ID: 1029959990

View in Genome Browser
Species Human (GRCh38)
Location 7:104680499-104680521
Sequence TGATAGGGAGATATTTTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 470
Summary {0: 1, 1: 0, 2: 0, 3: 45, 4: 424}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029959990_1029960000 24 Left 1029959990 7:104680499-104680521 CCGCCCAAAATATCTCCCTATCA 0: 1
1: 0
2: 0
3: 45
4: 424
Right 1029960000 7:104680546-104680568 TCATACCCATTATCCCTCAAGGG No data
1029959990_1029959999 23 Left 1029959990 7:104680499-104680521 CCGCCCAAAATATCTCCCTATCA 0: 1
1: 0
2: 0
3: 45
4: 424
Right 1029959999 7:104680545-104680567 ATCATACCCATTATCCCTCAAGG 0: 1
1: 0
2: 2
3: 6
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029959990 Original CRISPR TGATAGGGAGATATTTTGGG CGG (reversed) Intronic
903561087 1:24228308-24228330 TGATATGGAGAAAGTTTGAGTGG - Intergenic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
903937342 1:26905545-26905567 TGATGAGGAGATATTTGAGGTGG + Intronic
904127711 1:28253294-28253316 TGATAGGAAGAAAGTTTGAGTGG + Intergenic
904580854 1:31543188-31543210 TGATATGGAGAAAGTTTGAGTGG - Intergenic
906715330 1:47964596-47964618 GGATATTGATATATTTTGGGGGG + Intronic
907965823 1:59328504-59328526 TGATATGGAGAAAATTTGAGTGG - Intronic
908417515 1:63927884-63927906 GGATAGTGAGATATTTTGTTAGG - Intronic
910298346 1:85676013-85676035 TGATAGGGAGAAAGTTTTAGTGG - Intronic
910354901 1:86342588-86342610 TGAAAGGGAAATTTGTTGGGTGG - Intergenic
911135643 1:94436902-94436924 TGATAGGGAGAAAGTTTGAGTGG + Intronic
911199036 1:95025860-95025882 TGATATGGAGAAAGTTTGAGTGG - Intronic
911289443 1:96039004-96039026 TGTTAGGGGGATCTTTTGGGAGG - Intergenic
913253872 1:116936983-116937005 TGATAAGGAGAAAATTTGGCAGG + Intronic
914881584 1:151551069-151551091 TGCTAATGAGCTATTTTGGGGGG - Intronic
915007835 1:152656394-152656416 TCTTAGGGGGACATTTTGGGGGG - Intergenic
915156651 1:153882151-153882173 TGATGGGGGGATAGTTAGGGTGG - Intronic
916304249 1:163311297-163311319 TGATATGGAGAAAGTTTGAGTGG - Intronic
916566691 1:165985241-165985263 TGATATGGAGATAGTTTGAATGG + Intergenic
916598771 1:166272256-166272278 TGACAGGGACATAATTTGGATGG + Intergenic
916855084 1:168741080-168741102 GGATAGGCAGACATTTTGGGAGG - Intergenic
917861481 1:179149182-179149204 TGATATGGAGAAAATTTGAGTGG + Intronic
918392126 1:184076739-184076761 TGATATGGAGAAAGTTTGAGTGG + Intergenic
918499243 1:185175633-185175655 TTTTAGGAAGATATTTTGGCAGG + Intronic
919084806 1:192909452-192909474 TGATAAGGAGAGATTGTTGGAGG + Intergenic
919474909 1:198021155-198021177 TGACATGGATATCTTTTGGGGGG + Intergenic
920024323 1:202981996-202982018 TGACAGGGAGAAAGTTTGAGTGG - Intergenic
921210437 1:212891918-212891940 TGATATGGAGAAAGTTTGAGTGG + Intronic
922651227 1:227340748-227340770 TGATATGGAGAAAGTTTTGGTGG - Intergenic
924409646 1:243790528-243790550 TGATAAGGAGAAAGTTTGAGTGG - Intronic
1064461800 10:15541768-15541790 TGTTAGGAAGTTGTTTTGGGAGG - Intronic
1065546587 10:26827544-26827566 TGATAGGGAGAAAGTTTTAGTGG - Intronic
1066374694 10:34847106-34847128 TGATATGGAGAAAGTTTGAGTGG + Intergenic
1066478946 10:35776718-35776740 TGATAGGGAGAAAGTGTGAGTGG - Intergenic
1067857970 10:49813492-49813514 TGTTAGGAAGATATCTTTGGGGG - Intergenic
1069947115 10:71995042-71995064 TGATATGGAGAAAGTTTGAGTGG - Intronic
1072559936 10:96562788-96562810 TGTTAGGGAAATATTATAGGTGG + Intronic
1072569327 10:96644729-96644751 TAATAAGCAGATTTTTTGGGGGG - Intronic
1073227057 10:101930617-101930639 TGATGGGAAAATAGTTTGGGTGG - Intronic
1074210727 10:111331848-111331870 TGATAAGGAGAAAGTTTGAGTGG + Intergenic
1074793033 10:116911367-116911389 TGATATGAAGCTATTTGGGGAGG + Intronic
1075193368 10:120331877-120331899 TGATATGGAGAAAGTTTGAGTGG + Intergenic
1075971165 10:126654548-126654570 TGATATGGAGAAAGTTTGAGTGG - Intronic
1076172412 10:128332624-128332646 TGATATGGAGAAAGTTTGAGTGG + Intergenic
1076456902 10:130606418-130606440 TAATAGGAAGATATTTCTGGAGG + Intergenic
1078437480 11:11337576-11337598 TGACAGAGAGATATTTAGGAGGG + Intronic
1078438987 11:11348522-11348544 TGGGAGTGAGATATTTTGGAGGG - Intronic
1079801102 11:24870031-24870053 TGATAGGGAGAAATTTTTAGTGG + Intronic
1080183289 11:29449165-29449187 TGGTAAGGAGATTTTCTGGGTGG + Intergenic
1080391766 11:31854787-31854809 TGACATGGATATCTTTTGGGGGG - Intronic
1081210942 11:40333123-40333145 TGAAAGTGAGATATTTTTGGTGG - Intronic
1081275670 11:41146263-41146285 TGATGGGGAGATATTATGTTTGG - Intronic
1081408884 11:42731789-42731811 TGCTAGAGAAATATTTTTGGGGG - Intergenic
1083604793 11:63971824-63971846 TGCTAGGAAGATATGTGGGGTGG - Intergenic
1084746795 11:71175672-71175694 TGGTTTGGATATATTTTGGGTGG - Intronic
1085134674 11:74075350-74075372 GGTTCGGGCGATATTTTGGGGGG + Intronic
1085414167 11:76309347-76309369 TATTAGGGAGAAATTTTGGTTGG - Intergenic
1085500181 11:77014287-77014309 TGATACGGAGGTATTGTGGATGG - Intronic
1088439667 11:109855763-109855785 TGATATGGAGAAAGTTTTGGTGG - Intergenic
1089415280 11:118284085-118284107 TGATATGGAGAAAGTTTGAGTGG + Intergenic
1090523156 11:127500471-127500493 TGATATGGAGAAAGTTTGAGTGG + Intergenic
1090984301 11:131751769-131751791 TAATAAGTATATATTTTGGGGGG - Intronic
1091852974 12:3715280-3715302 TGAGAGGGAGCTAATTTGGACGG + Intronic
1092124154 12:6064108-6064130 TGATGGAGAGTTATTTTTGGAGG - Intronic
1092152322 12:6258887-6258909 TGATAAGGAGAAAGTTTGAGTGG - Intergenic
1092784185 12:12012891-12012913 TGAAAGGGGGAAATATTGGGTGG + Intergenic
1093883768 12:24436381-24436403 TGATAAGGAGAAAGTTTGAGTGG + Intergenic
1094028986 12:25989138-25989160 TGACAGGCAGAAATGTTGGGAGG - Intronic
1095962243 12:47843011-47843033 TGATTTGGAGATATTTATGGGGG - Exonic
1098864233 12:75743735-75743757 TAATAAGAAGATATTATGGGCGG - Intergenic
1099250796 12:80250906-80250928 TAATAGGAAATTATTTTGGGGGG + Intronic
1099342946 12:81461101-81461123 TGAAAGGGTTATGTTTTGGGTGG - Intronic
1099876372 12:88410949-88410971 GGTTAGGGAAATATTTTGTGTGG + Intergenic
1100956472 12:99914707-99914729 TGGGAGGGTGATATTTAGGGGGG + Intronic
1100961943 12:99972433-99972455 TGATATGGAGAAAGTTTGAGGGG + Intronic
1101041351 12:100759049-100759071 AGATGGGCATATATTTTGGGAGG + Intronic
1101436229 12:104667084-104667106 TGATACGAAGTTATTTTGAGAGG + Intronic
1101598326 12:106187431-106187453 TGAGAGGGAGATGGTATGGGGGG - Intergenic
1102040537 12:109798069-109798091 TGTTCTGGAGATATTTTTGGTGG + Intronic
1102654073 12:114465564-114465586 TGATATGGAGGAATTTTGAGTGG + Intergenic
1102824645 12:115937721-115937743 GGGGAGGGAGCTATTTTGGGTGG + Intergenic
1102849604 12:116228020-116228042 TGATATGGAGAAAGTCTGGGTGG + Intronic
1102865636 12:116371883-116371905 TGATACGAAGTTATTTTAGGTGG + Intergenic
1105288694 13:19030874-19030896 TGATATGGAGAAACTTTGAGTGG - Intergenic
1105780088 13:23698082-23698104 TGATATGGAGAAAGTTTGAGTGG + Intergenic
1106082673 13:26513301-26513323 TGAAAAGGAGATATTTTTGGTGG - Intergenic
1106810493 13:33353754-33353776 TGAGAAGGAGCTATTTTGGTTGG - Intergenic
1107012750 13:35684263-35684285 TCCAAGGGAGATCTTTTGGGAGG + Intergenic
1107115464 13:36741543-36741565 TGGCAGGAAGATATTTTTGGGGG - Intergenic
1107287276 13:38808277-38808299 TGATACGGAGAAAGTTTGAGTGG - Intronic
1108278073 13:48831638-48831660 TGATATGGAGAAAGTTTGAGTGG + Intergenic
1109265827 13:60199179-60199201 TGATATGGAGAAAGTCTGGGTGG - Intergenic
1109556634 13:63984527-63984549 TGATATGGAGAAAGTTTGAGTGG - Intergenic
1109584227 13:64376689-64376711 ATGTAGGGAGATATTTTGGCTGG + Intergenic
1109962369 13:69647243-69647265 TGATATAGAGATATTTTATGTGG - Intergenic
1110447274 13:75600017-75600039 TGATATGGAGAAAGTTTGAGTGG + Intronic
1110766523 13:79285465-79285487 TGATATGGAGAAAGTTTGAGTGG + Intergenic
1111406462 13:87813120-87813142 TAATAATGAGATATTTTGGAGGG + Intergenic
1111613650 13:90637841-90637863 GGAAAGGAAAATATTTTGGGTGG + Intergenic
1113554994 13:111226096-111226118 TGATATGGAGAAAGTTTGAGTGG + Intronic
1115109966 14:29809742-29809764 TGATAGGGAGAAAGTTTTAGTGG - Intronic
1115136333 14:30113075-30113097 TGATAGGGAGAAAGTTTTCGTGG + Intronic
1115486837 14:33918615-33918637 TGATATGGAGAAAGTTTGAGTGG + Intergenic
1115528617 14:34305557-34305579 TGATAGGGAGAAATTTCTTGTGG + Intronic
1119001614 14:70887078-70887100 AGATAGGGAGATTGTCTGGGTGG - Intergenic
1119005094 14:70918134-70918156 TGATATGGAGAAAGTTTGAGTGG - Intronic
1120128556 14:80777231-80777253 TGATTGGGAGGTGATTTGGGAGG + Intronic
1120329276 14:83068669-83068691 TGATATGGAGAAAGTTTGCGTGG - Intergenic
1120664094 14:87285395-87285417 TGATAGGTAGAGATTTGGAGTGG + Intergenic
1121018659 14:90565201-90565223 TGATAGGGAGAAAGTTTGAGTGG - Intronic
1122170485 14:99870172-99870194 TGATAGGGAGAAAGTTTGAGTGG + Intronic
1125376138 15:39031682-39031704 TGATGGGGAGAAGTTTGGGGAGG + Intergenic
1125651932 15:41324431-41324453 TGATATGGAGAAAGTTTGAGTGG - Intronic
1126352292 15:47756954-47756976 TGGTAGGGCTTTATTTTGGGAGG + Intronic
1126806550 15:52355316-52355338 TGTTTGGGAGTTTTTTTGGGGGG - Intronic
1127705136 15:61539549-61539571 TGATATGGGGAAATTTTGAGTGG - Intergenic
1128663542 15:69521539-69521561 TTATAGGAAGATATGTTGAGAGG + Intergenic
1128690083 15:69717749-69717771 TGATATGGAGAAAGTTTGGGTGG - Intergenic
1129237497 15:74232548-74232570 TGATAGGGAGATATGGGGGAAGG - Intergenic
1130358771 15:83160531-83160553 CGAAATGGAAATATTTTGGGGGG + Intronic
1132032382 15:98449240-98449262 TGATAGGGAGAAAGTTTTAGTGG - Intronic
1137332874 16:47517132-47517154 TGCTTTGGAGATATTATGGGTGG - Intronic
1138073039 16:54012208-54012230 TGATACGGAGAGAGTTTGAGTGG + Intronic
1138302029 16:55938479-55938501 AGATATGTAGATATGTTGGGAGG + Intronic
1139059195 16:63227783-63227805 TGATATGGAGAAAGTTTGAGTGG - Intergenic
1140089726 16:71827717-71827739 GAATAGGTAGATATTTTGGAAGG + Intergenic
1142616160 17:1136816-1136838 TGATATGGAGAAAGTTTGAGTGG - Intronic
1142794133 17:2293984-2294006 CCCTAGGGAGATATTTTGGGGGG - Intronic
1142809380 17:2388108-2388130 TGATAGGGAGAGGTTTGTGGGGG - Intronic
1143748533 17:9011575-9011597 AGATATGGATATCTTTTGGGGGG + Intergenic
1144252337 17:13430178-13430200 TGAGATGGAGAAATTTTGGGGGG + Intergenic
1144609076 17:16693060-16693082 TGATAGTGAATTATTTTTGGTGG + Intronic
1144903685 17:18622466-18622488 TGATAGTGAATTATTTTTGGTGG - Intergenic
1145128892 17:20324264-20324286 TGATAGTGAATTATTTTTGGTGG + Intergenic
1145195779 17:20893359-20893381 TGATAGTGAATTATTTTTGGTGG - Intronic
1146014764 17:29224007-29224029 TGAGACTGAGATATTATGGGAGG - Intergenic
1146149600 17:30455910-30455932 GTATATGGAGATAGTTTGGGTGG + Intronic
1146412644 17:32600742-32600764 TGATACGGAGAAAGTTTGAGTGG - Intronic
1150061964 17:62076182-62076204 TAATAGGGAGCTATTTTGGAGGG + Intergenic
1150386183 17:64763101-64763123 TTTTAGGAATATATTTTGGGGGG - Intergenic
1151105406 17:71610614-71610636 AGAGAGAGAGATATTTTTGGGGG + Intergenic
1153144132 18:2009913-2009935 TGATATGGAGAAAGTTTGAGTGG - Intergenic
1153154683 18:2134990-2135012 GGATAGGGAGATATATTGAGAGG - Intergenic
1153395364 18:4614154-4614176 TGATATGGAGAAAGTTTGAGTGG - Intergenic
1153566390 18:6422412-6422434 TGATATGGAGAAAGTTTGAGTGG - Intergenic
1153877938 18:9392513-9392535 TGATATGGAGAAAGTTTGAGTGG - Intronic
1154019013 18:10646060-10646082 TGATAGGGTGATTTTTTGTCAGG + Intergenic
1154185200 18:12177163-12177185 TGATAGGGTGATTTTTTGTCAGG - Intergenic
1154304651 18:13221542-13221564 TTTTAGGGACATTTTTTGGGGGG + Intronic
1154471038 18:14701759-14701781 TGATACGGAGAAATTTTGAGTGG + Intergenic
1155380529 18:25217601-25217623 AAATAAGAAGATATTTTGGGAGG + Intronic
1155406462 18:25493394-25493416 TGATATGGAGAAAGTTTGAGGGG + Intergenic
1155450790 18:25960647-25960669 TGAGAGGGAGAAACTTTGGGGGG - Intergenic
1155511919 18:26586716-26586738 TGATATGGAGAAAGTTTGAGTGG + Intronic
1155543936 18:26895450-26895472 TTATGCGAAGATATTTTGGGGGG + Intergenic
1155580196 18:27296380-27296402 TGATAGGGAGAAAGTTTGAGTGG - Intergenic
1155852105 18:30786730-30786752 TGATAGTGAAATTTTTTGGGGGG + Intergenic
1156686132 18:39649015-39649037 TGATAGGGAGATATGATGTGAGG + Intergenic
1158093692 18:53745921-53745943 TGATATGTTAATATTTTGGGGGG - Intergenic
1159514472 18:69439775-69439797 TGATATGGAGAAAGTTTGAGTGG - Intronic
1160103091 18:75942273-75942295 TGGTAGAGAGGTGTTTTGGGTGG - Intergenic
1160614389 18:80113369-80113391 TAATAGGGAGAAATTTTTGGTGG - Intronic
1162881388 19:13662295-13662317 TGATAAATAGATAGTTTGGGGGG + Intergenic
1163203730 19:15787303-15787325 TGATGGTGAGATCTTTAGGGAGG + Intergenic
1163499384 19:17666804-17666826 AGAGAGGGAGAGAATTTGGGAGG - Intronic
1164940176 19:32246297-32246319 TGATAAGGAGAAAGTTTGAGTGG + Intergenic
1166686612 19:44800357-44800379 TGCAATGGAGATATTTTGAGAGG - Intronic
1167501159 19:49849356-49849378 TGGGAGAGAGATTTTTTGGGGGG + Intergenic
1167790920 19:51679758-51679780 TCATTGGGAGATATTTTAGAAGG + Intergenic
926236596 2:11050137-11050159 TGGTAGGGAGAAATTGTGGGTGG - Intergenic
928553516 2:32398119-32398141 TGATAGAGAGTTACTTTGGAGGG + Intronic
929323226 2:40572166-40572188 TGATAGGGAGAAAGTTTTAGTGG + Intronic
929561022 2:42956565-42956587 TGATGGGGAGAGATTCTGTGGGG - Intergenic
929697518 2:44131794-44131816 TTGGAGGGAGATATTTTGGAGGG - Intergenic
929757799 2:44782048-44782070 TGATAGGGAGAAAGTTTGAGTGG + Intergenic
930236777 2:48896040-48896062 TAATAAGGATATATTTTGGGTGG + Intergenic
930859621 2:56057010-56057032 TGATAGGGAGAAAGCTTGAGTGG - Intergenic
930864640 2:56110571-56110593 TGGTAGGGAGAGATGTTGAGGGG - Intergenic
930921626 2:56761839-56761861 TGGTAGGGGGATATTTTGCAAGG + Intergenic
931264795 2:60651132-60651154 TGCTAGAGAGATCTTTTGGTAGG + Intergenic
932951002 2:76293324-76293346 TGATAGGGAGAAAGTTTTAGTGG - Intergenic
933417103 2:82000336-82000358 TGATAGGTAGATGTGTAGGGTGG + Intergenic
934061676 2:88300141-88300163 TGATAGGGAGAGAGTTTGAGTGG + Intergenic
934941083 2:98502527-98502549 TGACAGGGAGACACTTTGTGAGG + Intronic
936663411 2:114567387-114567409 AGATAGGGAGTTATTCTGGTGGG + Intronic
937008495 2:118540283-118540305 AGACAAGGACATATTTTGGGGGG + Intergenic
937030383 2:118734129-118734151 TAATAGGGAGATCGTCTGGGTGG - Intergenic
938960651 2:136337722-136337744 TGATATGGAGAAAGTTTGAGTGG + Intergenic
939486545 2:142819592-142819614 TGATATGGAGAAATTTTTAGCGG - Intergenic
941077502 2:161022581-161022603 TGATACGGAGAAAGTTTGAGTGG + Intergenic
942177855 2:173352050-173352072 TGATAGGGAGAAAATTTAAGTGG - Intergenic
944132899 2:196366004-196366026 TGGTAGGTAGTTATTGTGGGGGG - Intronic
946747120 2:222857183-222857205 TGATATGGAGATACTTTTAGTGG + Intergenic
947050394 2:226036243-226036265 TGATATGGAGAAAGTTTGAGTGG + Intergenic
947786337 2:232824426-232824448 TGATATGGAGATAGTTTTAGTGG + Intronic
948658446 2:239491594-239491616 TGATGGGCAGAGAGTTTGGGAGG + Intergenic
948955073 2:241283109-241283131 TGATAAGGAGAAAGTTTGAGTGG + Intronic
1169159759 20:3367303-3367325 TGATACGGAGAAACTTTGAGTGG - Intronic
1169257460 20:4110116-4110138 TGGCAGGGAGATATTTAGGCTGG - Intergenic
1169518440 20:6344383-6344405 TGATATGGAGAAAGTTTGAGTGG - Intergenic
1169535155 20:6530958-6530980 TGATATGGAGAAAGTTTGAGTGG - Intergenic
1169653914 20:7900966-7900988 TGATAGGGAGAAAGTTTGAGTGG + Intronic
1169756698 20:9050470-9050492 TGATAGGGAGAAAGTTTGTGTGG - Intergenic
1170032148 20:11955037-11955059 AGATGGGGAGATTATTTGGGTGG + Intergenic
1170642733 20:18169907-18169929 TGATATGGAGAAAGTTTGAGTGG + Intronic
1170904531 20:20501571-20501593 TGATATGGAGAAAGTTTTGGTGG - Intronic
1171104032 20:22415121-22415143 TGATAGGTAGATTTTTCTGGTGG - Intergenic
1171323783 20:24272265-24272287 TGATATGGAGAAAGTTTGAGTGG - Intergenic
1172660929 20:36568244-36568266 TGATATGGAGAAAATTTGAGTGG - Intergenic
1172922836 20:38500823-38500845 TGATATGGAGAAAGTTTGAGTGG + Intronic
1173761164 20:45561915-45561937 AGTTAGGGAAATAATTTGGGGGG + Intronic
1176803446 21:13456175-13456197 TGATATGGAGAAACTTTGAGTGG - Intergenic
1177391351 21:20477215-20477237 TGATATGGAGAAAGTTTGAGTGG + Intergenic
1177699753 21:24622590-24622612 TGATACGGAGAAAGTTTGAGGGG + Intergenic
1180113357 21:45677260-45677282 TGATATGGAGAAAGTTTGAGTGG + Intronic
1183004159 22:34886553-34886575 TGACAGGGAGAAATTCTTGGTGG + Intergenic
1183268022 22:36842074-36842096 TGATATGGAGAAAGTTTGAGTGG + Intergenic
1183612519 22:38919698-38919720 TGATATGGAGAAAGTTTGAGGGG - Intergenic
1185096972 22:48814322-48814344 TGATATGGAGAAAGTTTGAGTGG + Intronic
950957958 3:17074921-17074943 TGATATGGAGAAAGTTTGAGTGG - Intronic
950976283 3:17249132-17249154 TGATATGGAGAAAGTTTGAGTGG - Intronic
951412806 3:22385834-22385856 GATTAGGGAGATATTTTGAGAGG - Intergenic
951639735 3:24823304-24823326 TTTTGGGGGGATATTTTGGGGGG + Intergenic
953037480 3:39225632-39225654 TGAGAAGGAGATGTTTTGGGTGG + Intergenic
953121698 3:40049849-40049871 TGATGGGGAGAAAGTTTGTGAGG + Intronic
954340539 3:49950036-49950058 TCAAATCGAGATATTTTGGGGGG + Intronic
954696289 3:52428975-52428997 TAATTGGGAGATATTTTTGGTGG - Intergenic
955164495 3:56497588-56497610 TGATATGGAGAGAGTTTGAGTGG - Intergenic
955426604 3:58797334-58797356 TGATATGGAGAAAGTTTGAGTGG + Intronic
955517024 3:59736103-59736125 TGATAGATAGATTTTTTGAGAGG + Intergenic
955543420 3:60001946-60001968 TGATAAGAAAATATTTTGTGGGG + Intronic
956039327 3:65129743-65129765 AGATAGGAAGATATCTGGGGGGG + Intergenic
956725980 3:72156794-72156816 TGATGGGGATATATGTTGGTTGG + Intergenic
957461266 3:80523692-80523714 TAGGATGGAGATATTTTGGGGGG + Intergenic
957536771 3:81515794-81515816 TGATAGGAAGAAGTTTTTGGTGG + Intronic
957676301 3:83370694-83370716 TTATATGTATATATTTTGGGGGG - Intergenic
957880565 3:86206645-86206667 TGATAAGGAGAGAGTTTGTGTGG - Intergenic
958933105 3:100228800-100228822 TGATAGGGAGAAAGTTTTAGTGG + Intergenic
958971979 3:100621450-100621472 TGATATGGAGAAAATTTGAGTGG + Intronic
959390355 3:105764849-105764871 TGATATGGAGAAAGTTTTGGTGG + Intronic
959452257 3:106518029-106518051 TGTTAGTGAGGTATTTTTGGTGG - Intergenic
959518452 3:107298105-107298127 GGACAGGGACATATTTTGAGGGG - Intergenic
959579213 3:107967061-107967083 GAATAGGGGGATATTTTGGAGGG + Intergenic
960229965 3:115214310-115214332 TGATATGGAGAAAGTTTGAGTGG + Intergenic
960501781 3:118446607-118446629 TTATTGGGAGAGATTTTGAGAGG - Intergenic
961140194 3:124549634-124549656 TGAGAAGGACATATTTTGGATGG - Intronic
962033508 3:131626414-131626436 TGATAGGGAGAAAGTTTTAGTGG + Intronic
962157404 3:132962633-132962655 TGATAGGGAGAAAGTTTTAGTGG - Intergenic
962420475 3:135224757-135224779 TGAAAAGAAGATATTTTGGATGG + Intronic
963314148 3:143741272-143741294 TAATGGGGTGATTTTTTGGGGGG - Intronic
964324497 3:155531918-155531940 TGATAGAGAGAAAGTTTGAGTGG - Intronic
964469152 3:157033420-157033442 TGATATGGAGAAAGTTTGAGTGG + Intronic
964596935 3:158443596-158443618 TGATAGGGACAAAGTTTGAGTGG - Intronic
968539663 4:1158798-1158820 TGATATGGAGAAAGTTTGAGTGG - Intergenic
968766287 4:2471703-2471725 TGATAGGGAGAAAGTTTTAGTGG + Intronic
969152724 4:5183973-5183995 TGATACGGAGAAAGTTTGAGTGG - Intronic
970629761 4:17927337-17927359 TGATAGGGAGAAAGTTTGAGTGG - Intronic
971098747 4:23438467-23438489 TCATAGGAAGATATTTTGCAAGG - Intergenic
971537877 4:27777299-27777321 TGATATGGAGAAAGTTTTGGTGG + Intergenic
972776246 4:42243721-42243743 TGATACGGAGAAAGTTTGAGTGG + Intergenic
972920413 4:43933510-43933532 CGATAGAAAGATATTTTGGAAGG - Intergenic
973610824 4:52634719-52634741 AGAAAGGGAGATGTTTTGGCTGG - Intronic
973901223 4:55474201-55474223 TGATATGGAGAAAGTTTGAGTGG + Intronic
974028726 4:56756875-56756897 TGATGTGGATATCTTTTGGGGGG + Intergenic
974258383 4:59491815-59491837 TAATATGGTAATATTTTGGGTGG + Intergenic
974791709 4:66699087-66699109 TGATATGGAGAAAGTTTGAGTGG - Intergenic
977072014 4:92403199-92403221 TGATATGAAGAAAGTTTGGGTGG - Intronic
977978009 4:103289313-103289335 AGTTATGAAGATATTTTGGGTGG + Intergenic
978998411 4:115184767-115184789 TGAAATGGAGAGATTATGGGAGG + Intergenic
979314005 4:119238034-119238056 TGATAGTGAGAAAATTTGAGTGG - Intronic
979448857 4:120844934-120844956 TGATATGGAGAAAGTTTGAGTGG + Intronic
979625967 4:122845788-122845810 TGATATGGAGAAAGTTTGAGTGG - Intronic
979759470 4:124383231-124383253 TGATATGGAGAAAGTTTGAGTGG - Intergenic
979872287 4:125838673-125838695 TAAAAGGGAGATATTTAGGCTGG - Intergenic
980028477 4:127795552-127795574 GGATAGGTGGATAATTTGGGAGG + Intronic
980065436 4:128182859-128182881 TGATAGGGATAGAGTTTGAGTGG + Intronic
980424512 4:132608824-132608846 TGAAAGGAAGATACTTTGGGCGG + Intergenic
980717793 4:136650754-136650776 AGATAGGGAGATTATTTCGGTGG + Intergenic
981077025 4:140602393-140602415 TGAAAAGCAGATATTTTGGCTGG - Intergenic
981119584 4:141034403-141034425 TGATATGGAGAAAGTTTGAGTGG - Intronic
981458935 4:144989823-144989845 TGATACGGAGAAAGTTTGAGTGG + Intronic
981683470 4:147426850-147426872 TGATACGGAGAAAGTTTGAGTGG + Intergenic
981899008 4:149839907-149839929 TGATATGGAGAAAGTTTGAGTGG - Intergenic
982300452 4:153873369-153873391 TGATATGGAGAAAGTTTGAGTGG + Intergenic
983333117 4:166357018-166357040 TGATATGGAGAAAGTTTGAGAGG - Intergenic
984714353 4:182912927-182912949 TGATATGGAGGAATTCTGGGGGG - Intronic
984725705 4:183018485-183018507 AGATGGGCAGATAATTTGGGGGG + Intergenic
985311082 4:188600128-188600150 TGATATGGAGAAAGTTTGAGTGG - Intergenic
985369395 4:189269335-189269357 TGATATGGAGAAAGTTTGAGTGG + Intergenic
985565211 5:612105-612127 TGACAGGGAGCTATCTGGGGCGG + Intergenic
986752838 5:10805033-10805055 TGATATGGAGAAAGTTTGAGTGG + Intergenic
986776474 5:11018613-11018635 TGATATGGAGAAAGTTTGAGTGG + Intronic
987124515 5:14799087-14799109 TGATACGGAGAAAGTTTGAGTGG + Intronic
987427569 5:17791035-17791057 TGATAGGCAGAGTTTTGGGGAGG + Intergenic
987445458 5:18012875-18012897 TGATATGGATATATTTAGGTTGG + Intergenic
987762416 5:22182624-22182646 AAATAGGGAAATATTTTAGGAGG + Intronic
987768788 5:22272383-22272405 TGATAGGGAGGAAGTTTGAGTGG - Intronic
987791253 5:22571136-22571158 TGATATGGAGAAAGTTTGAGTGG - Intronic
988395645 5:30694934-30694956 TGATAGGAAGAAATTTTAGTAGG - Intergenic
989001058 5:36761194-36761216 TGATATGGAGAAAGTTTGAGTGG - Intergenic
989363535 5:40630375-40630397 GGAGAGGGAGGTTTTTTGGGAGG + Intergenic
989532735 5:42526216-42526238 TGATATGGAGAAAGTTTGAGTGG + Intronic
990003004 5:50916928-50916950 TGATATGGAGAAAGTTTGAGTGG - Intergenic
990251389 5:53919084-53919106 TGATAGGGAGGTGTTATGAGGGG - Intronic
990887516 5:60611624-60611646 TGATAGGGAGAAAGTTTGAGTGG + Intronic
991897204 5:71416080-71416102 AAATAGGGAAATATTTTTGGAGG + Intergenic
992127911 5:73661375-73661397 TGATACGGAGAAAGTTTGAGTGG - Intronic
992426618 5:76663964-76663986 TGATATGGAGAAAGTTTGAGTGG - Intronic
992543940 5:77792061-77792083 TGAAAGGGAGATATGTAGGTAGG + Intronic
992789282 5:80199011-80199033 ACAGAGGGAGATATTTTGGGAGG - Intronic
992872399 5:81020293-81020315 TGATAAAAAGATATATTGGGAGG + Intronic
992942185 5:81773364-81773386 TGGGAGGGAGGTATTTTGGCAGG - Intergenic
995214365 5:109578087-109578109 TGATATGGAGAAAGTTTGAGTGG - Intergenic
996045778 5:118872205-118872227 TGATAGGGAGAAAATTTGAGTGG - Intronic
996110251 5:119557028-119557050 AGCTAGTGTGATATTTTGGGGGG - Intronic
996482913 5:123995732-123995754 TGATATGGAGAAAATTTGAGTGG - Intergenic
996973367 5:129399658-129399680 TGTTAGATGGATATTTTGGGTGG + Intergenic
997162946 5:131628316-131628338 TGATATGGAGAAAGTTTGAGTGG + Intronic
998510331 5:142708037-142708059 TGATATGGAGAAAGTTTGAGTGG + Intergenic
999042904 5:148435268-148435290 TGATATGGAGAAAGTTTGAGTGG - Intronic
999712576 5:154331802-154331824 GGACAGGGACATATTTTAGGCGG - Intronic
999880041 5:155852185-155852207 TGATAGGGTTATTTTTTAGGTGG - Intergenic
999884545 5:155906563-155906585 TGATAGGGAGAAAGTCTGAGTGG + Intronic
1000080940 5:157846334-157846356 TGATATGGAGAAAGTTTGAGTGG + Intronic
1000492629 5:161933669-161933691 TGATATGGAGAAATTTTGAATGG + Intergenic
1001655903 5:173349515-173349537 TGATATGGAGAAAGTTTGAGTGG + Intergenic
1003008080 6:2400255-2400277 TGATAGGGAGAAAGTTTGAGTGG + Intergenic
1003598736 6:7499062-7499084 TGATATGGAGAAAGTTTGAGTGG - Intergenic
1003659999 6:8051249-8051271 TGATAGGGAGAAAGTTTGAGTGG + Intronic
1003662688 6:8077714-8077736 TGGTAGGGAGAAAGTTTGAGTGG - Intronic
1004099704 6:12596474-12596496 TGATAGGGAGAGATTTTTGTAGG - Intergenic
1004569289 6:16829804-16829826 TGATATGGAGAAAGTTTGAGTGG - Intergenic
1004926655 6:20422378-20422400 TGATATGGAGAAAGTTTGAGTGG - Intronic
1005689916 6:28294121-28294143 TGATATGGAGAAAGTTTGAGTGG + Intronic
1006146241 6:31961465-31961487 AGAAAGGGACATCTTTTGGGAGG + Intronic
1006589394 6:35142859-35142881 ACATAGGGAGATATTTAGGCTGG + Intronic
1007017743 6:38486233-38486255 TGATATGGAGAAAGTTTGAGTGG - Intronic
1007240269 6:40419811-40419833 TGAGAGGAACATATTCTGGGGGG - Intronic
1007379654 6:41479918-41479940 TGATACGGAGAAAGTTTGAGTGG + Intergenic
1007903746 6:45437985-45438007 TGATAGGTAGCTACTTGGGGAGG - Exonic
1008268881 6:49465808-49465830 TGATAGGGAGAAAGTTTGAGTGG - Intronic
1008395495 6:51001986-51002008 TCATCGGGAGACATTATGGGTGG - Intergenic
1008465972 6:51831079-51831101 TGATAGGCAGCTTCTTTGGGAGG - Intronic
1008693833 6:54010809-54010831 TTATAAAGAAATATTTTGGGGGG + Intronic
1009941257 6:70290990-70291012 TGATATGGACATATTCTGAGAGG - Intronic
1011093035 6:83628269-83628291 TGATAGGTAGGCATTTTGGTTGG + Intronic
1011378861 6:86720808-86720830 TAATAGTGAGATCTTTTTGGTGG + Intergenic
1011644797 6:89447328-89447350 TGATATGGAGAAAGTTTGAGTGG + Intronic
1011856493 6:91699336-91699358 TGATATGGAGAAAGTTTGAGTGG - Intergenic
1012522507 6:100137724-100137746 TGAGAGGCAGAGATTTTGGATGG + Intergenic
1012825662 6:104143699-104143721 TTATTGCCAGATATTTTGGGGGG + Intergenic
1012918508 6:105196855-105196877 TGATATGGAGAAAGTTTGAGTGG + Intergenic
1012930957 6:105315976-105315998 TGATATGGAGAAAGTTTGAGTGG - Intronic
1012965045 6:105664929-105664951 TGATATGGAGAAAGTTTGAGTGG - Intergenic
1013277338 6:108598369-108598391 TGATAGGGACATTTGTAGGGTGG + Intronic
1013876399 6:114835195-114835217 TGAAATTGAGGTATTTTGGGGGG + Intergenic
1014144133 6:117977849-117977871 TGATAGGGAAAGATTTTCAGAGG + Intronic
1014478057 6:121899537-121899559 TGATACGGAGAAAATTTGAGTGG + Intergenic
1014742418 6:125161322-125161344 TGATAGGGAGAAAGTTTGAGTGG - Intronic
1014988155 6:128037464-128037486 TGATAGGCAGATGTTCTAGGAGG - Intronic
1015111406 6:129596035-129596057 AAATAGGGAGATCATTTGGGAGG - Intronic
1015156631 6:130103606-130103628 AGATAGGCAGTTATTTGGGGAGG + Intronic
1017183996 6:151582495-151582517 TGATATGGAGAAAGTTTGAGTGG - Intronic
1017355206 6:153497049-153497071 TGATATGGAGAAAGTTTGAGTGG + Intergenic
1017547834 6:155470454-155470476 TCATAGGCATATCTTTTGGGGGG + Intergenic
1019308091 7:345805-345827 TGAAAGGCTGATATTTTGTGGGG + Intergenic
1020523307 7:9223096-9223118 TGATATGGAGAAACTTTGAGTGG + Intergenic
1020548990 7:9573924-9573946 TGATAGGGAGAAAGTGTGAGTGG - Intergenic
1020843898 7:13258229-13258251 TGGTATGGGGACATTTTGGGCGG + Intergenic
1020950619 7:14671308-14671330 TGAAAGGTAGACATTTTGGAAGG + Intronic
1021221738 7:17982296-17982318 TGATAAGGAGAAAGTTTGAGTGG - Intergenic
1021285350 7:18774724-18774746 TGATATGGAGAAAGTTTGAGTGG - Intronic
1021403742 7:20239783-20239805 TGATATGTGTATATTTTGGGAGG + Intergenic
1021934080 7:25613017-25613039 TGATAGGGAGAATGTTTGAGTGG - Intergenic
1022063328 7:26823474-26823496 TGATATGGAGAAACTTTGAGTGG + Intronic
1022145006 7:27528492-27528514 TGATAGGGAGTAAGTTTGAGTGG + Intronic
1023773212 7:43578948-43578970 TGATATGGAGAAAGTTTGAGTGG - Intergenic
1024441761 7:49427763-49427785 GGAAAGAGAGATATTTTAGGAGG - Intergenic
1024449816 7:49526386-49526408 TTAATGGGAGATATTTAGGGTGG + Intergenic
1024571636 7:50727975-50727997 TGTTATGGAGATATTTTGTGAGG - Intronic
1024786121 7:52910225-52910247 TGAGATGGAGATAGTTTGAGTGG - Intergenic
1025195939 7:56933561-56933583 TGATAGGGAGAAAGTTTCGATGG + Intergenic
1025676009 7:63643375-63643397 TGATAGGGAGAAAGTTTCGATGG - Intergenic
1025900229 7:65738372-65738394 TGATAGGGAGACATAGTGGGGGG + Intergenic
1027623116 7:80517313-80517335 TGATATGGAGAAAGTTTGAGTGG - Intronic
1028728870 7:94121941-94121963 GGATAGGGAGAAATTCTAGGAGG - Intergenic
1029959990 7:104680499-104680521 TGATAGGGAGATATTTTGGGCGG - Intronic
1031107919 7:117568399-117568421 TGGCAGGGAGATAATTTAGGAGG + Intronic
1031725949 7:125239104-125239126 TGATATGGAGAAAGTTTGAGTGG + Intergenic
1031937085 7:127746631-127746653 TCATTGGGAGATATTTTGATTGG + Intronic
1032701677 7:134385813-134385835 TGAGAGGGAGAAAGTTTGAGTGG + Intergenic
1032983453 7:137311335-137311357 TGATATGGAGAAAGTTTGAGTGG - Intronic
1033468734 7:141623442-141623464 TGATAGGGAGAAAGTTTTTGTGG + Intronic
1034210838 7:149360751-149360773 TGATATGGAGAAAGTTTGAGTGG + Intergenic
1036984290 8:13509701-13509723 TGATAGGGAAGAATTTTGGCAGG + Intronic
1037377100 8:18242601-18242623 TAATCGGTAGATATTTTTGGAGG - Intergenic
1038125769 8:24671309-24671331 TGATAGGGAAGTAGTTTGTGAGG + Intergenic
1039041543 8:33413221-33413243 TGAGAGGGAGAGTCTTTGGGAGG + Intronic
1039544958 8:38403207-38403229 AGATAGGGAGATTCTTTGGATGG - Intronic
1039983881 8:42431279-42431301 TGATATGGAGACAGTTTGAGTGG + Intronic
1040076051 8:43232098-43232120 TGATATGGAGAAATTTTGAGTGG - Intergenic
1041382515 8:57265515-57265537 TGAGAGGGAGAACTTTTGAGAGG - Intergenic
1042504967 8:69550068-69550090 TAATGGGGAGAAATTTTGGGGGG - Intronic
1042668677 8:71235414-71235436 TGGTAGGAAGTCATTTTGGGAGG - Intronic
1043280058 8:78452691-78452713 TGAGAGTCAGATATTTTGGCTGG - Intergenic
1043301373 8:78738218-78738240 TACTAGGGTGATATATTGGGTGG - Intronic
1044089762 8:87984666-87984688 TGATATGGAGAGAGTTTGAGTGG - Intergenic
1044807762 8:96025807-96025829 TGATATGGAGAAAGTTTGAGTGG + Intergenic
1045073144 8:98531992-98532014 TGATATGGAGAAAGTTTGAGTGG - Intronic
1045092339 8:98759017-98759039 TGATATGGAGACAGTTTGAGTGG - Intronic
1045129512 8:99133400-99133422 TGATATGGAGGAATTTTGAGTGG - Intronic
1045490995 8:102669300-102669322 TGCTAGGGACATATTGTAGGTGG - Intergenic
1047616098 8:126563747-126563769 TGATAGGGAGATTTTGTAAGAGG - Intergenic
1050298687 9:4234103-4234125 TGATACGGAGAAAGTTTGAGTGG - Intronic
1051201509 9:14631435-14631457 TGATATGGAGAAATTTTTGGTGG - Intronic
1051637015 9:19190012-19190034 TGAAAGTGACATATTTGGGGTGG - Intergenic
1051777770 9:20655159-20655181 TGATACGGAGAAAGTTTTGGCGG - Intergenic
1051835239 9:21330049-21330071 TTATAGAGAGAAATTTTAGGTGG - Exonic
1052371331 9:27668243-27668265 TGATATGGAGAAAGTTTGAGTGG - Intergenic
1052690747 9:31813839-31813861 TGATATGGAGAAATTTTCAGTGG - Intergenic
1052713192 9:32082751-32082773 GGAATGGGAGATATTTAGGGGGG - Intergenic
1053172459 9:35899068-35899090 TGATATGGAGAAAGTTTGAGTGG - Intergenic
1053290333 9:36875547-36875569 TGATATGGACATTTTTGGGGGGG - Intronic
1053296508 9:36918337-36918359 TGATATGGAGAAAGTTTGAGGGG + Intronic
1054817315 9:69487537-69487559 TGAGAGGCAGAACTTTTGGGAGG + Intronic
1054862590 9:69968901-69968923 TTTTAAGGAGATATTTTGGGGGG + Intergenic
1055402378 9:75937977-75937999 TGATAGGGAGAAAGTTTTTGTGG - Intronic
1055981884 9:82011822-82011844 TTTTAGGGAGATATATTGGTAGG + Intergenic
1058714131 9:107708258-107708280 TGATAAAGAGAAATTTTGGAAGG - Intergenic
1059075354 9:111187389-111187411 AGAAAGGGAGATACTTTGAGAGG - Intergenic
1059582023 9:115560147-115560169 TAATAGGAAGAAATTTTGAGTGG + Intergenic
1061176169 9:128998690-128998712 TGAAAGGGAGAAATAGTGGGTGG + Intronic
1061492891 9:130956088-130956110 TGAGCTGGAGATATTTAGGGGGG - Intergenic
1061776030 9:132964993-132965015 TGATATGTACATATTCTGGGAGG - Intronic
1061830799 9:133293123-133293145 GAATAGGAAGATAGTTTGGGAGG - Intergenic
1186068375 X:5790914-5790936 TGATAGGGACATATCTTTTGGGG - Intergenic
1186141770 X:6582021-6582043 AGATAGGCAGATATGATGGGTGG - Intergenic
1186395322 X:9202517-9202539 TGATATGGAGAAAGTTTGAGTGG + Intergenic
1186624947 X:11283484-11283506 GGATGTGGACATATTTTGGGGGG - Intronic
1186706792 X:12148319-12148341 TGATATGGAGAAAGTTTGAGTGG + Intronic
1187026685 X:15442668-15442690 TGATATGGAGAAAGTTTGAGTGG + Intronic
1187107199 X:16255747-16255769 AGATAGATAGATATATTGGGGGG + Intergenic
1187474419 X:19598193-19598215 TGATATGGAGAAAGTTTGAGTGG - Intronic
1187516641 X:19977418-19977440 TGATATGGAGAAAGTTTGAGTGG + Intergenic
1187662903 X:21570501-21570523 TGATAGGGAGAAAGTTTGAGTGG - Intronic
1187800432 X:23056359-23056381 TGATATGGAGAAAGTTTGAGTGG + Intergenic
1188231107 X:27664277-27664299 TGATATGGAGATAGTTTGAGTGG + Intronic
1188899430 X:35711582-35711604 TGATAGACACATATTTTTGGAGG + Intergenic
1188907915 X:35810128-35810150 TAATAAGGTGATATTTTGGCCGG - Intergenic
1189356146 X:40311124-40311146 TGCTGGAGAGAAATTTTGGGCGG + Intergenic
1189571477 X:42302512-42302534 TGGGAGGGAGATATCTTGGAAGG - Intergenic
1189686518 X:43569735-43569757 TAATTGGCACATATTTTGGGGGG - Intergenic
1189923112 X:45923027-45923049 TGATATGGAGAAAGTTTGAGTGG + Intergenic
1189965002 X:46363348-46363370 TGATATGGAGAAAGTTTAGGTGG - Intergenic
1190141899 X:47854323-47854345 TGATATGGAGAAAGTTTGAGTGG - Intronic
1190706765 X:53035339-53035361 TGATAGGGAAAGACTGTGGGAGG + Intergenic
1190715664 X:53101094-53101116 GGATATGGAGAAAGTTTGGGTGG - Intergenic
1191904013 X:66068378-66068400 AGATAGGGAGAGATTTTGTAAGG - Intergenic
1191944360 X:66515241-66515263 CAATAGGGAGGTATTTGGGGTGG + Intergenic
1191944632 X:66518708-66518730 TAATAGGGAGGTATTTGGGTTGG - Intergenic
1192551621 X:72059173-72059195 TGATATGGAGATAGAATGGGTGG - Intergenic
1194548710 X:95270503-95270525 TGATATGCAGTTTTTTTGGGGGG + Intergenic
1194555227 X:95350092-95350114 TGATAGTCAGTTTTTTTGGGGGG - Intergenic
1197129321 X:122986438-122986460 TGATAGGGAGAAAGTTTTAGTGG - Intergenic
1198119416 X:133577590-133577612 TAAAAGGGAGATAGTTTGAGGGG - Intronic
1199066530 X:143425501-143425523 TGAAAGAGAGACCTTTTGGGAGG + Intergenic
1199103045 X:143828290-143828312 TGATGGGGAGAAAGTTTGAGTGG + Intergenic
1199145082 X:144355925-144355947 TGATATGGAGAAAGTTTGAGTGG - Intergenic
1199272250 X:145898285-145898307 TGACAGGGAGATGTCATGGGGGG + Intergenic
1201735821 Y:17260457-17260479 TGATAGGTAGATAGGATGGGTGG + Intergenic