ID: 1029956636

View in Genome Browser
Species Human (GRCh38)
Location 7:104647237-104647259
Sequence GCCTCTCCCTTTTTTCAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 305}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029956633_1029956636 28 Left 1029956633 7:104647186-104647208 CCTAAGTTTTTCAAGAAGAGGAA 0: 1
1: 0
2: 3
3: 45
4: 348
Right 1029956636 7:104647237-104647259 GCCTCTCCCTTTTTTCAGACAGG 0: 1
1: 0
2: 1
3: 19
4: 305
1029956635_1029956636 -10 Left 1029956635 7:104647224-104647246 CCAACTCTTGAAAGCCTCTCCCT 0: 1
1: 0
2: 1
3: 26
4: 239
Right 1029956636 7:104647237-104647259 GCCTCTCCCTTTTTTCAGACAGG 0: 1
1: 0
2: 1
3: 19
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029956636 Original CRISPR GCCTCTCCCTTTTTTCAGAC AGG Intronic
900687739 1:3959273-3959295 GCCTCTTTGTTTTTTGAGACAGG + Intergenic
901402941 1:9026726-9026748 GCCTCTTTTTTTTTTGAGACAGG + Intergenic
901543612 1:9938556-9938578 GCCTTTGGCTTTTTTGAGACAGG + Intronic
901709885 1:11105586-11105608 CTCTGTCCCTTTTCTCAGACCGG + Intergenic
902820512 1:18940366-18940388 TTCTCTCCCTTTTGTCAGAGAGG - Intronic
903543816 1:24111306-24111328 GCCTCTCCCCTTCTTCAGGAGGG + Intronic
904567883 1:31438707-31438729 GACTCTTCCTTTTTCAAGACAGG - Intergenic
905419019 1:37826290-37826312 TCCCCCCCTTTTTTTCAGACGGG + Intronic
905805331 1:40872783-40872805 GCCTTTCCTCTTTTTCTGACAGG + Intergenic
906329153 1:44870164-44870186 CTCTCTCTCTTTTTTGAGACGGG - Intronic
907368186 1:53979808-53979830 GCCTCTTTTTTTTTTAAGACAGG - Intergenic
907873780 1:58466353-58466375 GCCTCTACATTTTTTCCCACAGG + Intronic
908023022 1:59917777-59917799 GCCCCTGCCTTTTTTCTGCCTGG + Intronic
909067657 1:70954958-70954980 GCTTCTCTCTTTTTTCATATAGG - Intronic
910584696 1:88866412-88866434 TCTTTTCCTTTTTTTCAGACAGG + Intronic
910979610 1:92946438-92946460 GACTCTCCCCTTTTTTAGAAGGG - Intronic
913238283 1:116804136-116804158 GTCTCTACCTTTTTTCATTCTGG - Intergenic
915312589 1:155011828-155011850 GCCTCCCCCTTCTTTCTGCCAGG - Intronic
915607772 1:156964100-156964122 GCATCTCCATTTGTTCAGAGAGG - Intronic
916426446 1:164685709-164685731 GCATTTCCCCTTTTTCAGAAGGG + Intronic
917825347 1:178814436-178814458 CTCTCTCTCTTTTTTTAGACAGG + Intronic
918219814 1:182426583-182426605 GCCTCTCCCTTTTCTGAGAATGG + Intergenic
920448376 1:206037846-206037868 GCCTCTTCCTTTTTCAAAACTGG + Intronic
920830257 1:209458183-209458205 GCCTCTTCCTCTTTTTACACTGG + Intergenic
924937108 1:248781394-248781416 GCCTTAGCTTTTTTTCAGACAGG - Intergenic
1062834808 10:628723-628745 GCCTCTTCATCTTCTCAGACGGG - Intronic
1063345472 10:5307941-5307963 CCTTCTCCCTTTCTTCATACTGG - Intergenic
1064647326 10:17472853-17472875 GCCTTTTCTTTTTTTGAGACAGG - Intergenic
1067238062 10:44468278-44468300 GCCTCTCTCTTTCTCCAGATAGG - Intergenic
1068599561 10:58942189-58942211 GCCTCTTCCTTTTCTCTGTCTGG - Intergenic
1069197930 10:65576251-65576273 TCCTCTCCCTTTGTTGAAACTGG - Intergenic
1071156707 10:82697953-82697975 CCCTCTCCCTTTCGTAAGACAGG - Intronic
1073027298 10:100497338-100497360 TCCTCTCCCTGTTTCCAAACAGG - Intronic
1073618010 10:105017515-105017537 GCCTCCCCATTTTTTTAGACTGG - Intronic
1074658168 10:115618528-115618550 TCCTTTTTCTTTTTTCAGACTGG + Intronic
1074927966 10:118093012-118093034 AACACTCCCTTTTTTGAGACAGG - Intergenic
1075508816 10:123052054-123052076 GCCTCTCTCCTTTTTCAAAGTGG + Intronic
1076248894 10:128968997-128969019 GCCTCTCTCTTTGCTCAGGCTGG - Intergenic
1077007969 11:368074-368096 GCCCCACCCCTTTTTGAGACAGG - Intergenic
1077896014 11:6454077-6454099 GCCTCCCCATTGTTTCAGAGTGG - Intronic
1078135776 11:8650365-8650387 TCCTCATCCTTTTTTGAGACAGG - Intronic
1079012029 11:16836463-16836485 GCTTCTCTCTTTATTCATACAGG - Intronic
1080377559 11:31731108-31731130 CTCTCTCAGTTTTTTCAGACTGG - Intronic
1080637809 11:34139061-34139083 GCCTCTCCTTCTTTCCAGGCTGG - Intronic
1080871486 11:36240755-36240777 TTCTCTCCCATTTTACAGACAGG - Intergenic
1081401546 11:42648931-42648953 CCTTCTCCCTCTTTTCAGACTGG + Intergenic
1083141627 11:60726687-60726709 GCCCCTCTCTTTTTTAAGATTGG + Intergenic
1083154221 11:60812705-60812727 CCCTCTCCTTTTTTTCAGCCAGG - Intergenic
1083716858 11:64582532-64582554 GCCACTGCCATTTTTCAGAAAGG + Intergenic
1084010488 11:66345809-66345831 TCACCTCCCTTTTTACAGACAGG + Exonic
1084102289 11:66957793-66957815 TCCTCTACTTTGTTTCAGACGGG - Intronic
1084916893 11:72435188-72435210 GCCTATCTCTTTTTTCAGCCTGG + Intergenic
1085276715 11:75304882-75304904 TCCTCTCTCTTTTTAAAGACAGG - Intronic
1085844996 11:80054919-80054941 GCCTCTTCCTTTGTTCAGTGTGG - Intergenic
1088504433 11:110514482-110514504 GCCTCTCATTTTTTTCTCACTGG - Intergenic
1089275573 11:117333532-117333554 TCCTCTCTCTTTTTTGAGACAGG + Intronic
1089767652 11:120779509-120779531 GCCTCACCCTTGTTCCAGAATGG - Intronic
1091628062 12:2137970-2137992 GCCACTCCCTGTTTTCTCACTGG + Intronic
1091806321 12:3358975-3358997 CCCTCTCCTCTTTTTCAGAAAGG - Intergenic
1092724516 12:11472192-11472214 GCCCCTCCTTTTTTTAAGGCTGG + Intronic
1094064891 12:26351647-26351669 GTCTCTTCCTTTTTTGAGACAGG - Intronic
1094355637 12:29574694-29574716 GCCTCTTCCTTGTTTTATACGGG + Intronic
1094454148 12:30613798-30613820 CCCTTTCCCTTTTTTAAGATGGG - Intergenic
1094680967 12:32666711-32666733 CCCTCCCCCTTTTTTCTGAGTGG - Intergenic
1096388082 12:51208292-51208314 CTCTCTCTCTTTTTTGAGACAGG - Intronic
1096758760 12:53822295-53822317 TCCTTCTCCTTTTTTCAGACAGG + Intergenic
1096986193 12:55759741-55759763 GCCTTTTTCTTTTTTGAGACAGG + Intronic
1100828170 12:98493972-98493994 TTCTCTCCTTTTTTTGAGACAGG - Intronic
1101108905 12:101466652-101466674 GCCTCTCTCTGTTGCCAGACTGG - Intergenic
1101456927 12:104842614-104842636 ACCTCTCCCATTTTACAGAGGGG + Intronic
1101887472 12:108678390-108678412 GTTTCTCTCTTCTTTCAGACTGG - Exonic
1102917520 12:116765532-116765554 GCTCGTGCCTTTTTTCAGACTGG - Intronic
1103627403 12:122230549-122230571 GTCTCACGCTCTTTTCAGACTGG - Exonic
1104258688 12:127162964-127162986 ACCTTCCCCTTTTTTCAGACTGG + Intergenic
1105441082 13:20415746-20415768 GGCTTTCCCGCTTTTCAGACTGG + Intronic
1106177538 13:27344031-27344053 GCCTCTCCCTTTTAGCACAATGG - Intergenic
1107246487 13:38302605-38302627 GCCTATCCCTTTTTACAGCTGGG + Intergenic
1110682934 13:78337564-78337586 TCTTCTTTCTTTTTTCAGACAGG - Intergenic
1111185662 13:84732095-84732117 TCCTTTTCCTTTGTTCAGACAGG + Intergenic
1116904800 14:50394242-50394264 GCCTCTCCCTGTGTACAGAGAGG + Intronic
1118297954 14:64587762-64587784 TCCTCTTTTTTTTTTCAGACAGG + Intronic
1121045017 14:90781574-90781596 GCCGCTTCCTTTTCTGAGACAGG - Intronic
1121248308 14:92480590-92480612 GCCTTTCCCTTTTTTAATATAGG + Intronic
1121416505 14:93782935-93782957 CTCTCTCCTTTTTTTGAGACAGG + Intronic
1121578922 14:95011856-95011878 GCCTCTGCGTTTTCTCAGCCCGG + Intergenic
1121831455 14:97055801-97055823 GCCACTTCCTTTATTCAGCCAGG - Intergenic
1123878852 15:24655210-24655232 GCATCTGTCTTTTTGCAGACAGG + Intergenic
1125129271 15:36262658-36262680 ATCTCTCCTGTTTTTCAGACAGG + Intergenic
1125670510 15:41468972-41468994 CTCTCTCTCTTTTTTGAGACAGG + Intronic
1126204365 15:46027034-46027056 GCCTCTCTTTTTTTTAAGATAGG + Intergenic
1126252010 15:46578527-46578549 GGCTCTCCCTTATTTAAGAAGGG + Intergenic
1127832861 15:62766229-62766251 GCCTCTGTCATTTTTCAGAGGGG + Intronic
1127985526 15:64067544-64067566 GCCTGTGCCTTTGTTCTGACTGG - Intronic
1127995464 15:64151316-64151338 GCCTTTCCCTCCTTTCAGCCTGG - Intergenic
1128185096 15:65638110-65638132 TCCTCTCCCTGTTTGCAGCCGGG + Exonic
1128316043 15:66660025-66660047 CTCTCTTTCTTTTTTCAGACAGG + Intronic
1128665272 15:69533027-69533049 GCCTCTCCCATTGTACAGACTGG + Intergenic
1129881614 15:79010380-79010402 CACTCTCCCATTTTGCAGACAGG - Intronic
1130989440 15:88867317-88867339 TCCTCTGCCTCTTTTCAGATAGG - Intronic
1131380343 15:91958448-91958470 GCCTCTCCCATTTCCCAGTCGGG + Intronic
1132487831 16:205182-205204 GCCTCTTCTTTTTTAGAGACAGG + Intronic
1132634555 16:936982-937004 GCCTCACGCTTTTATCAGAAGGG + Intronic
1134306633 16:13038936-13038958 GTCTCACTCTGTTTTCAGACTGG + Intronic
1134473412 16:14548945-14548967 CCCTCTTCCTTTTCTGAGACAGG - Intronic
1134643091 16:15844842-15844864 GGCTTTCTCTTTTTTGAGACAGG - Intronic
1135381856 16:22002370-22002392 GCCTCTCAGTTTCATCAGACCGG - Intergenic
1136089905 16:27911294-27911316 TCCTCTCTCTCTTTTGAGACAGG + Intronic
1139357790 16:66377582-66377604 GCCTCTCCCTCTGGCCAGACAGG + Intronic
1139380041 16:66524817-66524839 GACTCTGCCTCTTTCCAGACAGG - Intronic
1139402649 16:66695335-66695357 CTCTCTCTCTTTTTTGAGACCGG - Intronic
1139518870 16:67468284-67468306 TCCTTTTCCTTTTTTAAGACAGG - Intronic
1140381879 16:74496260-74496282 GCCTCCCCAATTTTTGAGACAGG - Intronic
1140485143 16:75287771-75287793 GCTTCTTCTTTTTTTGAGACAGG - Intergenic
1140657617 16:77156632-77156654 CTCTCTCTCTTTTTTTAGACAGG - Intergenic
1140887659 16:79258979-79259001 GGATCTCCCTTCTTTCAGCCTGG - Intergenic
1141023437 16:80520311-80520333 TTCTCTCCCTTTTCTCAGATGGG - Intergenic
1141109718 16:81262314-81262336 GACTCTCCCTTTCTTGAGTCAGG - Intronic
1141151885 16:81570099-81570121 GCCTCACCCCTTCTGCAGACGGG + Intronic
1141613701 16:85198266-85198288 TCCTCTCCCCTTTTACAGCCAGG - Intergenic
1143026466 17:3944529-3944551 GCCCCTCCCTTTCCGCAGACAGG - Intronic
1143042114 17:4046357-4046379 GCCTTTCCCTATTGTCACACAGG + Intronic
1143067531 17:4262156-4262178 GTCTCTCTCTTTTTTAAGACAGG + Intronic
1143465934 17:7136450-7136472 GAGTCTCTCTTCTTTCAGACTGG - Intergenic
1143790420 17:9290789-9290811 GCCTTTCCCCTTTTCCAAACAGG - Intronic
1144113436 17:12062339-12062361 GCCTTTGTCTTTTTTCAGACAGG + Intronic
1144635849 17:16908533-16908555 GCCTCTGCCTTCCTTCAGCCGGG + Intergenic
1144951466 17:18996698-18996720 GCCACTCCCATTTTCCAGAGGGG + Intronic
1145825772 17:27876200-27876222 GCATCTCCCTTTTTCCAGTTGGG - Intronic
1147735942 17:42638361-42638383 GCTTTTCCTTTTTTTGAGACAGG + Intergenic
1147886358 17:43687100-43687122 GCATTTTCTTTTTTTCAGACGGG + Intergenic
1148008895 17:44458527-44458549 TCCTTTCCTTTTTTTGAGACAGG + Intronic
1148521002 17:48274882-48274904 GCCTCTTCCTTTTTGGAAACAGG - Intronic
1150365150 17:64576197-64576219 CCCTCTCTTTTTTTTGAGACAGG - Intronic
1152124792 17:78439967-78439989 GCCTCACTTTTTTTTGAGACAGG + Intronic
1152585554 17:81187998-81188020 GCCTTCCCCCTTTTGCAGACAGG - Intergenic
1153242845 18:3046359-3046381 GCCTCACACATTCTTCAGACTGG - Intergenic
1153918393 18:9766224-9766246 GGCTCTCACTCTTTCCAGACAGG + Intronic
1155478877 18:26263719-26263741 CTCTCTCTCTTTTTTGAGACAGG + Intronic
1157537149 18:48468250-48468272 GCCTCTCCCTTTTGTTTGTCAGG - Intergenic
1159048671 18:63396256-63396278 GCCTTTTCTTTTTTTAAGACAGG + Intronic
1159055716 18:63461726-63461748 CTCTCTCTCTTTTTTGAGACAGG + Intergenic
1160061466 18:75532756-75532778 TCCTTTCCTTTTTTTGAGACAGG + Intergenic
1160394441 18:78561633-78561655 GCTTCTGCCTGTTTTCAGATTGG + Intergenic
1161081209 19:2311088-2311110 GCCCCAGCCTTTTTTAAGACAGG + Intronic
1161261802 19:3341873-3341895 GCCTGTCCCATTTTACAGATGGG - Intergenic
1161360409 19:3845785-3845807 TCCTCTTCTTTTTTTGAGACAGG - Intronic
1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG + Intronic
1161717871 19:5886923-5886945 GCCTCTCTTTTTTTAGAGACAGG + Intronic
1161926382 19:7303440-7303462 TTCTCTCTCTTTTTTGAGACAGG - Intergenic
1162821643 19:13226790-13226812 GCCTCTCCATTGTTCCAGAGTGG - Intronic
1162970859 19:14180553-14180575 GCCTGTTTGTTTTTTCAGACAGG + Intronic
1163574318 19:18101634-18101656 GAGTCTCTCTTTTTTTAGACAGG + Intronic
1163644970 19:18483996-18484018 GCATCTGCCTTTCTTCAAACAGG + Intronic
1163703325 19:18798056-18798078 GCCTTTCCTTTTCTTGAGACAGG - Intergenic
1165779554 19:38424423-38424445 ACCTCTACCCTTTTTCAGACAGG + Intronic
1167609503 19:50500486-50500508 CCCTCTCCCTTTCTGCAGCCTGG + Intergenic
1167689539 19:50976325-50976347 CTCTCTCCCATTTTACAGACAGG + Intergenic
1168319866 19:55502659-55502681 CTCTCTCTCTTTTTTGAGACAGG + Intronic
925732154 2:6926947-6926969 AACTCTCCCTTGTTTCAGAAAGG - Intronic
929619718 2:43342208-43342230 TATTCTCCCTTTTTTTAGACAGG - Intronic
930121833 2:47766987-47767009 GCATCTCCCTCTTTGCACACAGG - Intronic
931276631 2:60749458-60749480 GATTCTTCCTTTTTTGAGACAGG - Intergenic
932774371 2:74518650-74518672 GTCTCTCTCTTTTTAGAGACAGG + Intronic
933385336 2:81603517-81603539 GCCTTTCCCTTTTTCCAGAAGGG - Intergenic
935145392 2:100391913-100391935 GCCTCTACCTTTTCTCAGAATGG - Exonic
935623922 2:105152739-105152761 GCCTCTCCCTTTCTACAGGAAGG + Intergenic
938142263 2:128805092-128805114 GCTTTTCCATTTTTTCAGCCTGG + Intergenic
938938217 2:136146271-136146293 GCATCTCCCTATTGTCAGGCCGG - Intergenic
938967681 2:136402931-136402953 GCCTCTACCCTTTTTCACAATGG + Intergenic
940292194 2:152087877-152087899 GTCTCTTTCTTTTTTTAGACAGG - Intronic
941052135 2:160746922-160746944 GCTTTTCCCTTTGCTCAGACTGG + Intergenic
944623306 2:201541893-201541915 GCCTCTCTATTTTTTGAGATAGG + Intronic
944793003 2:203152691-203152713 TTCTCTCCCTTTTTTAAGATAGG + Intronic
944854129 2:203750024-203750046 GCCACTCCCTGGTTTTAGACTGG + Intergenic
945257202 2:207812629-207812651 GCCTAGCCCTTTTTGCAGCCCGG - Intergenic
945331411 2:208543497-208543519 GCCTCTCCCTTTTCTCTCTCTGG + Intronic
945997650 2:216451582-216451604 GCATCCCCCTTTTTACAGAGAGG + Intronic
946839591 2:223807259-223807281 GTCTCTCTCTTTTTTGAGACAGG - Intronic
946845949 2:223859219-223859241 CTCTCTCCCTCTTTTGAGACAGG + Intronic
947496055 2:230638012-230638034 CCCTCTCCTTTTTTTGGGACAGG - Intergenic
947747221 2:232514634-232514656 TCCTTTCCTTTTTTTCAGTCTGG - Intergenic
947938891 2:234031274-234031296 GTGACTCCCTTTTTGCAGACAGG - Intergenic
948186499 2:236025735-236025757 GCGTCTCCTTTTTTTAAAACTGG - Intronic
1169043461 20:2516317-2516339 TCCCCTCCCTTTTTGAAGACAGG - Intronic
1169204947 20:3734160-3734182 CCCGCTCCTTTTTTTGAGACAGG - Intronic
1169926951 20:10793752-10793774 GCCTCTCCATTTTGTCATTCTGG - Intergenic
1170977199 20:21176008-21176030 GCCTCCATTTTTTTTCAGACAGG - Intronic
1172892674 20:38278163-38278185 TCCTCTCCCTCTTTTCCCACAGG + Intronic
1173438034 20:43050206-43050228 GTCTCTCCCTGTTTTCCAACAGG - Intronic
1175162626 20:57020458-57020480 GCCTCTCTCTCTTTTCATTCTGG - Intergenic
1175210360 20:57350447-57350469 GCCTCTCCCTGTTTGCCCACTGG - Intergenic
1177335539 21:19720913-19720935 TCCTCTCCCTTTTTTCAGAAGGG + Intergenic
1178040640 21:28637104-28637126 TCCTCTCTTTGTTTTCAGACTGG + Intergenic
1178316113 21:31568110-31568132 TCTTCTTCCATTTTTCAGACAGG + Intergenic
1178817629 21:35946163-35946185 CTCTCTCTCTTTTTTGAGACAGG - Intronic
1179680962 21:43021101-43021123 GCCTTTCTTTTTTTTGAGACAGG - Intronic
1181911132 22:26239216-26239238 CCCCCTCCTTTTTTTGAGACAGG - Intronic
1182309751 22:29396151-29396173 GCAAGTCCCATTTTTCAGACTGG - Intronic
1182444995 22:30384777-30384799 CCCTCACCCATTTTTCAGCCTGG + Intronic
1182602481 22:31477111-31477133 GCCTCTTTTTTTTTTGAGACAGG - Intronic
1183266999 22:36834004-36834026 CTCTCTCTCTTTTTTGAGACTGG - Intergenic
1183406967 22:37634951-37634973 CCCTCTCCCCTTTTCCAGAAAGG - Intronic
1183924162 22:41193842-41193864 CTCCCTCCCTTTTTTGAGACAGG - Intergenic
1183932551 22:41244414-41244436 CTCTCTCTCTTTTTTGAGACAGG + Intergenic
1183985532 22:41568128-41568150 CCCTCTCTTTTTTTTGAGACTGG + Intronic
1184151655 22:42643216-42643238 GGCCCTCGCTTTTTACAGACAGG - Intronic
949506481 3:4733073-4733095 GCCTCACCCTTAATTCAAACAGG - Exonic
949512868 3:4781975-4781997 TCCCCTCCTTTTTTTGAGACAGG - Intronic
950747939 3:15105511-15105533 CTCTCTCTCTTTTTTGAGACAGG - Intergenic
950797943 3:15525778-15525800 TTCCCTCCCTTTTTTGAGACAGG - Intergenic
951784813 3:26406158-26406180 GCCCCTGCCTATTTGCAGACAGG - Intergenic
952391194 3:32881984-32882006 GCTTCTTCCATTTTTCAAACAGG - Intronic
953361539 3:42301487-42301509 GCTTCTCCCTTTTTCCATAAAGG + Intergenic
954388108 3:50254963-50254985 GCCTCTCCCTTTTCCCCAACAGG - Intronic
954561244 3:51558469-51558491 CTCTCTCTCTTTTTTGAGACAGG + Intronic
955931485 3:64061826-64061848 ACCTCTTCCTTTTCTCAGACTGG - Intergenic
958791287 3:98654119-98654141 GTCTCTCTTTTTTTTGAGACAGG - Intergenic
962875141 3:139530334-139530356 TACTCTCCCATTTTACAGACAGG - Intronic
964408841 3:156377888-156377910 GCCTCAACTTTTCTTCAGACAGG + Intronic
965472444 3:169111147-169111169 GACTCTCTCATTTTTCAAACAGG + Intronic
966643802 3:182220004-182220026 ACATCTCCCTATTTTCAGAAAGG - Intergenic
966835332 3:184045287-184045309 GCCTCTTTCTTTTGTAAGACAGG + Intergenic
969039603 4:4285411-4285433 CCCTCTGCCTTTTTTTAGAATGG - Intronic
969666201 4:8558763-8558785 GCTTCCCCCATTTTGCAGACAGG + Intronic
971474230 4:27057302-27057324 ACCTCTTCCTTGATTCAGACTGG + Intergenic
971901542 4:32665512-32665534 TCCTCTCCTTTTTATCAGAATGG - Intergenic
975873546 4:78808563-78808585 GCCGCTTCCTTTTTTAATACAGG + Intronic
976435109 4:85009086-85009108 TCCTCTCCCAGTTTCCAGACAGG + Intergenic
977228668 4:94425569-94425591 TTCTCTCTCTTTTTTGAGACAGG - Intergenic
977296254 4:95212875-95212897 CCCTCTCCATTCTCTCAGACTGG + Intronic
979318741 4:119299091-119299113 GCCACCCCTTTTTTTGAGACAGG + Intronic
980005762 4:127540741-127540763 ACCTTTCCTTTTTTTGAGACAGG + Intergenic
980178337 4:129374253-129374275 GCTTGTCCCTTGTTTGAGACAGG + Intergenic
983398861 4:167237324-167237346 GCTTCTCCAGTTTTTTAGACTGG - Intergenic
985690820 5:1311312-1311334 ACCTCCCCCTTTTTTCTGAGTGG - Intergenic
985756458 5:1721877-1721899 CTCTCTCTCTTTTTTGAGACAGG + Intergenic
985767811 5:1789365-1789387 CCCTCTCCCTTTTTTCTGAGTGG + Intergenic
986022475 5:3817799-3817821 GTCTCGCTCTTTTTCCAGACTGG + Intergenic
986328891 5:6703010-6703032 TCCCCTCTCTTTTTCCAGACAGG + Intergenic
988142726 5:27264265-27264287 GACTCTGCCTTTTCTCAGATGGG + Intergenic
988427090 5:31076433-31076455 GCCTCTCCCTCTGAGCAGACCGG - Intergenic
988475186 5:31578393-31578415 CTCTCTCTCTGTTTTCAGACAGG - Intergenic
989298589 5:39860938-39860960 TCTTCTCCCTTTCTTCAGGCTGG - Intergenic
991291445 5:65037013-65037035 CCCTCTCTCTTTTTTAAGATGGG + Intergenic
991671345 5:69051236-69051258 GTCTCTCTTTTTTTTGAGACAGG - Intergenic
992401626 5:76417090-76417112 ACCTCACCCTCTTTTGAGACAGG - Intronic
993389912 5:87306862-87306884 ACCTCCCCTTTTTTTGAGACAGG + Intronic
997207717 5:132059782-132059804 GCAACTCCCTGGTTTCAGACTGG - Intergenic
999362509 5:150997886-150997908 TCCTTTCCCTTTTTACATACAGG - Intergenic
999644417 5:153703730-153703752 GCCTTTTCTTTTTTTGAGACAGG - Intronic
1001586820 5:172838426-172838448 GCCTCTACCATTTTTCACTCTGG + Intronic
1002405245 5:179025223-179025245 TTCTTTCCCTTTTTTGAGACAGG + Intronic
1002994888 6:2273315-2273337 TCTTCTCCCTTTTTGCAGTCTGG - Intergenic
1003523721 6:6881289-6881311 GCCTCTCTCTTTTTTTAGTAGGG - Intergenic
1004365204 6:15006943-15006965 CACTCTCTCTTTTTTGAGACAGG - Intergenic
1005327052 6:24712374-24712396 GCCCGTCCTTTTTTTGAGACAGG - Intronic
1005361017 6:25030890-25030912 GTTTCTCCGTGTTTTCAGACTGG + Intronic
1005903603 6:30241272-30241294 GCATCTCCCTTTTTTCATTGAGG + Intergenic
1006126705 6:31843472-31843494 CCCTCTCTTTTTTTTGAGACAGG + Intergenic
1006753114 6:36391874-36391896 GTGTCTCCCTTTTTTCAAATAGG - Exonic
1006817572 6:36863006-36863028 GCTACTCCCATTTTGCAGACAGG - Intronic
1007488805 6:42201809-42201831 CCATCTCTCTTTTTTTAGACAGG + Intergenic
1011572597 6:88755157-88755179 ACGTCTTCCTTTTTCCAGACAGG - Intronic
1011635740 6:89371481-89371503 TTCTCTCTCTTTTTTGAGACAGG - Intronic
1013288146 6:108698173-108698195 CCCTCTCCCTCTTCTCAGCCTGG - Intergenic
1013805107 6:113987877-113987899 GCCTCTTCCTTTTATCCTACAGG + Intronic
1014160036 6:118157276-118157298 ACCTCTCCTTTTTTTCAAAAAGG - Intronic
1015254966 6:131168400-131168422 CTCTCTTCTTTTTTTCAGACAGG - Intronic
1016873013 6:148837699-148837721 TTCTCTCCTTTTTTTGAGACAGG + Intronic
1017597267 6:156043162-156043184 GCCTCTGTATTTTATCAGACTGG + Intergenic
1019763231 7:2829901-2829923 TCATCTCCCTTTCCTCAGACAGG - Intronic
1019949258 7:4358072-4358094 GACTCTGCCCCTTTTCAGACAGG + Intergenic
1019970155 7:4534435-4534457 CTCTCTCTCTTTTTTGAGACAGG + Intergenic
1020453702 7:8347854-8347876 GTCTCTCCCTGTTTTCATAAGGG - Intergenic
1020500148 7:8908149-8908171 TCCTATCCCTTTTCTAAGACAGG + Intergenic
1020695699 7:11411318-11411340 GGCTTCCCTTTTTTTCAGACTGG - Exonic
1022347946 7:29535982-29536004 GCATTTCTCTTTTTTCAGTCAGG + Intergenic
1022788291 7:33660757-33660779 ACCTCTCCCAGTTTTCACACAGG + Intergenic
1023119107 7:36891493-36891515 GCCTCTCCCTTGTCTTAGAAAGG - Intronic
1024108066 7:46113627-46113649 CTCTCTCTCTTTTTTGAGACAGG + Intergenic
1026445046 7:70476962-70476984 GCCTCTCCCTTCTGTCAGTGAGG + Intronic
1026529565 7:71185209-71185231 CTCTCTCTCTTTCTTCAGACAGG + Intronic
1026831070 7:73610468-73610490 TCATCTCCTTTTTTTGAGACAGG + Intronic
1026971673 7:74472365-74472387 GCCTCTTCTCTTTTTCAGATGGG + Intronic
1027253319 7:76413258-76413280 GCCTCTTCTTTTTTTGAGACAGG + Intronic
1028666439 7:93349091-93349113 GCCTCTCCCCTTCTCCAGTCTGG - Intronic
1028794301 7:94886519-94886541 TCCTCTTCTTTTTTTGAGACAGG + Intergenic
1029064583 7:97836823-97836845 GCCTCTCATTTTCTTCAGTCAGG - Intergenic
1029956636 7:104647237-104647259 GCCTCTCCCTTTTTTCAGACAGG + Intronic
1030017830 7:105242480-105242502 ACCTCGCCCTTTTGCCAGACTGG - Intronic
1030322669 7:108185708-108185730 CTCTCTCTCTTTTTTGAGACAGG - Intronic
1034430774 7:151040246-151040268 CCCTCTCTCCTTTTTCTGACAGG + Exonic
1034671108 7:152859066-152859088 GCTACTCCCATTTTCCAGACAGG + Intergenic
1038653484 8:29427442-29427464 TCCTTTCCGTTTTTTGAGACAGG + Intergenic
1039072650 8:33660556-33660578 ACATTTCCTTTTTTTCAGACAGG - Intergenic
1039721971 8:40174103-40174125 TTCTCTCTCTTTTTTGAGACAGG - Intergenic
1041076855 8:54176710-54176732 TCCTCTCCCTTTTGTAAAACAGG - Intergenic
1041660344 8:60395127-60395149 CCCCCTCCCCTTTTTGAGACAGG - Intergenic
1042611318 8:70604511-70604533 GTCTCTCTTTTTTTTGAGACAGG - Intronic
1043127686 8:76420413-76420435 GTCTTTCCTTTTTTTGAGACAGG - Intergenic
1043959221 8:86396597-86396619 TCTTCTTTCTTTTTTCAGACAGG + Intronic
1044897255 8:96905512-96905534 ACCTCTCCCTCTTGTCAGATGGG - Intronic
1045316737 8:101049780-101049802 GTCTCTTTCTTTTTTGAGACAGG + Intergenic
1049818096 8:144617785-144617807 TCCTCTGCCTTTTTTGAGGCAGG + Intergenic
1049825959 8:144668128-144668150 TCCTCCCCATTTTTTCAGAAAGG + Intergenic
1050121312 9:2310905-2310927 TTCTCTCTCTTTTTTCAGTCTGG + Intergenic
1055045875 9:71923294-71923316 GTCTCTCCCTGTTGCCAGACTGG + Intronic
1057929485 9:99181111-99181133 GCCACTCACTGATTTCAGACAGG + Intergenic
1060178946 9:121518439-121518461 GCTTCTTCTTTTTTTGAGACAGG + Intergenic
1060855635 9:126913458-126913480 CTCTCTCTCTTTTTTGAGACAGG + Intergenic
1062301482 9:135874465-135874487 CCCCCCCCCTTTTTTGAGACAGG - Intronic
1062738195 9:138150247-138150269 GCGTCTCCCTGTCTTCACACCGG - Intergenic
1203775942 EBV:73301-73323 TCCTCTGCCATTTTGCAGACAGG - Intergenic
1186158305 X:6749223-6749245 CCCTCTCCCATTTCTCACACTGG - Intergenic
1187342263 X:18431912-18431934 ACCTCTCCTTTTTTTGAGACAGG + Intronic
1189448460 X:41104070-41104092 CACTCCCCCTTTTTTGAGACAGG + Intronic
1190263123 X:48811296-48811318 GGCACTTCCTTTTTTGAGACAGG - Intronic
1190289086 X:48980194-48980216 GCTTCAGCCTTTTTTAAGACGGG - Intronic
1190307890 X:49096237-49096259 CTCTCTCTCTTTTTTGAGACAGG + Intronic
1195028199 X:100899507-100899529 CTCTCTCTCTTTTTTGAGACAGG - Intergenic
1196279436 X:113805662-113805684 CTCTCTCTCTCTTTTCAGACTGG + Intergenic
1196730973 X:118941162-118941184 TCCTCTTCTTTTTTTGAGACAGG - Intergenic
1197558301 X:127985427-127985449 GTGTCTTCATTTTTTCAGACAGG + Intergenic
1198434519 X:136603235-136603257 GCCTCTCTCTTTGATCAGAGAGG + Intergenic
1199680258 X:150219573-150219595 GCATCTCCCTCTTGGCAGACTGG + Intergenic
1201068810 Y:10125805-10125827 GCCTGTCCCTTTTTGGAGTCAGG - Intergenic