ID: 1029964161

View in Genome Browser
Species Human (GRCh38)
Location 7:104721301-104721323
Sequence CACCGCATGCTCTCCCTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029964158_1029964161 18 Left 1029964158 7:104721260-104721282 CCATCATTCTCAGCAAACTATCA 0: 3456
1: 11192
2: 10129
3: 4750
4: 3607
Right 1029964161 7:104721301-104721323 CACCGCATGCTCTCCCTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029964161 Original CRISPR CACCGCATGCTCTCCCTCAT AGG Intronic