGG + Intergenic
999929893 5:156420020-156420042 TATCAAGTCCCTGGAAGGAGAGG - Intronic
1001633043 5:173190821-173190843 TGTAAAAAACCTGGAGGGAATGG + Intergenic
1005358584 6:25008843-25008865 TGGCACTTCCCTAGAGGGAATGG - Intronic
1005640449 6:27791533-27791555 TCTGAACCCCCTGGAAGGAAAGG - Intergenic
1005843000 6:29756569-29756591 TGTCTGGTCCCAGGAGGGAATGG - Intergenic
1006410795 6:33872206-33872228 TGTCTACTCCCTGGAAGGCAGGG - Intergenic
1007127907 6:39442772-39442794 TGACAGCTCCCTGAACGGAAAGG + Intronic
1007667832 6:43526251-43526273 TGTAAACTCCCATCAGGGAAGGG - Intronic
1008380076 6:50831437-50831459 TCTCAACTCCATGGCGGGAGTGG + Intronic
1008466052 6:51832120-51832142 TATCAGCTCCTTGGAGGCAAGGG - Intronic
1009390243 6:63136091-63136113 TATCACATCCCTGGAGGGATTGG - Intergenic
1014422266 6:121260754-121260776 TGCCAAGTTCCTGGAGGGAGGGG + Intronic
1016904799 6:149137922-149137944 TGGCAACTACATGGAGGAAAGGG + Intergenic
1017256536 6:152339988-152340010 TGTCAACTCCCTGGGAGCAAGGG - Intronic
1019162707 6:170079895-170079917 TCACAACTCCCTGTGGGGAAGGG - Intergenic
1019267741 7:128097-128119 TGTCATCACCCTGGAGACAAAGG - Intergenic
1023837392 7:44076426-44076448 CATCAACTCCCTAGAGGGAAGGG - Intronic
1024453883 7:49580559-49580581 TGTCAGCTCCCTGGAGGTAAGGG + Intergenic
1025611161 7:63076802-63076824 TGTCGCCTCCCAGGAGGGCACGG - Intergenic
1026811081 7:73465800-73465822 GGTTTACTCTCTGGAGGGAAAGG - Intronic
1026948886 7:74334149-74334171 TGATGACTCCCTGGAGGGATAGG + Intronic
1028204587 7:88001945-88001967 TGTCATCTCTCTGGAGGTCAGGG + Intronic
1029284782 7:99458027-99458049 TCCCAGCTCCCTGGAGGGCAGGG - Intronic
1029954316 7:104621577-104621599 TGTCAACTCCCTGGAGGGAAAGG - Intronic
1033305118 7:140219550-140219572 AGTCATCTGCCTAGAGGGAAAGG + Intergenic
1035363186 7:158327827-158327849 TGCCAGCTCCCTGCAGGGAGGGG - Intronic
1035446907 7:158949413-158949435 TGTCTACTCCCTGGAGTGAGTGG - Intronic
1035710301 8:1708653-1708675 GGTCACCTCCCTGGATGGACTGG - Intergenic
1037737441 8:21578890-21578912 TGTCAGCTCCCTGATGGCAATGG + Intergenic
1038138866 8:24821342-24821364 TCTCCACTCCCTGGACTGAAGGG + Intergenic
1038260502 8:25989256-25989278 TGTCAACACCCAGCAGAGAAGGG - Intronic
1038969569 8:32617870-32617892 TATCACCAACCTGGAGGGAAAGG - Intronic
1040518461 8:48153820-48153842 TGTCAAGACCCTGCTGGGAAAGG - Intergenic
1045564402 8:103298923-103298945 TCTCAGGTCCCTGGGGGGAACGG + Exonic
1045776889 8:105815291-105815313 GTTCCACTTCCTGGAGGGAAGGG + Intergenic
1047324246 8:123821136-123821158 AGTCACCTCCCTAGAGGGAAAGG - Intergenic
1048971924 8:139649972-139649994 TGTCATCTCCCTGAAGGCAGTGG + Intronic
1049427153 8:142542632-142542654 TGTGAGCTCCCTGGAGGTGAGGG + Exonic
1049832566 8:144711430-144711452 TGTCCACTTCCTGGAGTGTAGGG - Intergenic
1051160207 9:14199235-14199257 TGGCAGCTCCCTGGAAGGCAAGG + Intronic
1052194899 9:25700340-25700362 TGTCAACTCCTTGAAGGCAAGGG - Intergenic
1052718709 9:32148856-32148878 TCTAAACTCCCTGGGGGAAAGGG - Intergenic
1052877098 9:33575437-33575459 TTTGATGTCCCTGGAGGGAAGGG + Intergenic
1053120784 9:35546376-35546398 TGTCACCTCCCTGGAAGTCAGGG - Intronic
1053265168 9:36707535-36707557 TGTAAACTCCCTGACGGCAAGGG + Intergenic
1053498907 9:38568957-38568979 TTTGATGTCCCTGGAGGGAAGGG - Intronic
1053662290 9:40292342-40292364 TTTGAGGTCCCTGGAGGGAAGGG + Intronic
1053912741 9:42922509-42922531 TTTGAGGTCCCTGGAGGGAAGGG + Intergenic
1054374418 9:64438571-64438593 TTTGAGGTCCCTGGAGGGAAGGG + Intergenic
1054522320 9:66083942-66083964 TTTGAGGTCCCTGGAGGGAAGGG - Intergenic
1055084374 9:72299292-72299314 TGTCCATACCCTGTAGGGAAAGG + Intergenic
1055434368 9:76277554-76277576 GCACAACTCCCTGGAGGGACAGG - Intronic
1057305368 9:93909213-93909235 TGTCAGCTCCGTGGAGGGCTGGG + Intergenic
1057836029 9:98446007-98446029 TTTCAAATCCCTAGAGTGAATGG + Intronic
1057904593 9:98974326-98974348 TCCCACCTCCCTGGAGGGACAGG - Intronic
1058851380 9:109014349-109014371 TGACAACTCACTTGAGGGGAAGG + Intergenic
1059256184 9:112933509-112933531 TTTAAAGTCCCTGGAGGGTAGGG - Intergenic
1059277063 9:113106377-113106399 TGGCAACTCCCTGGGGGCACAGG - Intergenic
1059279188 9:113118174-113118196 TGGCAACTCCCTGGGGGCACAGG + Intergenic
1059579018 9:115523345-115523367 AGTCAATTCCCAGGAAGGAAAGG - Intergenic
1060944385 9:127561293-127561315 TGTCAACTTCCTGGAGCACATGG + Intronic
1187683455 X:21792355-21792377 TGACAACACCCTGGTGGGAGAGG - Intergenic
1189879632 X:45476925-45476947 TGTCCAATCCCTTGAGGGTATGG + Intergenic
1190476807 X:50836318-50836340 TGTTAACTCCCAGGTGGAAAAGG - Intergenic
1190688571 X:52895331-52895353 TGTCCAGCCCCTGGAGGGAGAGG - Intronic
1190697412 X:52960461-52960483 TGTCCAGCCCCTGGAGGGAGAGG + Intronic
1191225211 X:58035247-58035269 ACTGAACTCCCAGGAGGGAACGG - Intergenic
1192223456 X:69212750-69212772 TGTGAGCTCCCTGGAGGGCCTGG - Intergenic
1192229122 X:69252621-69252643 GTTCAAGGCCCTGGAGGGAAAGG + Intergenic
1193427354 X:81355595-81355617 GGTCAACTCCCAGAAGGAAAGGG - Intergenic
1199500148 X:148499694-148499716 AGCCAATTCCCTGGAGGGAAAGG - Intergenic
1199980336 X:152917238-152917260 GGTGAGCTCCCTGGAGGGACTGG - Intronic