ID: 1029956686

View in Genome Browser
Species Human (GRCh38)
Location 7:104647772-104647794
Sequence AGGAAGAAGGAGAAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7889
Summary {0: 2, 1: 10, 2: 168, 3: 1248, 4: 6461}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029956681_1029956686 -2 Left 1029956681 7:104647751-104647773 CCATCTCTTTTATGTTCCTTTAG 0: 1
1: 0
2: 3
3: 57
4: 526
Right 1029956686 7:104647772-104647794 AGGAAGAAGGAGAAAGAGGAAGG 0: 2
1: 10
2: 168
3: 1248
4: 6461
1029956680_1029956686 2 Left 1029956680 7:104647747-104647769 CCTGCCATCTCTTTTATGTTCCT 0: 1
1: 1
2: 1
3: 35
4: 426
Right 1029956686 7:104647772-104647794 AGGAAGAAGGAGAAAGAGGAAGG 0: 2
1: 10
2: 168
3: 1248
4: 6461

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029956686 Original CRISPR AGGAAGAAGGAGAAAGAGGA AGG Intronic
Too many off-targets to display for this crispr