ID: 1029962709

View in Genome Browser
Species Human (GRCh38)
Location 7:104705791-104705813
Sequence CATTCCCCACTACCGGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029962706_1029962709 0 Left 1029962706 7:104705768-104705790 CCTCTTGGGGAACAGGTGGCAGT 0: 1
1: 0
2: 0
3: 13
4: 198
Right 1029962709 7:104705791-104705813 CATTCCCCACTACCGGAACTGGG No data
1029962700_1029962709 21 Left 1029962700 7:104705747-104705769 CCACACTGAGGCAGACAGAGGCC 0: 1
1: 0
2: 2
3: 23
4: 289
Right 1029962709 7:104705791-104705813 CATTCCCCACTACCGGAACTGGG No data
1029962697_1029962709 23 Left 1029962697 7:104705745-104705767 CCCCACACTGAGGCAGACAGAGG 0: 1
1: 0
2: 5
3: 27
4: 472
Right 1029962709 7:104705791-104705813 CATTCCCCACTACCGGAACTGGG No data
1029962699_1029962709 22 Left 1029962699 7:104705746-104705768 CCCACACTGAGGCAGACAGAGGC 0: 1
1: 0
2: 1
3: 84
4: 1814
Right 1029962709 7:104705791-104705813 CATTCCCCACTACCGGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029962709 Original CRISPR CATTCCCCACTACCGGAACT GGG Intronic
No off target data available for this crispr