ID: 1029958147

View in Genome Browser
Species Human (GRCh38)
Location 7:104661080-104661102
Sequence CACTGATATCAGGAAGGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029958143_1029958147 0 Left 1029958143 7:104661057-104661079 CCTCAGTATTGAGATCCTGTGAG 0: 1
1: 0
2: 0
3: 19
4: 130
Right 1029958147 7:104661080-104661102 CACTGATATCAGGAAGGCTTAGG 0: 1
1: 0
2: 1
3: 12
4: 164
1029958142_1029958147 20 Left 1029958142 7:104661037-104661059 CCTTCTTAATGGGAGGGATGCCT 0: 1
1: 0
2: 1
3: 8
4: 94
Right 1029958147 7:104661080-104661102 CACTGATATCAGGAAGGCTTAGG 0: 1
1: 0
2: 1
3: 12
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029958147 Original CRISPR CACTGATATCAGGAAGGCTT AGG Intronic
903713323 1:25343058-25343080 CACTTACATTAGGAAGGCTATGG - Exonic
906706206 1:47896601-47896623 CACTAAAATCAGGCAGGCTTGGG + Intronic
910437635 1:87221124-87221146 CACTGACATTATGAATGCTTGGG + Intergenic
912964106 1:114222275-114222297 AACTGATATGAGGAAGGCAGTGG - Intergenic
914415432 1:147477059-147477081 CACTGAAATCCCCAAGGCTTAGG - Intergenic
915603964 1:156939381-156939403 CGCCGATATCAGGCAGGCTTTGG - Intronic
915970256 1:160349915-160349937 CAATGGTATCAGGGAGTCTTAGG - Intronic
916417356 1:164604790-164604812 CACTGATATGAAGATGTCTTAGG - Intronic
916659252 1:166906109-166906131 CTCTGACCTCAGGAAGGCTGCGG - Intergenic
916659520 1:166908772-166908794 CACTGGTATATGGAAGGCTCTGG + Exonic
916745992 1:167685317-167685339 AACTGGTTTCAGGAAGGTTTAGG - Intronic
916861093 1:168806364-168806386 AACTGAGATGAGGAAGGCTGTGG - Intergenic
917881169 1:179337348-179337370 CCTTGATATCAGGAAGGGTATGG + Intronic
918294801 1:183146463-183146485 CAGAGACAGCAGGAAGGCTTTGG + Intergenic
920958808 1:210645759-210645781 AACTGGTATCAGGAAGGCCTGGG - Intronic
920974399 1:210772076-210772098 AACTGTGATCAGGAAGACTTTGG + Intronic
923644814 1:235808322-235808344 CACTGATATCTCCAGGGCTTTGG - Intronic
923857066 1:237856663-237856685 CACTGATATTAGTAAGGTTTTGG + Intergenic
1064408373 10:15084405-15084427 CACTGGTAACAAGAATGCTTTGG - Intronic
1066550847 10:36555082-36555104 CTCTGATATCATGAAGGTTGTGG + Intergenic
1071288696 10:84172688-84172710 GACTGATGACAGGAATGCTTTGG - Intergenic
1072572646 10:96672259-96672281 CAGTGAAATCAGGCAGCCTTAGG - Intronic
1072747070 10:97948204-97948226 CACAGAAATCAGGAAGGCAAGGG + Intronic
1074875695 10:117611503-117611525 CCCAGAGATCAGGAAGCCTTTGG - Intergenic
1078365506 11:10703052-10703074 AACTCATATCGGGAAGGCTGTGG - Intergenic
1078672320 11:13376421-13376443 CACACATATTAGGAAGGCCTAGG + Intronic
1079889280 11:26030101-26030123 TACTGAGATAGGGAAGGCTTGGG + Intergenic
1082025267 11:47566607-47566629 GAATGAAATCAGGAAGGCATGGG - Intronic
1090120899 11:124026901-124026923 TACTGATTCCAGGAAGGCATGGG + Intergenic
1090223053 11:125047637-125047659 AACTGATATGAGGAAGACTGTGG - Intergenic
1091317394 11:134624176-134624198 CAAAGGTCTCAGGAAGGCTTTGG + Intergenic
1092564915 12:9654531-9654553 CATTGATATGAGAAAGGCTATGG + Intergenic
1093473259 12:19527838-19527860 AAATGATGTCAGGAAGGCTGAGG + Intronic
1094017534 12:25880989-25881011 TACTGATATCAGGAATCATTTGG - Intergenic
1100160705 12:91857306-91857328 TATTGATATTAGGAAGGCATGGG - Intergenic
1101943720 12:109120120-109120142 CTGTGTTATAAGGAAGGCTTCGG + Intronic
1103928008 12:124434282-124434304 CATTGATTTCAGTAAGGCCTGGG - Intronic
1105846969 13:24301698-24301720 CCCTGAAAGCAGGAAGGCCTTGG - Intronic
1106772579 13:32976059-32976081 CACTCATAACAGCAATGCTTTGG + Intergenic
1111038414 13:82709959-82709981 CACTGACTTTAGCAAGGCTTTGG + Intergenic
1111102161 13:83602406-83602428 GATTGTTATCAGGAAGTCTTTGG + Intergenic
1111139199 13:84091888-84091910 CACTGATAACTGGAAGCTTTAGG + Intergenic
1113317076 13:109192385-109192407 AACAGATGTCAGGAAGGATTAGG - Intronic
1118344408 14:64926345-64926367 CACAGATATAAGAAAGGCATGGG - Intronic
1122562545 14:102626696-102626718 CAGTGTTAACAGGTAGGCTTTGG - Intronic
1124473367 15:30008797-30008819 CTCAAAGATCAGGAAGGCTTGGG + Intergenic
1125699089 15:41664981-41665003 CACTAATATCAGGAAAGGTCAGG - Intronic
1127840069 15:62823554-62823576 CACTGCTTTCAGGAAGAGTTTGG + Intronic
1128772866 15:70295399-70295421 CAGTGAAATCAGGAACTCTTGGG + Intergenic
1130443070 15:83974837-83974859 TACTGAGATCAGGATGGATTAGG + Intronic
1130891368 15:88136592-88136614 CGCTGATCTCAGGAAGGTCTGGG + Exonic
1133537336 16:6714661-6714683 CACTGATATCATAAAGGTGTAGG + Intronic
1136422358 16:30143087-30143109 CCCAGATACCAGGAAGGCTGAGG + Intergenic
1137026565 16:35482032-35482054 CAATTCTATCAGGCAGGCTTAGG + Intergenic
1144148036 17:12416975-12416997 AATTGATATTAGGAAGGCATAGG - Intergenic
1145244664 17:21260661-21260683 CACTGAAATCATCAGGGCTTGGG + Intergenic
1145757584 17:27403927-27403949 CAGTGATATCAGGAATGGCTTGG - Intergenic
1146717207 17:35096541-35096563 CTCTGATAACAGGAAGTCTGAGG - Intronic
1153391002 18:4559433-4559455 CACTGTTGTCAGCAAGGCTTTGG - Intergenic
1153737620 18:8088164-8088186 AACTGAAATAAGAAAGGCTTGGG - Intronic
1156395374 18:36694571-36694593 CAATGATATAAGGCAGGGTTTGG - Intronic
1157323906 18:46655681-46655703 AGCTGAGATCAGGAAGGCTGTGG - Intronic
1158209581 18:55032248-55032270 GACTGATAACATGAAGGCTCTGG + Intergenic
1160095836 18:75872081-75872103 CGCAGATATCAGGCAGGCTGCGG - Intergenic
1162639250 19:11995148-11995170 CACAGACATCAGGATGTCTTTGG + Intergenic
1163222953 19:15934871-15934893 CCCTGATTTCCGGAAGGCTGTGG + Intergenic
1163383105 19:16981606-16981628 TTCTGATATCAGGAAAGCTAAGG + Intronic
1164537122 19:29094054-29094076 CACGGCTATCTGGCAGGCTTTGG + Intergenic
1165128547 19:33618002-33618024 AACTGACTTCAGGAAGCCTTGGG + Intergenic
1165440128 19:35821305-35821327 AACTGGCACCAGGAAGGCTTGGG - Intergenic
930995707 2:57715072-57715094 CACTGACATAAGGAAGCATTAGG - Intergenic
932363751 2:71131979-71132001 TACTGAGATAGGGAAGGCTTGGG - Intronic
937312783 2:120912288-120912310 TTTTGATGTCAGGAAGGCTTTGG + Intronic
938002068 2:127750138-127750160 CCCTGATACCAGGGAGGCTGAGG - Intronic
938215745 2:129511987-129512009 CCCTGATATCAGGAAGATGTGGG + Intergenic
938646417 2:133335153-133335175 CATGGATACCAGGAAGGGTTGGG - Intronic
940001664 2:148972673-148972695 CTGTGATATCAGGTAGTCTTAGG - Intronic
941968289 2:171322343-171322365 CACTGATACCAGAAAGGGTCTGG + Exonic
945978570 2:216289894-216289916 CTCTAATCTCAGGAAGACTTGGG + Intronic
946216239 2:218185941-218185963 AAGGGATATCAGGAAGTCTTGGG - Intergenic
946242288 2:218363965-218363987 CACTGATTGCAGGAAGTCCTAGG - Intronic
946960436 2:224979461-224979483 CACAGCTATCAGGAAGACCTAGG - Intronic
947787889 2:232840928-232840950 CACTGAAATTAGGAGGGCTTTGG + Intronic
948312400 2:236998374-236998396 CACTGCAATCAGAAAGGTTTGGG + Intergenic
948643499 2:239389767-239389789 CACTGATGTCAGGAAGGAAGGGG - Intronic
1168940787 20:1709396-1709418 CATTGATATCAGGATGGCAGGGG - Intergenic
1169995829 20:11555004-11555026 AAATGACATCTGGAAGGCTTTGG - Intergenic
1171041884 20:21771753-21771775 TACTGAAATGAAGAAGGCTTGGG - Intergenic
1174025982 20:47575409-47575431 AACTTAAATCATGAAGGCTTGGG + Intronic
1174745855 20:53061904-53061926 AAATGATATCAGAAAAGCTTGGG - Intronic
1174889945 20:54381027-54381049 CATAGATTTCAAGAAGGCTTTGG - Intergenic
1175396557 20:58667939-58667961 CACTGATGCCAGGCAGGCTATGG - Intronic
1175563083 20:59949304-59949326 CACTGCTATCTGAAAGGGTTTGG - Intergenic
1175865821 20:62175883-62175905 CACAGATGTCAGGAGGGCTCTGG + Intronic
1177627876 21:23687844-23687866 CACTTATATAAGGAAAGCATAGG - Intergenic
1178008093 21:28246618-28246640 CACTATTATCTGGAAGGCCTTGG - Intergenic
1182879775 22:33723541-33723563 CACTGATATCAGGCGGATTTGGG + Intronic
1183849956 22:40577309-40577331 CACTCATATCAGGAATATTTGGG - Intronic
1184120142 22:42444676-42444698 CTCTGCTGTCAGGAAGGCTGGGG - Intergenic
1184542445 22:45135925-45135947 CTCTGGTATCAGGTAGGCCTGGG + Intergenic
949223414 3:1663538-1663560 CATTGAAATCAGAAAGTCTTAGG + Intergenic
949838210 3:8291952-8291974 AACTGAGATGAGGAAGGCTGTGG + Intergenic
954263599 3:49457240-49457262 GTCAGATGTCAGGAAGGCTTGGG + Intergenic
955089552 3:55735878-55735900 TACTGAAATAAGGAAGGCTGAGG - Intronic
956478407 3:69648108-69648130 CACTGACATCAAGAAAGCTTGGG + Intergenic
956562506 3:70595952-70595974 CACTGATATCAGGAGAGTTCAGG - Intergenic
957792344 3:84958291-84958313 CACTGGCATCAGGCAGCCTTTGG - Intergenic
959693685 3:109226663-109226685 CACCGGGATCAGGTAGGCTTGGG - Intergenic
959832404 3:110880330-110880352 CACTGACATCAGGAGGGCGAGGG + Intergenic
960158260 3:114319946-114319968 CAGTGGTATGAGGAAGGCTGGGG + Intergenic
961100212 3:124192035-124192057 TACTGTTATCAGGAAAGTTTGGG + Intronic
962256566 3:133873825-133873847 TTATGTTATCAGGAAGGCTTTGG - Intronic
964034136 3:152175442-152175464 CATTCATATTAGGAAGGCTTTGG + Intergenic
964384158 3:156129515-156129537 CTCTGATATCAGGCTGACTTAGG + Intronic
964384815 3:156136385-156136407 CTATGAAGTCAGGAAGGCTTGGG - Intronic
966092385 3:176155761-176155783 CACAGTTATTAGGAAGGCTGAGG + Intergenic
966472561 3:180307741-180307763 CACTGATACCAGCTGGGCTTAGG - Intergenic
967262577 3:187658130-187658152 CTTTGTTATCAAGAAGGCTTGGG - Intergenic
970233594 4:13935908-13935930 AACAGAAATCAGGAAGGCTTTGG + Intergenic
970736467 4:19175100-19175122 CAGTGAAATCATGGAGGCTTTGG + Intergenic
971825203 4:31612367-31612389 CACTTATATAAGCAAGGTTTGGG - Intergenic
972688618 4:41374711-41374733 CAATGATATCAGTAAGGATCTGG + Intronic
976586485 4:86802956-86802978 CACAGCTACCAGGAAGGCTGAGG + Intronic
977904917 4:102466321-102466343 CATAGATATTAGGAAAGCTTTGG - Intergenic
979157495 4:117415225-117415247 CATTGATATCAGAAATGTTTGGG + Intergenic
982349255 4:154396936-154396958 AAGTTATATCAGGAAGGTTTAGG - Intronic
982363114 4:154544588-154544610 AATTGATATCATGAAGCCTTAGG - Intronic
982526726 4:156488489-156488511 TACTGTTATCAGCAAGACTTTGG - Intergenic
982666490 4:158270805-158270827 AAATGATATCAGAAAGGATTAGG - Intergenic
983510722 4:168606867-168606889 CTCTGATCTCAGGAAGGCCTAGG - Intronic
987481221 5:18460706-18460728 GTCAGATATCAGGAAGGCTATGG - Intergenic
987739383 5:21885775-21885797 TACTGATATCAGTGAGTCTTTGG - Intronic
990334921 5:54763310-54763332 CACTTATATCAGAAAAACTTGGG + Intergenic
991193018 5:63897673-63897695 CACTGATACCATGAAGGGCTGGG - Intergenic
991627454 5:68618680-68618702 CCCTGGCTTCAGGAAGGCTTTGG + Intergenic
997766888 5:136513559-136513581 CTATTATATCAGGAAGTCTTAGG - Intergenic
998393842 5:141805728-141805750 CAAAGATATCAGGAAGGACTAGG - Intergenic
999192304 5:149757526-149757548 CTCTGAATTCAGGAAGGCCTCGG - Intronic
1000633538 5:163617681-163617703 CTCTGAAATCAGGAAGGAATGGG - Intergenic
1000743580 5:165001314-165001336 CACTAATATCAGCAAGGATAGGG + Intergenic
1006595022 6:35186466-35186488 CAATGAGTTCAGGAAGACTTTGG - Intergenic
1007513020 6:42389188-42389210 CACTGAAATCTGTAAGGCTGTGG + Intronic
1010575549 6:77525732-77525754 CAAAGATATGAGGAAGTCTTTGG + Intergenic
1012972164 6:105743035-105743057 CACTAATATCAGGATGCTTTTGG - Intergenic
1020197785 7:6055509-6055531 CACTGATCTCAGAGAGGCTGAGG + Intronic
1022323959 7:29313232-29313254 CACTTATCTCTGGAAGGCTGAGG - Intronic
1022546616 7:31195079-31195101 CACTGATGTAAGAAAGACTTTGG - Intergenic
1023166755 7:37350414-37350436 CATTGACATCATGAAGGCTAGGG + Intronic
1023277720 7:38538472-38538494 GACAGATTTCAGAAAGGCTTAGG + Intronic
1026310388 7:69178518-69178540 CAGTGATAAAAGGCAGGCTTTGG + Intergenic
1028957952 7:96714806-96714828 CACAGCTATCAGGGAGGCTGAGG - Intergenic
1029307208 7:99629254-99629276 CACTGACATCAGAGAGGTTTGGG + Exonic
1029732516 7:102447508-102447530 CAGTGATGACACGAAGGCTTCGG + Exonic
1029958147 7:104661080-104661102 CACTGATATCAGGAAGGCTTAGG + Intronic
1035374724 7:158400514-158400536 TAATGATGTCAGGATGGCTTTGG - Intronic
1035584117 8:759079-759101 TATTGATAACAGGAAGGCTGTGG - Intergenic
1035584151 8:759214-759236 TATTGATAACAGGAAGGCTGTGG - Intergenic
1037270808 8:17128206-17128228 CACTGATCTCAGGAACTTTTGGG - Intergenic
1038001086 8:23391794-23391816 CACTGAGGTCAGGAGGGGTTTGG + Intronic
1039233934 8:35480853-35480875 CACTGAGATGAGGAAGAATTTGG + Intronic
1039770902 8:40685893-40685915 CACTGAGCTCAGAATGGCTTGGG + Intronic
1041753142 8:61283155-61283177 AACTGATATTAGAAAGGCTGAGG - Intronic
1042386925 8:68187362-68187384 CACGGAAAGCAGGAAGGCTTTGG + Intronic
1042556616 8:70038709-70038731 CCCAGCTATCAGGAAGGCTAAGG + Intergenic
1044547675 8:93477600-93477622 CATTGAGATGAGGAAGGCTGTGG - Intergenic
1045821516 8:106343869-106343891 AACTGATATACAGAAGGCTTAGG + Intronic
1046617859 8:116497497-116497519 CACAGATATCAGCATGGATTGGG + Intergenic
1046875876 8:119254087-119254109 CAATGCTCTCAGGAAGGCTCTGG - Intergenic
1050302221 9:4271285-4271307 CTATGTTATCAGCAAGGCTTTGG + Intronic
1057955861 9:99407280-99407302 CTCTGAAATCAGGAAGGCCTGGG + Intergenic
1060142126 9:121219414-121219436 CAATGCTATCAGGAAGGCTTTGG - Intronic
1060292958 9:122320887-122320909 GACTGAAAGCAGGAAGCCTTAGG - Intronic
1186629403 X:11333096-11333118 CACTGAGAACAGTAAGGCTATGG + Intronic
1187039736 X:15580931-15580953 CACCCATATCAGGAAAGATTTGG - Intronic
1188323841 X:28774831-28774853 TACTGAGATGAGGAAGGCTAGGG - Intronic
1192049933 X:67715425-67715447 CCCTGATACCTGGAAGGCCTAGG + Intronic
1199412740 X:147543535-147543557 TACTAAAATGAGGAAGGCTTTGG + Intergenic
1202098680 Y:21281946-21281968 CACTGAACTGAGGAATGCTTTGG - Intergenic