ID: 1029956681

View in Genome Browser
Species Human (GRCh38)
Location 7:104647751-104647773
Sequence CTAAAGGAACATAAAAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 587
Summary {0: 1, 1: 0, 2: 3, 3: 57, 4: 526}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029956681_1029956686 -2 Left 1029956681 7:104647751-104647773 CCATCTCTTTTATGTTCCTTTAG 0: 1
1: 0
2: 3
3: 57
4: 526
Right 1029956686 7:104647772-104647794 AGGAAGAAGGAGAAAGAGGAAGG 0: 2
1: 10
2: 168
3: 1248
4: 6461
1029956681_1029956685 -6 Left 1029956681 7:104647751-104647773 CCATCTCTTTTATGTTCCTTTAG 0: 1
1: 0
2: 3
3: 57
4: 526
Right 1029956685 7:104647768-104647790 CTTTAGGAAGAAGGAGAAAGAGG 0: 2
1: 0
2: 4
3: 72
4: 787
1029956681_1029956689 16 Left 1029956681 7:104647751-104647773 CCATCTCTTTTATGTTCCTTTAG 0: 1
1: 0
2: 3
3: 57
4: 526
Right 1029956689 7:104647790-104647812 GAAGGGGCAGCTTCTGTATCAGG 0: 2
1: 0
2: 1
3: 15
4: 172
1029956681_1029956687 -1 Left 1029956681 7:104647751-104647773 CCATCTCTTTTATGTTCCTTTAG 0: 1
1: 0
2: 3
3: 57
4: 526
Right 1029956687 7:104647773-104647795 GGAAGAAGGAGAAAGAGGAAGGG 0: 2
1: 12
2: 87
3: 796
4: 5091
1029956681_1029956688 0 Left 1029956681 7:104647751-104647773 CCATCTCTTTTATGTTCCTTTAG 0: 1
1: 0
2: 3
3: 57
4: 526
Right 1029956688 7:104647774-104647796 GAAGAAGGAGAAAGAGGAAGGGG 0: 4
1: 30
2: 390
3: 2612
4: 9559

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029956681 Original CRISPR CTAAAGGAACATAAAAGAGA TGG (reversed) Intronic
901750769 1:11406377-11406399 AAAAAGGAACATCAAATAGACGG - Intergenic
903085002 1:20848566-20848588 CAAAATGAAGATTAAAGAGAAGG + Intronic
905384126 1:37588214-37588236 CTGAAGCAAGATAAAAGAGTTGG + Intronic
907346457 1:53785435-53785457 CTCAAGTAACATACATGAGAAGG + Intronic
907745647 1:57210732-57210754 CAAAAGGAAGGCAAAAGAGAGGG + Intronic
908044612 1:60155083-60155105 CTAAGGGAGCGTAAAAGAGGGGG + Intergenic
908285731 1:62597584-62597606 CTAGAGGAACAATAAAAAGAAGG - Exonic
908479977 1:64529838-64529860 CTAAAGTAACATTATAGAGCAGG - Intronic
908547606 1:65177275-65177297 CCAAAGGAACAAAAATGAGTAGG + Intronic
909159524 1:72128886-72128908 TAAATGGAACAAAAAAGAGAAGG + Intronic
909235286 1:73145346-73145368 GTAAAGGAATATAAGAGAGAAGG - Intergenic
909255977 1:73422558-73422580 CTGAAGAAACATGAAAGACAGGG + Intergenic
909613547 1:77580068-77580090 ATAAAGGACCATACAAAAGAAGG - Intronic
909870387 1:80731336-80731358 CTAAAGGAACTTGAAAGGCAGGG + Intergenic
910664571 1:89710243-89710265 TTGAAGAAACATAAAAGAGAAGG - Intronic
911064999 1:93780101-93780123 GTAAGGGAACAGAAAAGAAAAGG - Intronic
911864700 1:103003036-103003058 CAAAAGGAAGATAGAAGAAAAGG + Intronic
912671283 1:111628678-111628700 TTAAAGGAAAACAAAAGGGAGGG + Intronic
912778867 1:112525438-112525460 GTAAAGGGATAGAAAAGAGAGGG + Exonic
914772600 1:150703014-150703036 CTGAAGGTATATTAAAGAGAGGG - Intronic
914997314 1:152556068-152556090 CTAAAGGTACAGAGAAGAGCTGG + Intronic
915813154 1:158937387-158937409 GTAAAAGAACAAAAAGGAGAGGG + Intronic
916187414 1:162146465-162146487 CCAGAGGAGCTTAAAAGAGAGGG - Intronic
916590817 1:166188488-166188510 CTAAAAGAACCCAAGAGAGAGGG - Intergenic
916858822 1:168780574-168780596 CCAAGGGAAAAGAAAAGAGATGG - Intergenic
917029727 1:170676325-170676347 GTAAAGAAAAAAAAAAGAGAGGG - Intronic
917036980 1:170758814-170758836 GTAAAGGAATATAAAAGGTATGG + Intergenic
917852609 1:179078345-179078367 TTAAAGGAACATAGATGAGCTGG + Intergenic
918572161 1:186009690-186009712 CAAGAGAAAAATAAAAGAGATGG + Intronic
919182833 1:194107008-194107030 CTAAAGAAATAAAAAGGAGAAGG + Intergenic
919644500 1:200080577-200080599 GTAATGGAACACAAAAGAGCTGG - Intronic
919891554 1:201979040-201979062 CTAAAAGTACATAAGAGAGAGGG - Intergenic
920712179 1:208305753-208305775 CTAAAGAATCATCAAAGAGAAGG + Intergenic
921136773 1:212267916-212267938 CTAAAAGAAAAGAGAAGAGATGG - Intergenic
921272195 1:213482311-213482333 GTAAAGGCAGATAAAAGAGATGG - Intergenic
921328791 1:214014929-214014951 CTACAGGAAAATAAAGCAGATGG + Intronic
921832105 1:219739380-219739402 CAAAATGAACATGAAAAAGAAGG + Intronic
922171365 1:223158640-223158662 CTAAAGGATACTAAAAGATAGGG - Intergenic
923182115 1:231529517-231529539 TTAATGGGACATAAAAGTGAAGG - Intronic
924695459 1:246395406-246395428 CTGAAGGAAAATAGAAGAAACGG - Intronic
1063260237 10:4379656-4379678 CAAAATTAACATAATAGAGATGG + Intergenic
1063360402 10:5450519-5450541 CTAAAGTAATATAAAAAGGAAGG - Intronic
1064486145 10:15792540-15792562 TAAAAGGAACAGAAAAGACAAGG + Intronic
1064535775 10:16356137-16356159 GTAAAGGAACAAAGAACAGAAGG - Intergenic
1064812933 10:19222167-19222189 CTAAGGGAAGAAAAGAGAGAGGG - Intronic
1064890462 10:20165638-20165660 CTAAAGGAAGATGAAAGAAAAGG + Intronic
1065079975 10:22119407-22119429 CAAAACAAACATAAAAGAGACGG - Intergenic
1065225849 10:23543115-23543137 CAAAAGGAAGTTAAAAGAGCTGG - Intergenic
1066431790 10:35358986-35359008 CTCCAGGAACACAAAAGAGAGGG - Intronic
1066679068 10:37918719-37918741 CTAAAAGAACAAAAAGGAAATGG + Intergenic
1067730004 10:48803719-48803741 CTTAAGGGATGTAAAAGAGAAGG + Intronic
1068021406 10:51589706-51589728 CAAAAGGAAAATGAAAGTGAAGG - Intronic
1068174821 10:53444790-53444812 TGAAAGAAAAATAAAAGAGATGG + Intergenic
1068326084 10:55489129-55489151 TTAAAAGAAAATAAAAGTGATGG - Intronic
1068634815 10:59337108-59337130 CTAAAAGATCACAAAAAAGAGGG - Intronic
1068800247 10:61132379-61132401 TTAAATTAAGATAAAAGAGAAGG + Intergenic
1069200781 10:65613142-65613164 CTAAAGAAAGAGAATAGAGAAGG - Intergenic
1070033671 10:72701439-72701461 CTAAAGGAGCAGAAAGGAAAAGG - Intronic
1071920746 10:90347232-90347254 ATAAAGGAAGATGAGAGAGAGGG + Intergenic
1071947678 10:90665706-90665728 TTAAAGTAACCTAAAAGAAATGG + Intergenic
1072096365 10:92185056-92185078 CAAAAGGAAGAAAAAAGAAATGG - Intronic
1072431441 10:95375265-95375287 CCAAAGGAATATAAAATAGAAGG - Intronic
1073241129 10:102058929-102058951 CTAATAGAATATAAAAGAGTGGG + Intergenic
1074094116 10:110293248-110293270 CTAAATGAACATAATATACAGGG + Exonic
1074739210 10:116468309-116468331 CTAAAGAAAAATAAAAATGAAGG + Intronic
1075554954 10:123423695-123423717 CTAAACCAACATAAAAGACAAGG + Intergenic
1075767321 10:124903979-124904001 CCACAAGAACATAAAAGAGGAGG + Intergenic
1075798375 10:125136521-125136543 CTATAGGCACACAAAAGAGGAGG - Intronic
1076376109 10:129986471-129986493 CTAAATGCACTTAAAAGATACGG + Intergenic
1076703405 10:132286221-132286243 CAAAACTAACACAAAAGAGATGG + Intronic
1077290416 11:1787440-1787462 TTAAAGGAAAAAAAAAGAAAAGG - Intergenic
1077382632 11:2251490-2251512 GTAAAGGAACAGCAAAAAGAAGG + Intergenic
1077786343 11:5388353-5388375 CTACAGGAACACATAGGAGAGGG + Intronic
1077846503 11:6030784-6030806 CTACAGAAACATAAAATAGGAGG - Intergenic
1078108209 11:8371869-8371891 ATAAAGGAAAAATAAAGAGAAGG - Intergenic
1078587153 11:12601682-12601704 CAAAAGAAAGAGAAAAGAGATGG - Intergenic
1078787955 11:14514735-14514757 CTTATGGAACAGAGAAGAGAAGG + Intronic
1079327839 11:19509682-19509704 CTAAAGAACCAGCAAAGAGAAGG - Intronic
1079588565 11:22155000-22155022 CTAAAGAAAAACAAGAGAGAGGG + Intergenic
1080035541 11:27706176-27706198 CAAAAGGTAGACAAAAGAGAAGG + Intronic
1080310141 11:30880527-30880549 CTAAAGGAAACTAAAAGATTAGG - Intronic
1080490814 11:32762591-32762613 GTAAAGGAAAAGAAAAGGGAGGG + Intronic
1080782385 11:35441694-35441716 CTAAAAGAAAGTAAAAGAAAAGG + Intronic
1080842429 11:35997403-35997425 CTCAAGGAACCACAAAGAGATGG - Intronic
1081210133 11:40322744-40322766 CCAAAGCAGCATAAAAGGGATGG - Intronic
1082084778 11:48040967-48040989 TAAAAGGTCCATAAAAGAGAGGG - Intronic
1083505964 11:63157426-63157448 CTGAAGAAAGATAAAAGAGAGGG - Intronic
1083561792 11:63678750-63678772 TTAAATGAATTTAAAAGAGAGGG - Intergenic
1084010085 11:66342988-66343010 CTGAAGACACAGAAAAGAGAGGG - Intronic
1085713677 11:78853212-78853234 CTACAGGAAAATAAAAGTTATGG - Intronic
1086626644 11:88963494-88963516 CAGAAGGAAGATAAAAGGGATGG - Intronic
1087364839 11:97205314-97205336 CTAAAGTAAAATAAAAGGGAAGG + Intergenic
1087458531 11:98418318-98418340 CTAAGAGAACATACAAGAGAAGG + Intergenic
1088718156 11:112567426-112567448 ATAAGGGAACAGAAAATAGAAGG - Intergenic
1088809110 11:113378144-113378166 TGAAAGGAAGAGAAAAGAGAGGG - Intronic
1088945033 11:114503351-114503373 TAAAAGGAACCTAGAAGAGACGG + Intergenic
1089205435 11:116757825-116757847 CTAAGAGAACAGGAAAGAGAGGG - Exonic
1089336947 11:117731719-117731741 CTAAAGGAACTTAAAAGCTATGG - Intronic
1090811450 11:130247992-130248014 CAAAAGGAACTTAAAACAGCAGG + Intronic
1090990920 11:131816026-131816048 ATAAAGGAGGAGAAAAGAGAAGG - Intronic
1091890238 12:4047920-4047942 CTGAAGGAACTTAGAAGAAATGG - Intergenic
1093633032 12:21432814-21432836 TTAAAGAAACACAAAATAGATGG - Intergenic
1093858103 12:24129876-24129898 CTAAAAGAAAATAAAACAAATGG - Intergenic
1094128979 12:27054342-27054364 ATAAAGGAATAAAAAACAGATGG + Intronic
1095369202 12:41446207-41446229 ATAAAGCTACATAAAACAGAAGG - Intronic
1095396587 12:41769030-41769052 CAAAAGGAACTTATTAGAGATGG - Intergenic
1095504541 12:42880417-42880439 ACAAAGGAACATAGAAGAGTTGG - Intergenic
1095861199 12:46919653-46919675 CTCGAGGAAAATATAAGAGAAGG - Intergenic
1096032495 12:48433085-48433107 CAATAGGAACAAAAAATAGATGG + Intergenic
1096087166 12:48873445-48873467 CTAAAGGAAAAACAAAAAGAAGG + Intergenic
1096221265 12:49829367-49829389 ATAAAGGAACATAAAAAGTAAGG + Intergenic
1096590343 12:52654763-52654785 CTAAAGGAGAACAGAAGAGAGGG - Intergenic
1097026298 12:56058165-56058187 CAAAAGGAAAATTAAAGAAAAGG - Intergenic
1097902682 12:64889067-64889089 CCAAAGCAACTTAAAAGAGGAGG - Intergenic
1098256399 12:68620510-68620532 TTAAATTAACATAAAAAAGAAGG - Intronic
1098506748 12:71261349-71261371 TTATATGAATATAAAAGAGAAGG - Intronic
1098859208 12:75688661-75688683 CTAAACGTACATAAGAGAGAGGG + Intergenic
1100218903 12:92482573-92482595 CTCAAGGGAAATAAAAGTGAAGG + Intergenic
1101896328 12:108759784-108759806 AAAAAGGAAAATAAAAGAAAAGG + Intergenic
1103152206 12:118650618-118650640 CTGAAGGAACAGAACAGAGACGG - Intergenic
1104393470 12:128410881-128410903 CTAAAGGTACACAAAACTGAAGG - Intronic
1105804236 13:23940912-23940934 CTAAAGCAACTTAAAATAAATGG - Intergenic
1106690827 13:32114134-32114156 CTACAGACCCATAAAAGAGATGG - Intronic
1106839336 13:33669855-33669877 CTTAAGGGACATACAAGAGTAGG - Intergenic
1107048353 13:36019191-36019213 CTAAAAGAACAAATATGAGAAGG - Intronic
1107715443 13:43195096-43195118 CTTAAAGAACATAAAATACATGG + Intergenic
1108541302 13:51449710-51449732 ACAAAGGAATATAAAAGAGAAGG + Intronic
1108948334 13:56053160-56053182 TTAAAGGAACAGAAAAAACAAGG + Intergenic
1109177552 13:59174745-59174767 CTAAAGGCAAATAAAAGATTGGG + Intergenic
1109369585 13:61404809-61404831 CAAAAAGAAAAAAAAAGAGAAGG - Intergenic
1110144419 13:72171803-72171825 CTAAAGGAACCTAAAAAACTGGG - Intergenic
1110232701 13:73183201-73183223 GTAAAACAAGATAAAAGAGATGG + Intergenic
1110336151 13:74333096-74333118 CTGAAGGAAAACAAAAGATAGGG - Intergenic
1111006327 13:82254770-82254792 AAAACGAAACATAAAAGAGAAGG + Intergenic
1111111465 13:83715633-83715655 GTAAGGTAATATAAAAGAGAGGG - Intergenic
1111772044 13:92609269-92609291 ATAAAGGAAAAAAGAAGAGAGGG + Intronic
1112177083 13:97036530-97036552 CTAAAAGAAAAGAAAAGAAAAGG + Intergenic
1112520535 13:100090669-100090691 CTATAAGAAAATAAAATAGAGGG + Intronic
1112554004 13:100449893-100449915 CTAAAGGGACATAAAATAATGGG - Intronic
1112754332 13:102614556-102614578 CTACAGGAACAGAAACGAAAAGG - Intronic
1112883366 13:104136803-104136825 CTAAAGCAACATAAGAATGAAGG + Intergenic
1113055925 13:106267715-106267737 CTAAAGAAACATTAAAAAAAAGG - Intergenic
1113629055 13:111868444-111868466 CTAAAAGAGAATAAAAAAGATGG - Intergenic
1114476813 14:23001451-23001473 ATAAATAAAAATAAAAGAGAGGG - Intronic
1114932142 14:27486381-27486403 CTAAAGGAAAAAAAAAAAAATGG + Intergenic
1114962094 14:27905085-27905107 CTAAAGCAAAATAAATGAAATGG - Intergenic
1115183153 14:30653668-30653690 CTACAGAAACAAAAATGAGAAGG + Intronic
1116047466 14:39762534-39762556 CTAAAGCTACTTAAAAGAGTGGG - Intergenic
1116119860 14:40708853-40708875 CTAGATTAACAGAAAAGAGAAGG + Intergenic
1116215676 14:42014157-42014179 CAACAGAAAGATAAAAGAGATGG - Intergenic
1116234457 14:42260509-42260531 CTAAAGGAACCTTAAGGAAAGGG - Intergenic
1116248069 14:42443850-42443872 ATAAAGGAAAATAATTGAGAGGG - Intergenic
1116253999 14:42526035-42526057 CTAAAGTATCATAAAATAAAAGG - Intergenic
1116704455 14:48279157-48279179 ATAAAGGAACAAAAAAGACATGG + Intergenic
1116880147 14:50159281-50159303 CAAAAGGAATAAATAAGAGAAGG - Intronic
1117843646 14:59887891-59887913 CTAAAGGAACAGCAAAGGCATGG + Intergenic
1118143578 14:63111721-63111743 CCAAAGGAAATTAGAAGAGAAGG + Intergenic
1118273554 14:64365421-64365443 GTAAAGGAACAGAGAATAGATGG - Intergenic
1118499246 14:66342787-66342809 GGAAAGAAACATAAAGGAGAAGG + Intergenic
1118512774 14:66494110-66494132 CTCCAGGAACATAAAAGGAAAGG - Intergenic
1118631881 14:67712893-67712915 CAAAAGAAAAAAAAAAGAGAAGG - Intronic
1118769269 14:68930960-68930982 CTAAGGACACAAAAAAGAGAGGG + Intronic
1119409477 14:74421015-74421037 CTACAGGAAAATAAAAGAGAAGG + Intronic
1119715958 14:76859547-76859569 AAAAAGAAACATAAAAGAAATGG + Intronic
1119808381 14:77497693-77497715 CAAAAATAAAATAAAAGAGAGGG + Intronic
1119899423 14:78247232-78247254 CCCAAAGCACATAAAAGAGATGG - Intronic
1120463335 14:84825209-84825231 CTAAAGGAAAATAAAACACAAGG - Intergenic
1121683114 14:95810799-95810821 CTAATGGAAGGCAAAAGAGATGG + Intergenic
1124052207 15:26207938-26207960 CTAAAGGGACATAAAAGCTTAGG - Intergenic
1124080001 15:26484678-26484700 CTACAGAAACAGAAAAGAGATGG + Intergenic
1124578356 15:30928750-30928772 CCAAAGGACCGTAACAGAGATGG - Intronic
1124825524 15:33090768-33090790 CTAAAGGAACCTCAGGGAGAAGG + Intronic
1125077666 15:35638471-35638493 CCAAAGGACCCCAAAAGAGATGG + Intergenic
1125239981 15:37563232-37563254 ATAATGGAAAATAAAAGAAATGG + Intergenic
1126013677 15:44328921-44328943 CTAAAGAAAGATAATAGAAAAGG - Intronic
1126616421 15:50585694-50585716 CCAAAGGAAAATGAAAGTGATGG + Intronic
1126800348 15:52292418-52292440 CTAAGGTAACATACAAGTGATGG - Intronic
1126840854 15:52716053-52716075 ATAAATAAAAATAAAAGAGAAGG + Intergenic
1127233598 15:57022998-57023020 CTCAATGCACTTAAAAGAGAAGG - Intronic
1127899829 15:63333000-63333022 GTCAAGTAACATAACAGAGATGG + Intronic
1128950916 15:71880622-71880644 TTAAAGGAACTTTAAAAAGAAGG - Intronic
1130040523 15:80402688-80402710 CTTAAGGAAAGTAAAAGAGGAGG - Intronic
1130052555 15:80495863-80495885 CTAAAGGAGCCTCAGAGAGATGG - Intronic
1130058677 15:80552988-80553010 CTAGAGAAACATAACAGTGAGGG - Intronic
1130329892 15:82913768-82913790 ATAAATGACCAGAAAAGAGATGG - Intronic
1131871119 15:96765548-96765570 CTAAAGGAACATGTTAGAGGGGG - Intergenic
1131871253 15:96767466-96767488 CAAGAGGAACAGAAAAAAGAGGG - Intergenic
1133655269 16:7856098-7856120 CAAAAGGAACAAAAACCAGAGGG - Intergenic
1133846614 16:9460090-9460112 TTAAAGGAACATTGAGGAGAGGG - Intergenic
1134336107 16:13301007-13301029 ATAAAAGAATAGAAAAGAGAAGG - Intergenic
1134826644 16:17290027-17290049 CAAAAAGAACAAGAAAGAGATGG - Intronic
1135708127 16:24692580-24692602 ATAAAAGAAAATAAAATAGAGGG + Intergenic
1136015271 16:27394852-27394874 TTAAAGGAACTAAAAAAAGAAGG + Intergenic
1136650471 16:31665510-31665532 CAAAAGGAAAATAAAAAAGCTGG + Intergenic
1136910144 16:34138302-34138324 CAAAAGAAACATAAAAAATATGG + Intergenic
1137415781 16:48277667-48277689 CAAAAGGAAAATAAAAAAAAAGG - Intronic
1137702768 16:50508742-50508764 CTATAGGGACAGAAAACAGATGG - Intergenic
1139016734 16:62698320-62698342 CTAAAGGAAAAATAAAGAAAAGG + Intergenic
1139197570 16:64938648-64938670 CTAGAGGACCATAAAAAACAAGG - Intergenic
1139606116 16:68019896-68019918 CTAAAGCAACTTATGAGAGAAGG - Intronic
1140178106 16:72685297-72685319 ACAAAGGCACATAAAACAGATGG - Intergenic
1143828440 17:9631647-9631669 GTAAAAGAAGTTAAAAGAGATGG + Intronic
1144030470 17:11316723-11316745 CTAAGTCTACATAAAAGAGAAGG - Intronic
1144046008 17:11455251-11455273 TTAAAATAAAATAAAAGAGAGGG + Intronic
1144389400 17:14779688-14779710 AAAAGTGAACATAAAAGAGAGGG + Intergenic
1146141613 17:30373161-30373183 CTAATGGGACATAGAACAGAAGG - Intergenic
1146236455 17:31169408-31169430 CTAAAGGAACATAACAAACAAGG - Intronic
1146435625 17:32843590-32843612 CTTAAGGAGAATAGAAGAGATGG + Intronic
1146733289 17:35214302-35214324 CAAAAGAAACATCAAAGTGATGG - Intergenic
1146781363 17:35676044-35676066 TTTAAGGAACAAAACAGAGAAGG - Intronic
1147046865 17:37759081-37759103 AGAAAGCAAGATAAAAGAGAAGG + Intergenic
1147524656 17:41210290-41210312 CTAAAGGGTCAGAAAAGAGGTGG - Intronic
1148426739 17:47604839-47604861 CTAAAAGAACATAAACTAGAAGG - Intronic
1148520848 17:48273713-48273735 CTAAAGAATGATAAAAGAGCCGG - Intronic
1149755165 17:59180290-59180312 CTAAAAGAACAAAAATGAGCTGG - Intronic
1153191815 18:2549135-2549157 GTAAAGGTATATAAAGGAGAGGG - Intronic
1153207516 18:2719204-2719226 GGAAAGGAACAGAAAAGAAAAGG - Intronic
1154039425 18:10839024-10839046 CCAAAGTTACATAGAAGAGAGGG + Intronic
1154936670 18:21065442-21065464 CTAAAAGAAGATAATGGAGAAGG - Intronic
1156039656 18:32806320-32806342 CTAAAATAACATCAAATAGAGGG + Intergenic
1156577880 18:38339713-38339735 TCAAAGGAACAGAAAAGAGGAGG - Intergenic
1156852418 18:41743760-41743782 AGAATGGAAAATAAAAGAGATGG + Intergenic
1157165230 18:45352662-45352684 CCAAAGGAAAATAAAAGAAGTGG + Intronic
1158376318 18:56873472-56873494 CAAAAGGAACATAAAGAAGGTGG + Intronic
1158482638 18:57835511-57835533 CTAAAGGAAAGTAAAAGAAATGG - Intergenic
1158915362 18:62120796-62120818 AAAAAGGAACATAAAACAGATGG + Intronic
1159862805 18:73669375-73669397 CTATAGGAACAAAAATGTGAAGG + Intergenic
1162331071 19:10030213-10030235 GTAAAGGAACATAAGGAAGATGG + Intergenic
1162512720 19:11129389-11129411 CTAAACAAACATAAAAGACCAGG + Intronic
1162679620 19:12331117-12331139 CTAAAGGGACAAGAAAGAGTTGG - Intronic
1163203432 19:15784732-15784754 ATAAATAAAAATAAAAGAGAGGG - Intergenic
1163624107 19:18378754-18378776 CAAAAGAAAAAAAAAAGAGATGG + Intronic
1164413550 19:28026159-28026181 TTAAAGGAAAAGAAAAGAAAGGG - Intergenic
1164877605 19:31702529-31702551 CTAAAGGAACATTAAAGATCAGG + Intergenic
1165048142 19:33122660-33122682 GTAAAGGGACATAAAAGACTTGG - Intronic
1165532695 19:36417659-36417681 CCAGAGTAACATAAGAGAGATGG + Intronic
1166026759 19:40093470-40093492 CTTAGGGTACAAAAAAGAGATGG - Intergenic
1166761376 19:45226430-45226452 AAAAAAGAAAATAAAAGAGATGG - Intronic
1167048641 19:47066202-47066224 TTAAAAAAAAATAAAAGAGACGG + Exonic
1168343068 19:55636834-55636856 TGAAAGGAACATCACAGAGAGGG + Intronic
1168670985 19:58240952-58240974 CAAAAAGAAAAGAAAAGAGAAGG - Intronic
926075870 2:9942271-9942293 CTAAAGGAAGAAGAGAGAGAAGG - Intergenic
926209327 2:10857582-10857604 CAAAAGGAAGAAGAAAGAGAGGG - Intergenic
926389170 2:12369906-12369928 CTAAAGGAAAAGAAAATAAAAGG - Intergenic
926497698 2:13612029-13612051 CTAAAGGAAACTAAAGGAAAAGG + Intergenic
926643685 2:15265201-15265223 CTAAAGGAACTGAAAAGAGAAGG - Intronic
926817154 2:16810305-16810327 GTAATGGAAGATGAAAGAGAAGG + Intergenic
926818083 2:16820923-16820945 CTGAAGTAAAATAATAGAGAAGG + Intergenic
927510217 2:23639742-23639764 CCAATGGGAGATAAAAGAGAGGG - Intronic
928134011 2:28674506-28674528 CTAAAAGAATACAAAAGAGTTGG - Intergenic
928296915 2:30091622-30091644 GAAAAGGAACATCAAAGGGAAGG + Intergenic
928488898 2:31760693-31760715 GAAAAGGAACATAGAAGAGGTGG - Intergenic
928680341 2:33694740-33694762 TTAAAGGAACAAAAAGAAGAAGG - Intergenic
929132300 2:38588902-38588924 CTAAAGAAACAAAAAAGCTAAGG + Intronic
930158519 2:48129472-48129494 ATAAAGGAAAATAAAACAGGAGG - Intergenic
930458635 2:51640513-51640535 CTAAAAGAAAAGAAGAGAGAAGG + Intergenic
930501562 2:52226335-52226357 CTAAAGGAACAGAAAAGGTCTGG + Intergenic
930947700 2:57095422-57095444 CTAAGGGAACATACAATTGAGGG - Intergenic
931176911 2:59863398-59863420 ATAAAGGAACAGGAAAGAGAAGG - Intergenic
931234421 2:60401249-60401271 TGAAAGGAAAATAAAAAAGAAGG + Intergenic
931664739 2:64602067-64602089 CTGAAGGATCATGAAAGAAAGGG + Intergenic
931913331 2:66926045-66926067 CAAAATGAAGAGAAAAGAGAGGG - Intergenic
931953777 2:67395571-67395593 CAAAAACAACATTAAAGAGAAGG - Intergenic
932117512 2:69066786-69066808 CAAAAGGAACACAAAACAAATGG + Intronic
932717016 2:74108378-74108400 CTAAAGGGAGAAAATAGAGATGG + Intergenic
933829264 2:86193630-86193652 GTAAAGGAAAACAAGAGAGATGG + Intronic
933861279 2:86471453-86471475 CTATATGAACAAAAAAGATAGGG - Intronic
934013678 2:87854507-87854529 TTAAAGGAACATAAAAGGAATGG - Intergenic
934754893 2:96817874-96817896 CTAGAAGAACATAGAAAAGATGG + Intronic
935230720 2:101093712-101093734 CTCAGGGAAAAAAAAAGAGATGG + Intronic
935714259 2:105926167-105926189 CTAAAGCAAAATAAGAGAAATGG + Intergenic
935807128 2:106760243-106760265 GGAAAGGAACAGAAAGGAGAGGG + Intergenic
936293106 2:111242424-111242446 ATAAAGGAACAGAAATCAGAGGG + Intergenic
936485473 2:112921848-112921870 AGAAAGGAAGAAAAAAGAGAGGG + Intergenic
936585200 2:113751147-113751169 ATAAAGAAAAACAAAAGAGAAGG + Intronic
936685688 2:114823602-114823624 TTATGGGAACACAAAAGAGATGG + Intronic
936748046 2:115604021-115604043 CTAAAGGAAGAAAAATGATAGGG + Intronic
937015100 2:118597811-118597833 CTAATGAAACATAAAAGATGAGG + Intergenic
937132945 2:119526833-119526855 CTCCAAGACCATAAAAGAGATGG + Intergenic
938154141 2:128915502-128915524 ATAAAGAAACATAGAAGAAAAGG - Intergenic
938818910 2:134933543-134933565 AAAAAGGAATAAAAAAGAGAAGG + Intronic
938980105 2:136518341-136518363 AGAAAGGAATAGAAAAGAGAGGG - Intergenic
939387561 2:141520373-141520395 CTAAAGCCACTTAAAACAGATGG + Intronic
939734632 2:145828702-145828724 CAAATGGAATCTAAAAGAGAGGG - Intergenic
940674782 2:156714667-156714689 CCAAAGGCACCTATAAGAGATGG + Intergenic
941588374 2:167388091-167388113 CTAAAGGAGCATTCTAGAGATGG + Intergenic
942259145 2:174140240-174140262 CTAAAGGTACAAAAATGTGATGG - Intronic
943662893 2:190578069-190578091 ATAAAGGACAATGAAAGAGAAGG - Intergenic
943756667 2:191564284-191564306 CAAAAGGGACATAAAAGGAAAGG - Intergenic
943978765 2:194518857-194518879 CAAAAGGAAGATGACAGAGATGG - Intergenic
944176475 2:196833923-196833945 ATATAGGAAGAAAAAAGAGAAGG + Exonic
945679265 2:212893686-212893708 CTAATGAAAAATAAAAAAGAAGG + Intergenic
945702919 2:213193637-213193659 ATAAAGGAAAACAAAACAGATGG - Intergenic
946321453 2:218956928-218956950 CCAGAGGAACATAAGGGAGATGG + Intergenic
946811245 2:223528332-223528354 CTAAAGCAACAGAAAGCAGATGG - Intergenic
947322706 2:228939785-228939807 CTAACGGAGCACAAAAGAAAAGG + Intronic
947346286 2:229192608-229192630 CTTATGGAACATACAGGAGAAGG + Intronic
947518514 2:230827540-230827562 CAAAAAGAAAAGAAAAGAGAAGG - Intergenic
948352408 2:237351644-237351666 CACAAATAACATAAAAGAGATGG + Intronic
949061811 2:241964382-241964404 CTGAAGGAAGCAAAAAGAGAAGG - Intergenic
1172463898 20:35140809-35140831 ATAAAGGAACATAAAGAAGATGG + Intronic
1173234292 20:41229952-41229974 CTAATGGAAAATAATAGAGTTGG - Intronic
1173671561 20:44802657-44802679 CCTAAGGAACATAAAAAACAGGG + Intronic
1174734112 20:52948397-52948419 CTCAAGGAACACAAAAGACTGGG + Intergenic
1175165937 20:57044769-57044791 AAAAAGGAACATAAAAGAACAGG + Intergenic
1176952217 21:15061914-15061936 CTAATGGAACAAATAAGATAAGG - Intronic
1177040697 21:16106757-16106779 CTAAAACAACAGAAAAGAAAGGG + Intergenic
1177272279 21:18865279-18865301 CCAATGGAACAGAATAGAGAAGG - Intergenic
1177522085 21:22239145-22239167 CTGAAGGTGCATAAAAGTGAAGG + Intergenic
1177613771 21:23489972-23489994 CTAAAGGGCAAAAAAAGAGAAGG - Intergenic
1179001654 21:37466434-37466456 GAAAAGGAACATAAAACAGTTGG + Intronic
1179470154 21:41605002-41605024 CTAAAGGAACAGGGAAGAGAGGG + Intergenic
1180339032 22:11603133-11603155 CAAAAGAAACATAAAAAAAATGG + Intergenic
1181321349 22:22009055-22009077 GTAAAGGAAAATAAAGAAGAAGG - Intergenic
1181767866 22:25104681-25104703 CTATGGGAACATAATAGGGAGGG - Intronic
949126264 3:448362-448384 CTCAAGGAACCTAAAAAAAAAGG - Intergenic
950782931 3:15408041-15408063 CTAAAGGAAAATAAAAGTTGAGG - Intronic
951074051 3:18367733-18367755 AAAAGGGAACAGAAAAGAGAGGG - Intronic
951917221 3:27814569-27814591 CTAAAGGAAATTAAAATGGAGGG - Intergenic
952063290 3:29537144-29537166 CTAAAGGGGAATGAAAGAGAAGG + Intronic
952223219 3:31346222-31346244 GTAAAGAAAGATAAAAGAGAAGG - Intergenic
953193008 3:40706571-40706593 ATAAAGGCACATACAAAAGATGG - Intergenic
953799071 3:46007882-46007904 CTAAAAAAACAAAAAAGAGAAGG + Intergenic
953964208 3:47290462-47290484 CTCAAGGAAAAAAAAAAAGAGGG - Intronic
954026618 3:47788238-47788260 ATAAAGGACAATAAAAGAGTGGG + Intergenic
954535740 3:51358149-51358171 CCAAAGGAAAATAGGAGAGAGGG + Intronic
955614748 3:60795003-60795025 CTAAAGGAACGCAAAAGCAACGG - Intronic
956276191 3:67503992-67504014 TAAAAGGAACATAAAACAGCAGG + Intronic
956479910 3:69662940-69662962 CTAAAAAAAGAAAAAAGAGATGG + Intergenic
957664471 3:83206723-83206745 CAATAGGAAAATAACAGAGATGG - Intergenic
957773162 3:84720399-84720421 TTAATGGAACATAGCAGAGAGGG - Intergenic
958460496 3:94388541-94388563 CTAAAGGAACTAAAAAAATAAGG + Intergenic
958761390 3:98312642-98312664 ATAAAGAAACAGATAAGAGATGG - Intergenic
958896830 3:99838848-99838870 GTGAGGTAACATAAAAGAGAGGG - Intronic
959753883 3:109873320-109873342 TAAAAGGAACGTAAAAGTGATGG - Intergenic
960363404 3:116741860-116741882 CTCAAGGAAAAAAAAATAGAAGG + Intronic
960825586 3:121780201-121780223 CTCAAGGAAGAGAACAGAGAAGG - Intronic
961866838 3:129959564-129959586 AAAAAGGAACAGAAAAGAAAAGG - Intergenic
963034239 3:141011557-141011579 CAGAAGGAGCATGAAAGAGAAGG + Intergenic
963131162 3:141859550-141859572 CAACAGGAACACAAAAAAGATGG - Intergenic
963541863 3:146601558-146601580 CTAAAGACATACAAAAGAGAGGG + Intronic
963657333 3:148073203-148073225 CTCAAGGAAAATAATAGGGATGG - Intergenic
963709549 3:148731198-148731220 CTAAAGAACCAGAAAATAGAGGG + Intronic
964123443 3:153210452-153210474 ATAAGTGAACATAAAAGAGGAGG - Intergenic
964167148 3:153722264-153722286 GTGAAGGCACATAAAAGAAAAGG - Intergenic
964431652 3:156612958-156612980 CTATAGGGACAGAAAAGAGATGG - Intergenic
964640133 3:158900390-158900412 ATAAAGGAAAACAAAAGAGTTGG - Intergenic
965246381 3:166276368-166276390 TCAAAGGAAAATAAAAGGGAGGG - Intergenic
965733585 3:171798030-171798052 CTAAAGAAACATTAAAGGGAAGG + Intronic
967093627 3:186157572-186157594 CTAAATGATCTTAAAACAGATGG - Intronic
967503465 3:190226457-190226479 CTTGAGGAACATTAAAGTGAAGG + Intergenic
967549721 3:190776995-190777017 CTAAATTAAAATAAAATAGAAGG - Intergenic
968328590 3:197843980-197844002 ATAAAGCAGGATAAAAGAGATGG + Intronic
969458345 4:7313862-7313884 CTAAGGGAACAGAAGAGATAGGG - Intronic
970065329 4:12087400-12087422 TTAGAGGAACAGAAAAGAGCAGG + Intergenic
970686898 4:18578739-18578761 CTACAGGAACATAAAAATCAAGG - Intergenic
971745106 4:30569178-30569200 ATAAAGGAAAAGAAAAGAGAAGG - Intergenic
972089463 4:35262617-35262639 CTAAAAGTACATAAAATAAAAGG + Intergenic
972210787 4:36834325-36834347 CTTAAGGAAAATAAAAAAAAAGG + Intergenic
972445227 4:39137010-39137032 CTTAAGGAAAATGAAAGACAAGG + Intergenic
974046937 4:56906599-56906621 ATAAAGGAACTTCAAAGAGAAGG + Intergenic
974201823 4:58652163-58652185 ATAAAGGAACATATAATAGCTGG - Intergenic
974744690 4:66057052-66057074 CAAAAGGAAAATAAGAAAGAAGG + Intergenic
975856092 4:78626058-78626080 CTCAACAAAAATAAAAGAGAGGG - Intergenic
976573797 4:86644558-86644580 CTAATAGAACATTGAAGAGAAGG + Intronic
976945343 4:90758954-90758976 CTAAAAGAACATAACAGAATGGG - Intronic
976956649 4:90909669-90909691 AAAGAGGGACATAAAAGAGATGG - Intronic
977125568 4:93162888-93162910 TTAAATGAAGAGAAAAGAGAAGG + Intronic
977987419 4:103399715-103399737 GTAAAGGAAAAGAAAAGAAATGG - Intergenic
978105444 4:104896571-104896593 TTAAACAAACATAAAAGAGGGGG + Intergenic
978258393 4:106719784-106719806 CTAAAGGAAACAAAAAGAGTTGG + Intergenic
978559903 4:110022087-110022109 TTAAGGAAACATAAAAGACATGG - Intergenic
979089027 4:116453995-116454017 ATAAAGGAAAACAAAAGAGATGG + Intergenic
979193831 4:117896308-117896330 ATAAAGATACATAAAAGAGATGG - Intergenic
979419625 4:120487864-120487886 CTCAGGGAACTTAAAAGAGCAGG + Intergenic
979860905 4:125692741-125692763 CCAAAGAAACATGGAAGAGAAGG + Intergenic
979919538 4:126479805-126479827 CTTAAAGTACAAAAAAGAGATGG - Intergenic
980281682 4:130731514-130731536 CAAAAGGAACACAGAAGAGTAGG - Intergenic
981029289 4:140107903-140107925 CGAGAGGAACAAAAAAGAAATGG + Intronic
981111196 4:140935566-140935588 GGAAGGGAACATGAAAGAGATGG - Intronic
981148787 4:141356925-141356947 CTAAAGGAACAAGAGAAAGAAGG + Intergenic
981395505 4:144244083-144244105 CTAAATGAGGATAAAGGAGATGG - Intergenic
981435467 4:144716151-144716173 CTAAAGGAGCATAATAGTTAAGG - Intronic
981498330 4:145418533-145418555 TTAAAGGTACTTAAAAGAAAAGG - Intergenic
981730963 4:147898153-147898175 CCTAAGGAACTTAAAAGAAATGG - Intronic
982969351 4:161962676-161962698 CTAAAGGAACTTAAAAGACAGGG - Intronic
983678629 4:170325933-170325955 CCAAAGCAACATAAAAGGAAGGG - Intergenic
983714411 4:170760559-170760581 ATAGAGGAACAAAAAAGAGATGG - Intergenic
984189231 4:176585038-176585060 CTAGAGGAAAACATAAGAGAAGG - Intergenic
984723474 4:182998629-182998651 ATAAAGGAACATAAATGACCAGG + Intergenic
985049599 4:185975613-185975635 CAAAAGGGACATAATAGAAAAGG + Intergenic
985156508 4:186993678-186993700 CTCAAGAAAATTAAAAGAGAAGG - Intergenic
985327744 4:188791292-188791314 CTAAAGGGACATTAAAGAAGAGG + Intergenic
986810225 5:11349637-11349659 CTAAAGGTACAGAGAAGAGATGG + Intronic
987202298 5:15589693-15589715 CTTAAGAAGCTTAAAAGAGAGGG + Intronic
988283266 5:29176917-29176939 CTAAAGGAAAAGAAAAAAAAGGG + Intergenic
988331644 5:29849523-29849545 CTTAAGCAAAATAAAATAGAAGG + Intergenic
990027568 5:51213441-51213463 AGAAAAGAAGATAAAAGAGAGGG - Intergenic
990193133 5:53284488-53284510 ATAAAGGAACAAAGAACAGAGGG - Intergenic
990327295 5:54691099-54691121 CTAAAGGACCAGAAGACAGATGG - Intergenic
990702529 5:58489715-58489737 CTAACGGAAAATAAAATGGAGGG - Intergenic
990735983 5:58862786-58862808 TGAAAGAAAAATAAAAGAGAAGG + Intergenic
990763395 5:59155567-59155589 CTAAAGGATCAATAAAGAGTTGG + Intronic
991152439 5:63386543-63386565 CTAAAGAAAAAAAAAAAAGATGG - Intergenic
991625183 5:68593888-68593910 CTGAAGGAGAATAAGAGAGATGG - Intergenic
991704526 5:69345449-69345471 CTAGATTAACAAAAAAGAGAAGG - Intergenic
991903540 5:71484441-71484463 CAAAAAGAAGAAAAAAGAGAGGG + Intronic
992898319 5:81267243-81267265 CTGAAGGAACACAATAGAGTAGG + Intergenic
993468268 5:88274198-88274220 CAAAATGAACATATAAGAGGTGG - Intergenic
993542165 5:89165194-89165216 CTAAAGCATAATAAAAAAGAAGG + Intergenic
993929169 5:93916792-93916814 CTAAAGGAACATTAAATTCAAGG + Intronic
995148374 5:108811864-108811886 CTAATGGAACAAAAAGGAGGAGG - Intronic
995197666 5:109391334-109391356 CTAAAGGAACATCAGACAGATGG - Intronic
995943804 5:117617856-117617878 ATAAAGGAACATCAAGAAGAGGG - Intergenic
996337207 5:122397873-122397895 CTAAGGGAACTAAAAAGACAAGG + Intronic
996469485 5:123843622-123843644 CTGAAGGAACATAAGAGTCAAGG + Intergenic
996918728 5:128742028-128742050 CTAAAGAAACACAAAACAGGTGG + Intronic
997973238 5:138421696-138421718 ATAAAGAAAAATAAAAGAAAAGG + Intronic
998528645 5:142864975-142864997 GTGAGGGAACAAAAAAGAGAGGG - Intronic
999544689 5:152614466-152614488 CTGAAAGAACTTAAAGGAGAAGG + Intergenic
999873407 5:155775510-155775532 CAAAAGGAGCATAATAGAGTTGG - Intergenic
1000186426 5:158863089-158863111 ATAAAGGAACATAAAGGATAGGG - Intronic
1000524714 5:162342906-162342928 TTATGGGAACATAAAAGAAAGGG - Intergenic
1000828808 5:166078493-166078515 ATAAAGGAAAATAACACAGAAGG + Intergenic
1002034179 5:176453543-176453565 CTAAAGGAAAAAAAAACACATGG + Intronic
1002790506 6:434353-434375 TTATAGGAAAATGAAAGAGAAGG - Intergenic
1003428523 6:6016973-6016995 CTTCCGGAACATAAAAGAAACGG - Intergenic
1003829863 6:9996228-9996250 CAAAAGGAATCTAAAAGTGATGG - Intronic
1004828513 6:19450699-19450721 CTAAAAGAGCAAAAAGGAGAGGG + Intergenic
1006999442 6:38295686-38295708 CTAAAGTAACATAAATTAGTGGG - Intronic
1007878713 6:45137515-45137537 ATAACAGAACAAAAAAGAGAAGG + Intronic
1007920311 6:45603167-45603189 CTAAAGTAAGAAATAAGAGAAGG + Intronic
1009751396 6:67882796-67882818 GTAAAGGAACATAAGGAAGATGG + Intergenic
1009760608 6:68000324-68000346 CTAAAGGATAATAAAAGACAAGG - Intergenic
1010455306 6:76047937-76047959 CCAAAAGACCAGAAAAGAGATGG + Intronic
1010577848 6:77554944-77554966 ATCAGGGAAAATAAAAGAGATGG - Intergenic
1011186983 6:84688543-84688565 TTAAAGGAAGATAAATGAAAGGG + Intronic
1011481746 6:87800845-87800867 CCAGAGGAAGAGAAAAGAGAAGG - Intergenic
1011566583 6:88680172-88680194 CTAACAGAATTTAAAAGAGATGG - Intronic
1012044999 6:94262605-94262627 ATAAAGGAACAGAAAACTGAAGG + Intergenic
1012412274 6:98972169-98972191 GTAAATGAACAAAAAAGAGTAGG - Intergenic
1012583131 6:100892672-100892694 GTAAAAGAAAAGAAAAGAGAGGG - Intergenic
1012663414 6:101934002-101934024 TTAAAGGAAAAAAAAAGAAAGGG - Intronic
1012736181 6:102947931-102947953 CTCAATGCACAGAAAAGAGAAGG + Intergenic
1012766519 6:103373712-103373734 CTAAGGAAAAAAAAAAGAGAAGG - Intergenic
1013778192 6:113702136-113702158 CAAAAGGAATATGAAAGATAAGG + Intergenic
1013792468 6:113853360-113853382 CTAAAGCAAAATAAGGGAGATGG - Intergenic
1013872258 6:114779141-114779163 ATAGAGGAAGATACAAGAGAAGG - Intergenic
1014527320 6:122516352-122516374 CTAAAGGTAAATCAAAGAGTTGG + Intronic
1014902017 6:126978089-126978111 CTATAAGAGCATAAAAGAGCAGG + Intergenic
1015147830 6:130006856-130006878 CTTAAGGAAAACAAAGGAGAGGG + Intergenic
1015359951 6:132328595-132328617 CTACACGAACATAAATGAGAGGG + Intronic
1016000450 6:139036109-139036131 ACAAACAAACATAAAAGAGATGG + Intronic
1016423429 6:143909474-143909496 CTAAAGGTACAAAGAAGAGCTGG - Intronic
1018063257 6:160107028-160107050 CTACAGGAAAAAAAAAGGGATGG - Intronic
1018366068 6:163121269-163121291 CTTAAGGAATGGAAAAGAGAAGG - Intronic
1018498478 6:164376687-164376709 GCAAAGGAACAGGAAAGAGAAGG + Intergenic
1018563387 6:165125437-165125459 CTAAACGAACATAAATTTGAGGG - Intergenic
1018791481 6:167151635-167151657 CTCAAGGAAGACAAAAGAGAAGG + Intronic
1019882249 7:3872328-3872350 CTTACAGAAAATAAAAGAGAAGG - Intronic
1020181360 7:5925001-5925023 CTAATGGAACAACAAAGAAACGG - Intronic
1020301573 7:6799889-6799911 CTAATGGAACAACAAAGAAACGG + Intronic
1020345372 7:7156642-7156664 CAAAAGCAACAGAAAGGAGATGG - Intergenic
1020506511 7:8995782-8995804 CTAAAGCCACATAAAGCAGAGGG - Intergenic
1020778104 7:12481891-12481913 CTAAAGGAACCTAGAATAGTAGG - Intergenic
1021055301 7:16040346-16040368 TTAAAAGAACATACAAGAGAGGG - Intergenic
1021105698 7:16637252-16637274 ATAAAAGAACATAAAAGAATAGG + Intronic
1021122969 7:16817831-16817853 CTAAAGGAACATATGATTGAGGG + Intronic
1021212242 7:17868831-17868853 CTATAGAAACAGAAAAGAAAAGG + Intronic
1021489163 7:21199921-21199943 CTTAAGGAACATAAAACATATGG + Intergenic
1022266944 7:28766202-28766224 TTAAAGTAACTTTAAAGAGATGG - Intronic
1022800060 7:33768147-33768169 CTGAAGGCACATAACAGAGCTGG - Intergenic
1024405887 7:48979409-48979431 CTAAAGGTACAAAGAAGAGCTGG + Intergenic
1025216897 7:57064169-57064191 CAAAAAGAAAAAAAAAGAGACGG + Intergenic
1025654487 7:63506579-63506601 CAAAAAGAAAAAAAAAGAGATGG - Intergenic
1026623529 7:71972453-71972475 GCAGATGAACATAAAAGAGAAGG - Intronic
1026899804 7:74030522-74030544 AAAAAGGAAAATAAAAGAAAAGG - Intronic
1027548060 7:79555327-79555349 TTACTGGAACATAAAAGAGTGGG + Intergenic
1027757999 7:82240578-82240600 ATAAAGCAATATAAAAGATACGG - Intronic
1028493445 7:91439483-91439505 AGAAAGAAACATAAAACAGATGG - Intergenic
1028575348 7:92343494-92343516 TTAAGGGAAAATAAAATAGATGG - Intronic
1029029762 7:97455216-97455238 CTAGAGGAAAGTAAAACAGAAGG - Intergenic
1029863292 7:103598786-103598808 TTAAAGGAAGAAAAAAGAAAAGG + Intronic
1029901430 7:104044508-104044530 CTCAGGGAAAATAGAAGAGAGGG - Intergenic
1029956681 7:104647751-104647773 CTAAAGGAACATAAAAGAGATGG - Intronic
1030060743 7:105618915-105618937 GTAAAGGAACTTAAGAGAAAGGG + Intronic
1030323360 7:108193246-108193268 CTCTAGGCACATAAAAGAGAAGG + Intronic
1030401071 7:109050595-109050617 CAAAAGAAAGAGAAAAGAGAAGG - Intergenic
1030521390 7:110602482-110602504 TTAAAGAAAAATAAAAGTGAAGG + Intergenic
1030676085 7:112387110-112387132 CTAAAGCAAAAAACAAGAGAGGG - Intergenic
1030691302 7:112537568-112537590 CTGAAGAAAAATAAAAGGGAGGG + Intergenic
1030698909 7:112617303-112617325 ATGAAGGAATATAAAAGTGATGG + Intergenic
1030832797 7:114247492-114247514 CACAAGGGACATAAAAGAGAAGG - Intronic
1031212796 7:118852185-118852207 CTAAAGAAAAATAAGGGAGAGGG + Intergenic
1031475209 7:122212779-122212801 CTAAAGGAAGATACAAAGGAAGG + Intergenic
1031835095 7:126672471-126672493 CCAGAGGAAGAGAAAAGAGAAGG - Intronic
1032826503 7:135574582-135574604 CTAGAGCATCATAAATGAGAGGG + Intronic
1033042983 7:137935516-137935538 TGAAAGGAACATCAAAGAAAAGG - Intronic
1033524829 7:142200713-142200735 ATGAAGGAACCTAAAAAAGAAGG - Intronic
1033561102 7:142532043-142532065 AAAAAGGAATATAGAAGAGATGG + Intergenic
1033716265 7:144005723-144005745 CCAAGAGAAGATAAAAGAGAGGG - Intergenic
1034609812 7:152356209-152356231 CTAAAGAATCAAAAATGAGAAGG + Intronic
1034992334 7:155555694-155555716 CTAAAGGAACATAGCAGCGCAGG - Intergenic
1036110735 8:5898520-5898542 CTGAAGGAAAATAGAAGGGATGG + Intergenic
1036922699 8:12873028-12873050 CTAAAAGGACATACAAAAGAGGG + Intergenic
1037120630 8:15282208-15282230 TTAAAGGAATAATAAAGAGAAGG - Intergenic
1038206390 8:25470668-25470690 GTAAAGGATCATAAAAGCCATGG - Intronic
1038933772 8:32225032-32225054 CTAAAGCAACATAAAACAATAGG + Intronic
1039635069 8:39155815-39155837 ATAAAGAAAAATAAATGAGAAGG - Intronic
1040020073 8:42733303-42733325 GAAAAAGAAGATAAAAGAGAAGG + Intronic
1040534046 8:48290271-48290293 CTAAAGGCTCATTAAAGAGCAGG + Intergenic
1041659020 8:60382927-60382949 GTAAAGGAATAGAAAAGAGTGGG + Intergenic
1042037724 8:64554752-64554774 CTAAAGGAAAATAAATAGGAAGG - Intergenic
1042220300 8:66466862-66466884 TTCAAGGAACTTAAAAGGGATGG + Intronic
1043461409 8:80464093-80464115 GACAAGGAACATAAGAGAGAAGG - Intergenic
1044161494 8:88922491-88922513 CAAAAGGAACAAAAAATAGAGGG + Intergenic
1044184043 8:89230768-89230790 GGGAAGGAACATAAAAGAAATGG + Intergenic
1044994861 8:97829461-97829483 GTAAAGGAACATAAGGAAGACGG + Intronic
1045824541 8:106381453-106381475 TCAATTGAACATAAAAGAGAAGG + Intronic
1045906897 8:107356502-107356524 CCAAAGGAATATAGAAGGGAGGG + Intronic
1046250096 8:111619550-111619572 TGACAGGAACATAAAAGAGCTGG - Intergenic
1046575519 8:116023794-116023816 CTCAATGAACATACAAGAGAGGG + Intergenic
1046643142 8:116755123-116755145 ATAAAAGAATATCAAAGAGAAGG - Intronic
1046676193 8:117111404-117111426 CTAAAAGAAGAAAGAAGAGATGG - Intronic
1046694474 8:117323597-117323619 CTAGAGAAACATAAAACATAAGG + Intergenic
1046923602 8:119762887-119762909 CCAGAGAAACAGAAAAGAGAAGG + Intronic
1047133157 8:122045321-122045343 CTAAATGAACTGAAAAGAGCAGG + Intergenic
1047144513 8:122182480-122182502 TTAGAAGAACATGAAAGAGATGG - Intergenic
1047268789 8:123334619-123334641 ATAACGAAAAATAAAAGAGAAGG + Intronic
1047465997 8:125114971-125114993 ATAAAGAAACATAAAATATAAGG - Intronic
1047799962 8:128298575-128298597 CAAAGGGAAAATAAAAGACAGGG - Intergenic
1048292159 8:133189543-133189565 CTACAGGAAAAGAGAAGAGAAGG + Intergenic
1049049172 8:140180120-140180142 GAAAAGGAACAAAAAAGAGACGG - Intronic
1050055757 9:1652168-1652190 TTATAGGAACAGAAAAGAAAGGG + Intergenic
1050174775 9:2858426-2858448 TTAAAGGAACATAAGAAAGGAGG - Intergenic
1050352109 9:4750143-4750165 GTCAAGGAACAGAACAGAGAAGG + Intergenic
1050890020 9:10812863-10812885 CTAAAGGAATAAAAATGAAAGGG - Intergenic
1051284566 9:15483063-15483085 CTGAAGGAATATAATGGAGAGGG - Intronic
1051317357 9:15855678-15855700 GTATAGTAAAATAAAAGAGAAGG - Intronic
1051452968 9:17217726-17217748 GTAAAACAACATAAAAGAGTAGG - Intronic
1052379086 9:27750641-27750663 ATAAAGAAGGATAAAAGAGAAGG - Intergenic
1052588424 9:30458945-30458967 CTAAGAGAACATAAACAAGAAGG + Intergenic
1053040718 9:34868750-34868772 TTGAAGGAAAAAAAAAGAGAAGG - Intergenic
1055083831 9:72294165-72294187 CTAAAGCAACAGGAAAGAGGTGG - Intergenic
1057405133 9:94763330-94763352 CTAATGGAACTTAAAAGAAAAGG - Intronic
1057673769 9:97120441-97120463 CTAAAGAAAAAAAAAAAAGATGG + Intergenic
1057924319 9:99130043-99130065 CCAAAGGAATATAAAAATGAGGG + Intronic
1058238436 9:102523686-102523708 CTAATGGAACAAAACAGAGAGGG - Intergenic
1059046078 9:110868472-110868494 TTAAAGGAAAATAAAATGGATGG - Intergenic
1059100502 9:111466904-111466926 TTAAAGGAAAATAAATGAGCTGG - Intronic
1059315884 9:113425562-113425584 CAAAAGGAATATCAAAAAGAAGG - Intronic
1059376456 9:113885489-113885511 ATAAAATAACATACAAGAGAAGG - Intronic
1059540284 9:115123483-115123505 CTTAAGAAACCTAAGAGAGAAGG - Intergenic
1060428843 9:123530046-123530068 GTAAAGGAAGATGAAAGAGCAGG + Intronic
1185630673 X:1514344-1514366 GAAAAGGAAAATAAAAGGGAAGG - Intronic
1185717769 X:2356483-2356505 AGAAAAGAACATGAAAGAGAAGG + Intronic
1186001161 X:5012502-5012524 CCAATGGAACAGAAAACAGAAGG + Intergenic
1186241479 X:7571919-7571941 CTAAAGGCACATAAAAGTTTAGG + Intergenic
1186603933 X:11069064-11069086 CTAAAGGAAAATAAAAATCAAGG - Intergenic
1186970988 X:14842687-14842709 CTAAAGTAACATAAAGAATATGG - Intergenic
1188594894 X:31887911-31887933 CTAATAAAACAGAAAAGAGAAGG + Intronic
1188900121 X:35721917-35721939 ATGAATGAACATAAAAAAGAAGG - Intergenic
1188953988 X:36412889-36412911 CTAAAACAACATTAAAGAAAAGG + Intergenic
1190472211 X:50793743-50793765 CTAAAAGAAAAGAAAAAAGAGGG + Intronic
1191874677 X:65784127-65784149 CTAGAAGGACATAAAAAAGATGG + Intergenic
1192549022 X:72039055-72039077 GGAAAGGAAAAGAAAAGAGAAGG - Intergenic
1192870902 X:75182996-75183018 ATAAAGTAAAATAAAAAAGAAGG - Intergenic
1193580131 X:83253668-83253690 CAAAAAGAACATAGAAGAGAAGG + Intergenic
1194228253 X:91288727-91288749 GTAAAGGAAAACAAAACAGAAGG + Intergenic
1194662474 X:96642193-96642215 CTGAAAGAACAAAGAAGAGAGGG - Intergenic
1195330523 X:103794928-103794950 CTAAAGGAAAATATCAGATAAGG + Intergenic
1195828995 X:109034865-109034887 GTCAAGGAAAGTAAAAGAGAAGG - Intergenic
1196274625 X:113752459-113752481 ATAAAATAAAATAAAAGAGAAGG - Intergenic
1196328049 X:114432334-114432356 CGAAAGAAACATAAAGGAAACGG + Intergenic
1198004099 X:132474310-132474332 CTCAATGAAAATGAAAGAGAGGG - Intronic
1198127954 X:133665753-133665775 TTATATGAACATAAAAGAGGAGG - Intronic
1198180232 X:134200893-134200915 AAAAAGGAACAAAAAAGAGAGGG - Intergenic
1198548835 X:137723265-137723287 CTAGAGGAATGTATAAGAGAGGG - Intergenic
1198726841 X:139687110-139687132 TTCAAGGAACAAGAAAGAGACGG - Intronic
1198752882 X:139952916-139952938 CTAAAGGAACAAAAATTAGCTGG + Intergenic
1199066792 X:143428776-143428798 CTAAAGAAAAAAAAAAAAGAAGG + Intergenic
1199130796 X:144183963-144183985 TTAAAGGAACATAAAAGGAATGG + Intergenic
1200328688 X:155270745-155270767 CAAAAGCAACACAAAAGAGGTGG - Intergenic
1201067043 Y:10106831-10106853 CTACAGTAAAATAGAAGAGAAGG + Intergenic
1201256481 Y:12112722-12112744 ATAAAAGAATATAAAAGAAAGGG - Intergenic
1201731312 Y:17206761-17206783 CTAAAAGAAAACAAAAGAGAAGG + Intergenic
1202143678 Y:21755636-21755658 CTTAAGGAAGATAATGGAGATGG - Intergenic