ID: 1029955234

View in Genome Browser
Species Human (GRCh38)
Location 7:104631824-104631846
Sequence CACTTACAAAGGTTGTAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029955234_1029955237 20 Left 1029955234 7:104631824-104631846 CCTAGCTACAACCTTTGTAAGTG 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1029955237 7:104631867-104631889 TTAACTTATTAGCATCCTTGAGG 0: 1
1: 0
2: 1
3: 6
4: 125
1029955234_1029955239 25 Left 1029955234 7:104631824-104631846 CCTAGCTACAACCTTTGTAAGTG 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1029955239 7:104631872-104631894 TTATTAGCATCCTTGAGGGCAGG No data
1029955234_1029955238 21 Left 1029955234 7:104631824-104631846 CCTAGCTACAACCTTTGTAAGTG 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1029955238 7:104631868-104631890 TAACTTATTAGCATCCTTGAGGG No data
1029955234_1029955240 26 Left 1029955234 7:104631824-104631846 CCTAGCTACAACCTTTGTAAGTG 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1029955240 7:104631873-104631895 TATTAGCATCCTTGAGGGCAGGG 0: 1
1: 0
2: 1
3: 14
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029955234 Original CRISPR CACTTACAAAGGTTGTAGCT AGG (reversed) Intronic
904248661 1:29206595-29206617 CACTTAGAAAGATGTTAGCTTGG - Intronic
905875649 1:41430686-41430708 CAGTTAAAAATGTTGTACCTGGG + Intergenic
906087064 1:43144989-43145011 CACTTACCAAGGCTGAAGGTGGG - Intergenic
908330598 1:63067189-63067211 CACTTTCAAAGGTTGTTGGAGGG + Intergenic
911450874 1:98058957-98058979 CACTTCCTATAGTTGTAGCTTGG - Intergenic
913532136 1:119740992-119741014 AACTTACTAAGGTGGTACCTTGG + Intronic
914665533 1:149829444-149829466 TACTGTCAAAGGTTGAAGCTGGG - Intergenic
914670232 1:149864350-149864372 TACTGTCAAAGGTTGAAGCTGGG + Intronic
914727330 1:150338813-150338835 CACTTACAAATGCAGGAGCTTGG - Intronic
916755007 1:167761006-167761028 AACTTTCAAAGGTTTTAGATAGG + Intronic
922097257 1:222453037-222453059 AACTTGCAAATGTTGTACCTGGG - Intergenic
922678548 1:227569979-227570001 CAGTAAAAAGGGTTGTAGCTGGG + Intronic
1063260336 10:4381727-4381749 CACTTACAATGGTTCTAGGTGGG + Intergenic
1063685228 10:8230620-8230642 CACTTGCAAAGGTTGTGGGGAGG + Intergenic
1068070573 10:52189540-52189562 CACATACAAGGGATCTAGCTTGG + Intronic
1069134616 10:64748519-64748541 CACTTACATAGATTCTATCTGGG + Intergenic
1075158599 10:120002600-120002622 CACTTAGAAAGGTTTTATCTTGG + Intergenic
1082127004 11:48445150-48445172 CAGTTTCAAAGTTTGTGGCTTGG + Intergenic
1082560586 11:54616131-54616153 CAGTTTCAAAGTTTGTGGCTTGG + Intergenic
1085995480 11:81907722-81907744 CATTTACAAAGGCTATAGATGGG - Intergenic
1090104702 11:123840235-123840257 CACTTACCAATGATGTAGTTTGG + Intergenic
1095408996 12:41901644-41901666 CACTTACAGAGGCTGGAGGTGGG + Intergenic
1098652570 12:72991535-72991557 CACTTCCGAAGGTTATAGCTTGG - Intergenic
1099638072 12:85242021-85242043 CAATTACAAACCTTGTAGGTAGG + Intronic
1099947673 12:89263384-89263406 CAGTTACAAAGGTTGAATGTTGG + Intergenic
1100571157 12:95844144-95844166 CAGTTACACAGGTGGTAGATGGG + Intergenic
1103022956 12:117551126-117551148 GAAGTACAAGGGTTGTAGCTTGG + Intronic
1103054543 12:117808379-117808401 CACTTATCGAGGTTGGAGCTGGG - Intronic
1106048811 13:26170788-26170810 AACTTACAAAGGTTGGAGAAAGG + Intronic
1107023487 13:35775672-35775694 CCCTTAAAAAGGATGTAGCCTGG + Intronic
1110081731 13:71322050-71322072 ATCTTACAAATGCTGTAGCTTGG + Intergenic
1131707800 15:95017303-95017325 CACTTAAAAACATTGTATCTTGG - Intergenic
1133054352 16:3138155-3138177 CACTTAGCAAGGGGGTAGCTGGG - Intronic
1133491174 16:6270260-6270282 CTCTTACAAAGGGTGTATATAGG - Intronic
1137815860 16:51396911-51396933 CATTTACAAAAGCTGTAGTTAGG - Intergenic
1138114703 16:54351122-54351144 CACTTACAAAGGGTTTATCATGG - Intergenic
1138820806 16:60256956-60256978 CACATACCAAGTTTGTAGCAAGG - Intergenic
1138822859 16:60282417-60282439 CACTTACAAAGAGTGTGCCTCGG + Intergenic
1139231087 16:65283251-65283273 CACTGACAGAGGATGCAGCTGGG + Intergenic
1140549887 16:75854529-75854551 CACTTAAAAATGTTTTAGCCAGG + Intergenic
1150205678 17:63404781-63404803 GACTAACAGAGTTTGTAGCTAGG + Intronic
1158733167 18:60048482-60048504 AAATTACAAAAGTTGAAGCTGGG + Intergenic
1158869730 18:61673947-61673969 CTCTTACAATGCCTGTAGCTGGG + Intergenic
1159130883 18:64278916-64278938 CACTTACAAAAATTGTGGGTTGG + Intergenic
1159913841 18:74171676-74171698 CACAAACAAGGGTTGTAACTTGG - Intergenic
1162615609 19:11798385-11798407 GCCTTAGAAAGGCTGTAGCTAGG + Intronic
1162848507 19:13412770-13412792 CTTTTAGAAAGGTTGTAGCTGGG - Intronic
925988273 2:9233472-9233494 CACTTACAAAAGTTGTATGGTGG + Intronic
926127360 2:10279747-10279769 AACTTACAAAGGGTGGAGCTGGG - Intergenic
930702315 2:54470883-54470905 CACATTCAAAGGCTGTAGGTTGG - Intronic
931018603 2:58016094-58016116 CACTTACAAATCTTTTATCTTGG + Intronic
931842937 2:66173583-66173605 CACTTAAGAAGATTGTATCTTGG + Intergenic
940339296 2:152562935-152562957 TCCTTACTAAGGTGGTAGCTTGG - Intronic
941206544 2:162580229-162580251 CACTTACAAATGATGTAAGTTGG + Intronic
1184277309 22:43417149-43417171 CACTTAAAAACCTTTTAGCTGGG - Intronic
952946148 3:38478970-38478992 CCCTTACAAATGCTGAAGCTGGG + Intronic
953715389 3:45313020-45313042 CTCTTACTAAGGTTGTGGTTTGG - Intergenic
954226480 3:49184923-49184945 CACTTAAAAATGTTATAGGTCGG - Intronic
955995757 3:64678876-64678898 CTCTTCCAAAGGTTGCTGCTGGG - Intronic
956283274 3:67582020-67582042 AACTTTCAAAGGATCTAGCTTGG - Intronic
957502778 3:81078214-81078236 TTGCTACAAAGGTTGTAGCTTGG + Intergenic
961605570 3:128092874-128092896 CACTTAAAAATGTTGTACATAGG + Intronic
964962321 3:162442280-162442302 CACTTAAAAATGGTGTAACTTGG - Intergenic
972474071 4:39434151-39434173 CACTTACAAGGGCTGTAACATGG - Intronic
974167789 4:58226083-58226105 AAGTTACAAAGGCAGTAGCTTGG - Intergenic
974223645 4:59009700-59009722 CAGTTCTGAAGGTTGTAGCTTGG + Intergenic
975299918 4:72777886-72777908 CAATTACAGAAGTTGTTGCTAGG - Intergenic
976318091 4:83681002-83681024 CAATTACAAATGCTGTAGCAAGG + Intergenic
980977838 4:139628188-139628210 CACTTAGGAGGGATGTAGCTTGG - Intergenic
992149279 5:73886299-73886321 CATGTATAAAGGTTTTAGCTTGG - Intronic
998100133 5:139425823-139425845 CACTTACAAAGATAGAAGATAGG - Intronic
1001631752 5:173180432-173180454 CACTTACTGGTGTTGTAGCTTGG + Intergenic
1008205505 6:48651500-48651522 CAATTACAAAGGCTTTACCTGGG - Intergenic
1012408729 6:98931234-98931256 CAGTTTCAAAGTTTGTAGCTTGG - Intronic
1014103570 6:117538376-117538398 CACTTATAAAGGATGTGACTTGG + Intronic
1015524372 6:134161377-134161399 GTTTTACAAAGATTGTAGCTAGG + Intergenic
1017736705 6:157371282-157371304 CAGTTACAAAGATAGTGGCTGGG - Intergenic
1017750520 6:157486959-157486981 CACCTACCAATGCTGTAGCTGGG - Intronic
1021155450 7:17204183-17204205 CACTTACACATATTGAAGCTAGG + Intergenic
1023019954 7:36002850-36002872 CACTTAAGAAGGTTGGAGGTAGG + Intergenic
1023355341 7:39361831-39361853 CACCTACAAATGTTTGAGCTCGG + Intronic
1026480576 7:70775714-70775736 CACTTAGAAAATATGTAGCTGGG + Intronic
1028835183 7:95366740-95366762 CACTTACAAATTGTGTAACTTGG + Intronic
1029955234 7:104631824-104631846 CACTTACAAAGGTTGTAGCTAGG - Intronic
1033250486 7:139754120-139754142 CACTTCCAAAGGGTGTCTCTTGG - Intronic
1049522803 8:143102966-143102988 CACTTACTAAGCATGTAGCTAGG + Intergenic