ID: 1029966397

View in Genome Browser
Species Human (GRCh38)
Location 7:104745245-104745267
Sequence AGGAAGAAGGAGAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7889
Summary {0: 2, 1: 10, 2: 168, 3: 1248, 4: 6461}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029966397_1029966402 2 Left 1029966397 7:104745245-104745267 CCTTCCTCTTTCTCCTTCTTCCT 0: 2
1: 10
2: 168
3: 1248
4: 6461
Right 1029966402 7:104745270-104745292 AGGAACATAAAAGAGATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029966397 Original CRISPR AGGAAGAAGGAGAAAGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr