ID: 1029957510

View in Genome Browser
Species Human (GRCh38)
Location 7:104655031-104655053
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2167
Summary {0: 1, 1: 0, 2: 5, 3: 40, 4: 2121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029957510 Original CRISPR TTGGACTAGCTGAAGGAAGA AGG (reversed) Intronic
Too many off-targets to display for this crispr