ID: 1029969603

View in Genome Browser
Species Human (GRCh38)
Location 7:104776447-104776469
Sequence AAGGAGAAGCTGGCTGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 815
Summary {0: 1, 1: 0, 2: 2, 3: 57, 4: 755}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029969603_1029969609 -10 Left 1029969603 7:104776447-104776469 CCCCCCACAGCCAGCTTCTCCTT 0: 1
1: 0
2: 2
3: 57
4: 755
Right 1029969609 7:104776460-104776482 GCTTCTCCTTCTTTTACCAGTGG 0: 1
1: 0
2: 2
3: 19
4: 205
1029969603_1029969612 20 Left 1029969603 7:104776447-104776469 CCCCCCACAGCCAGCTTCTCCTT 0: 1
1: 0
2: 2
3: 57
4: 755
Right 1029969612 7:104776490-104776512 ATCAGAATCACCTGAAGTCTTGG 0: 1
1: 0
2: 2
3: 34
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029969603 Original CRISPR AAGGAGAAGCTGGCTGTGGG GGG (reversed) Intronic
900101348 1:963421-963443 AAGGCGAAGCTGCCTGGGTGTGG + Exonic
900177708 1:1298165-1298187 AAGGTGAAGCAGGAAGTGGGTGG - Intronic
900522170 1:3111069-3111091 ATGGGGAAGCTGGAGGTGGGAGG + Intronic
901089539 1:6632250-6632272 AGGGAGAAGCTGGCTGTGGAGGG + Intronic
901271230 1:7953576-7953598 AATAAGATGCTGGCTGGGGGCGG + Intergenic
901529592 1:9844591-9844613 AAGGAGCCGCTGGCTGTGATGGG + Intergenic
901798712 1:11694785-11694807 AAGAAGAAGAAGGTTGTGGGAGG + Intronic
901852316 1:12023355-12023377 ACAAAGAAGGTGGCTGTGGGGGG - Intronic
902375670 1:16028968-16028990 AAGGAGACCATGGCTCTGGGAGG + Intronic
902444255 1:16451958-16451980 GGGGAGCAGTTGGCTGTGGGGGG + Exonic
902465858 1:16618154-16618176 AAAGAGGAGGGGGCTGTGGGGGG - Intergenic
902701945 1:18178666-18178688 AAGGAGAAGCTGGCAGGAAGGGG - Intronic
902745340 1:18470047-18470069 CAGGAGAGACAGGCTGTGGGAGG - Intergenic
902776123 1:18676175-18676197 AAGGCGAAGATGGCAGGGGGAGG - Intronic
902784087 1:18721740-18721762 GAGGAGAAGCTGGCAGTTGTCGG + Intronic
902879371 1:19360756-19360778 AAGGAGAAGCTGCCCGTAGTGGG - Intronic
903194296 1:21673345-21673367 AGGGAGTAGGTGGGTGTGGGAGG + Intergenic
903557345 1:24203291-24203313 AAGGAGATGGTGGCTGAGGCAGG - Intergenic
903885346 1:26537685-26537707 CAGGAGATGCTGGCTATGGAGGG + Intronic
904045083 1:27603892-27603914 AAGCAGACGCTGGCTTTGGGTGG + Intronic
904454869 1:30641508-30641530 AAGGAGAGGCTGGCGGGGGCGGG - Intergenic
904600206 1:31668777-31668799 AAGAAGAAGCTGGCAGGGGCTGG - Intronic
904712696 1:32442704-32442726 AAGTAGAAGGTGGCTGGGCGCGG + Intergenic
904728567 1:32569680-32569702 AAGGAAAAGCTGGCCGGGAGCGG - Intronic
905107124 1:35570622-35570644 AAGGAGAAGCAGGTTGGGGTTGG + Intergenic
905219397 1:36433978-36434000 AAGGAAAAGCTGTCAGTAGGTGG + Intronic
905331796 1:37208174-37208196 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
905375090 1:37514649-37514671 AAGCAGGAGCTGGCGGTGAGGGG - Exonic
905467504 1:38166530-38166552 AAAGAGCAGTTGGGTGTGGGAGG - Intergenic
906383496 1:45347664-45347686 AGTGAGAAGCTGGCCGTGGTGGG - Exonic
906684501 1:47754939-47754961 AATGAGCAGCTAGCTGTGGAAGG + Intergenic
907282839 1:53362273-53362295 AAGGGGAAGCAGCCTGTGTGAGG - Intergenic
907303470 1:53501980-53502002 AAGGAGAAGGCGGGTTTGGGAGG + Intergenic
907439887 1:54472632-54472654 CAGCAGAAGCTGGCTGTGGCTGG + Intergenic
908180719 1:61602510-61602532 AAAGAGAAACAGGCGGTGGGGGG + Intergenic
908353711 1:63311246-63311268 AAGAAGAAGATGGCTGGGCGTGG - Intergenic
909529365 1:76664489-76664511 ATGGGGAAGCTGAATGTGGGTGG - Intergenic
910771384 1:90835764-90835786 TAGGAGAAGGTGCCTGAGGGAGG + Intergenic
911235271 1:95405165-95405187 AAGGGGAAGCTGGCACTGGATGG - Intergenic
911668370 1:100581302-100581324 AAGGATGAGGTGGCTGTAGGTGG - Intergenic
912348310 1:108987130-108987152 CAGGAGAAGCTGGCTGCAGGAGG - Intronic
912516661 1:110220591-110220613 AAGCAGAAGCTGGCTCTCTGAGG - Intronic
912866983 1:113266590-113266612 CAGGAGAAGCTGGGCGTGGGGGG - Intergenic
913233109 1:116758275-116758297 AAGAGGAAGCTGGCTTGGGGAGG + Intronic
914771132 1:150686161-150686183 AAGGACATGCTGGCTGGGTGCGG - Intronic
914919207 1:151836338-151836360 AGGCAGCAGCTGGCAGTGGGGGG + Intergenic
915009880 1:152675680-152675702 AAGGACAAGCTGGGTGTTGCAGG - Intronic
915605581 1:156948113-156948135 GAGGAGCAGCTGGGTGTGGATGG + Intronic
915614755 1:157028874-157028896 ATGGAGAAACTGGCTGGGCGTGG + Intronic
915616460 1:157043336-157043358 CATGAGAACCTTGCTGTGGGGGG - Intronic
915674594 1:157518562-157518584 AAAGAGACTCTGGCTGGGGGAGG - Intronic
916674240 1:167053087-167053109 AAACAGAAGGAGGCTGTGGGAGG + Exonic
917383120 1:174436838-174436860 GAGGAGTACCTGGCTGTGTGAGG - Intronic
917710202 1:177677172-177677194 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
918120829 1:181538642-181538664 AAGGAGAAGGTGACTGTGTTTGG + Intronic
918162919 1:181918092-181918114 AAGGGAAAGCTTGCAGTGGGAGG - Intergenic
918826436 1:189330657-189330679 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
919929325 1:202210987-202211009 AAGCATAGGCTGGTTGTGGGGGG + Intronic
921353184 1:214258644-214258666 AAGGAAATGCTGTCTCTGGGGGG - Intergenic
922902619 1:229148404-229148426 AGGGAGCAGCTGGAGGTGGGAGG - Intergenic
922985478 1:229863051-229863073 AAGGAGATTCTGGCTGGGCGCGG - Intergenic
923318744 1:232806794-232806816 AAGGATAAGCGTTCTGTGGGGGG + Exonic
923519256 1:234723259-234723281 AAGGCCATGCTGGCTGTGGACGG - Intergenic
923642027 1:235773024-235773046 AAGAATATGCTGGCTGGGGGTGG + Intronic
923843173 1:237696666-237696688 GAGAAGAAGCAGACTGTGGGAGG - Intronic
924150308 1:241123285-241123307 AAGGAGCAGCTGGGTTGGGGAGG - Intronic
1063332933 10:5180346-5180368 AATGAGTACCTGGCTGTGTGCGG + Intergenic
1063640636 10:7827147-7827169 AAGGGGCAGCAGGCTGTGAGAGG + Intronic
1064136359 10:12754179-12754201 AAGGAGGAGCAGGCTGGGCGTGG - Intronic
1065326437 10:24554090-24554112 AAGGAGATGGTGTCTGTGGCAGG - Intergenic
1065695580 10:28376681-28376703 CAGGAGAAGGGGGCAGTGGGTGG + Intergenic
1066228898 10:33412640-33412662 AGGGAGAAACTGGCTGATGGAGG + Intergenic
1066483434 10:35820533-35820555 GAGGACATGCTGGCTGTGAGTGG + Intergenic
1066503629 10:36019495-36019517 AAAGAGAAGCTGGCTGGAAGTGG - Intergenic
1067983357 10:51113428-51113450 AGGGAGAAGATGGCTCTGGTTGG - Intronic
1068922152 10:62496028-62496050 TAGGAGAAAGTGGCGGTGGGAGG - Intronic
1069874421 10:71552979-71553001 AAGCTGAAGCTGGGAGTGGGGGG - Intronic
1069936837 10:71923343-71923365 ACGCAGACGCTGGCTGTAGGGGG + Intergenic
1070266209 10:74905686-74905708 AAGGAGAAGAGGGCTGTGATGGG + Intronic
1070292000 10:75123235-75123257 AAGGAGATGAGGGTTGTGGGTGG + Intronic
1070360947 10:75688620-75688642 AAGCAGAAGCAGGGTTTGGGAGG + Intronic
1070432652 10:76356872-76356894 ATGGAGGAGTTGGCAGTGGGTGG + Intronic
1070629195 10:78072430-78072452 AAGGAGAAGCTGGCAGTGTTGGG + Intergenic
1070743594 10:78919150-78919172 AAGGAGAGGGAGGCTCTGGGAGG - Intergenic
1071366875 10:84908743-84908765 AAGGAGAGGCTGTCTGTGTGAGG + Intergenic
1071473722 10:86006887-86006909 CAGGGGAAGCTGGCGGTGGTGGG + Intronic
1071765549 10:88660667-88660689 AAGGAGCAGATGGGAGTGGGAGG - Intergenic
1071797816 10:89025047-89025069 AAGGAGTAGCTGGATATGGCTGG - Intergenic
1072145651 10:92634271-92634293 AAGGAGAGGCTGGCTGGGCACGG - Intronic
1072671924 10:97436731-97436753 AAGGAGAATCAGGCTGGGCGTGG + Intronic
1073073249 10:100807981-100808003 AAGGAGGAGCTGGCCGAGGCGGG + Intronic
1073348756 10:102803885-102803907 AAGGAAAACCTGGCTGGGCGCGG - Intronic
1074026453 10:109640831-109640853 AAGTAGAAGCTGGCCGGGCGCGG - Intergenic
1074232724 10:111553847-111553869 CAGGAGAAGCTGACTGAGGGAGG - Intergenic
1075680384 10:124326969-124326991 AAGGAGAAGCTCACTCTGGTCGG - Intergenic
1075714381 10:124547687-124547709 CAGGAGAAGCAGTCTGAGGGAGG + Intronic
1075734528 10:124655696-124655718 TGGGAGGAGCTGGCTGTGGCTGG - Intronic
1075794903 10:125112961-125112983 GAGCAGGAGCTGGCTGTCGGAGG - Intronic
1076075771 10:127532785-127532807 AAGTTGAAGTTGGCTGTTGGAGG + Intergenic
1076302671 10:129439955-129439977 AAGGAGAGGCTAGTTGGGGGTGG - Intergenic
1076569049 10:131420377-131420399 AGGAAGAAGCTGGCTGGCGGGGG + Intergenic
1077119591 11:900699-900721 AAGGAGGTGCTGGCTTTGGAGGG + Intronic
1077203215 11:1324502-1324524 AAGGAGAAGGAGGCAGTGGAAGG + Intergenic
1077333101 11:1991982-1992004 TAGGGGCAGCTGGGTGTGGGAGG - Intergenic
1077606214 11:3614637-3614659 AGGGAGAAGCTGGGTGAGGTGGG - Intergenic
1077726630 11:4681756-4681778 AAGGACTTGCAGGCTGTGGGAGG - Exonic
1080059288 11:27939829-27939851 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1080317903 11:30970813-30970835 ATGCAGATGCTGGCTGTGGTAGG - Intronic
1080353373 11:31411856-31411878 AAGGAGTAACTGTCTGTGGTAGG - Intronic
1080473919 11:32572142-32572164 GAGGCGAAGCTTGCAGTGGGCGG + Intergenic
1081529366 11:43947459-43947481 AAGGAGAGGCAGGCTGGGGCCGG + Intergenic
1081693777 11:45095297-45095319 AAGGAGGAGGTGGGTGTGGAGGG - Intergenic
1082115231 11:48320848-48320870 AAAGAGAAGATGGATGTGAGAGG + Intergenic
1082956571 11:58876661-58876683 GAGGAGTACCTGGCTGTGTGAGG + Intronic
1083068299 11:59948572-59948594 AAGGAGAAGGTGTAAGTGGGAGG - Intergenic
1083386999 11:62318469-62318491 AGAGAGAAGGTTGCTGTGGGTGG - Intergenic
1083737043 11:64687358-64687380 AGAGAGAAGCAGGCTGTGTGTGG - Intronic
1083902870 11:65652186-65652208 AAGGAGAGGCAGGCTGGGGATGG + Intergenic
1084081332 11:66827338-66827360 AAGGAGAAGTGGGCTGGGCGCGG - Intronic
1084160933 11:67349721-67349743 AAGGAGAAGCTTCCTGAGGAAGG - Intronic
1084314586 11:68337743-68337765 GAGGAAGATCTGGCTGTGGGTGG - Intronic
1084489955 11:69472819-69472841 AAGGAGCAGCAGGCTGTGAAAGG + Intergenic
1084712960 11:70855468-70855490 AAGGGGAAGCTGGCTAAAGGGGG - Intronic
1084799519 11:71533236-71533258 CTGGAGAAGCTGGCTATGTGTGG + Intronic
1084876733 11:72138906-72138928 ATGGAGGAGATGGCTGTGGTGGG + Intronic
1085245020 11:75094111-75094133 AAGAAAAAGCTGGCTGGGTGCGG - Intergenic
1085703429 11:78764925-78764947 AAGGAGAATGGGGGTGTGGGCGG + Intronic
1085887478 11:80537124-80537146 AAGGAGAAGCCAGCTGGGTGTGG - Intergenic
1086175353 11:83884716-83884738 GAGGAGTATCTGGCTGTGTGAGG - Intronic
1086316665 11:85602103-85602125 GAGGAGAAGCAGACTGAGGGTGG - Intronic
1086544467 11:87951769-87951791 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1088805862 11:113351509-113351531 GAGGAAAAGCTGGATATGGGTGG + Intronic
1089086716 11:115825682-115825704 AAGGAAAAGCTGGCTGGGCATGG - Intergenic
1089496663 11:118911495-118911517 ATGGAGAAGCTGGGGGTGGCGGG - Intronic
1089538111 11:119173045-119173067 AAGGAGAAGCAGGGTGAGGGAGG + Intronic
1089612317 11:119676446-119676468 AAGGAGAAGGTTGATATGGGTGG - Intronic
1090857636 11:130624121-130624143 AAGGGGTAGGTGGCTGTGGCAGG + Intergenic
1091017116 11:132061884-132061906 CAGCAGCAGCTGGCTGTGTGTGG + Intronic
1091090797 11:132769595-132769617 AAGTAGACGCTGCCTTTGGGTGG + Intronic
1202816083 11_KI270721v1_random:47160-47182 TAGGGGCAGCTGGGTGTGGGAGG - Intergenic
1091591408 12:1845070-1845092 AGGGAGAAGCAGGGTGGGGGTGG + Intronic
1091657090 12:2353725-2353747 AAGGGGAGGCTGTCTGGGGGTGG + Intronic
1091743308 12:2975267-2975289 TAGGAGAAACTGACTGGGGGCGG - Intronic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092281726 12:7102516-7102538 GAGGAGAAGCTGGATGGGAGGGG - Intronic
1092672610 12:10881179-10881201 AAGGAGAAGGGGGCTGTAGAAGG - Intronic
1092711599 12:11343661-11343683 AAGAAGAAAGTGGCTGGGGGTGG - Intergenic
1092772488 12:11909910-11909932 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1093436550 12:19141173-19141195 AAAGAGAAGCTTTCTGTTGGGGG - Intronic
1093880108 12:24394474-24394496 AAGGAGGAGCTGGCTGATGCAGG + Intergenic
1094604061 12:31935577-31935599 AAAAAAAAGCTGTCTGTGGGTGG - Intergenic
1095054014 12:37579370-37579392 AAGGATAAACCGGCGGTGGGGGG - Intergenic
1095299376 12:40564812-40564834 GAAGAGAAGCTGGTTTTGGGGGG + Intronic
1095428973 12:42111906-42111928 GAGGAGTACCTGGCTGTGTGAGG - Intronic
1095483360 12:42658740-42658762 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1095567752 12:43646410-43646432 AAGGAAACTCTGGCTGAGGGAGG - Intergenic
1095816264 12:46426299-46426321 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1095873715 12:47057480-47057502 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1095910780 12:47424499-47424521 ATGCAGATGCTGGCTGTGGTAGG - Intergenic
1096752355 12:53769139-53769161 AATCAGAAGCAGACTGTGGGGGG - Intergenic
1096926774 12:55156817-55156839 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1096962977 12:55598832-55598854 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1098066110 12:66618403-66618425 AAGTAGAAACTGGCTGGTGGGGG + Intronic
1099512399 12:83554487-83554509 GAGGAGGACCTGGCTGTGTGAGG + Intergenic
1099547197 12:83999011-83999033 TAGGAAAACCTGGCTGTGAGCGG + Intergenic
1099989584 12:89708630-89708652 AAGGAAAGGCAGGCTGCGGGAGG + Exonic
1100724689 12:97396168-97396190 AAGAATTAGCTGGGTGTGGGAGG + Intergenic
1101251305 12:102938874-102938896 AGTGAGAAGGTGGCTGTGGTGGG - Intronic
1101551469 12:105766462-105766484 AGGGAGAAGCTTCCTGTGGGAGG - Intergenic
1101641815 12:106591157-106591179 AGGGAGAGGGTGGCAGTGGGAGG + Intronic
1101992854 12:109501491-109501513 GAGGGGATGCTGGCTGTGCGTGG - Exonic
1102201318 12:111059742-111059764 AAGGAGAAGGTGGTCGTGGGGGG + Intronic
1102273561 12:111561386-111561408 CAGGAGGAGGTGGCTGAGGGAGG + Intronic
1102730639 12:115105929-115105951 AAGGTGAAGAGGGCTGTGGATGG - Intergenic
1103576812 12:121883649-121883671 AAGGAAAAGTTGGTTGTGTGGGG - Intergenic
1104045384 12:125158987-125159009 AAGGAGATGGTGGATGTGAGTGG - Intergenic
1104472618 12:129042917-129042939 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1105223850 13:18409102-18409124 GAGGAGGAGGAGGCTGTGGGAGG + Intergenic
1105252523 13:18712669-18712691 AAGGAGGAGCTGACTTTGGCAGG - Intergenic
1105298606 13:19113436-19113458 AAGGCGGCTCTGGCTGTGGGAGG - Intergenic
1105311800 13:19218938-19218960 GAGGAGAACCTGGCCGTGTGAGG + Intergenic
1105420080 13:20244034-20244056 GAGGAGAACCTGGCCGTGTGAGG - Intergenic
1106782185 13:33070259-33070281 AAGGAGAAGCCAGCCGTTGGAGG + Intergenic
1106827827 13:33542999-33543021 AAGCGGAAGCTGCCTGTAGGAGG + Intergenic
1106960805 13:34995160-34995182 AAGGAAAAACTGGCTGGGTGTGG + Intronic
1107244125 13:38272028-38272050 AAGGAGAATCTGTGTGTGGTGGG + Intergenic
1107725297 13:43293026-43293048 ATGGTGAAGGTGGCTGTGGTGGG - Intronic
1107749259 13:43546644-43546666 AAGCAGAAGCTGGGGGTGTGAGG - Intronic
1108546671 13:51502007-51502029 AATGATAAGTTGGCTGTTGGAGG + Intergenic
1109320568 13:60805247-60805269 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1109421399 13:62116547-62116569 AAGGGGAAGCTTGATATGGGAGG - Intergenic
1109863171 13:68226434-68226456 AATAAGAAGCTGGCTGGGTGAGG + Intergenic
1111491786 13:88986922-88986944 AAGGAAAAGCTAGATGTAGGAGG + Intergenic
1112486406 13:99824264-99824286 AAGGATTAGCTGGGGGTGGGTGG - Intronic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1114007998 14:18333928-18333950 GAGGAGGAGGCGGCTGTGGGAGG + Intergenic
1114051365 14:18921501-18921523 AAGGAGAAGCTGGACTTTGGAGG + Intergenic
1114111196 14:19480424-19480446 AAGGAGAAGCTGGACTTTGGAGG - Intergenic
1114183178 14:20382116-20382138 AAGGAGAGACTGGGTGTGGTGGG - Intronic
1114184649 14:20391249-20391271 CAGGAGGAGCTGACTGTGGAGGG + Intronic
1114674692 14:24432186-24432208 AAGGAGGAGATAGCTCTGGGAGG + Exonic
1115506408 14:34098092-34098114 AAGGGGTAGGTGGGTGTGGGAGG - Intronic
1117104606 14:52384931-52384953 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1117237771 14:53796881-53796903 GAGGAGGAGCTGGCTGTGAAAGG - Intergenic
1117292523 14:54347486-54347508 AAAGAAAAGCTGGCTGGGGCCGG + Intergenic
1117815558 14:59593954-59593976 AATGAGCAGCTGCCTGTGAGAGG + Intergenic
1118067089 14:62204479-62204501 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1118594182 14:67423359-67423381 ATGAAGAAGCTGGCTGTGGAGGG - Intergenic
1120202379 14:81552243-81552265 TAGGTGAAGCTGGCTGGGCGCGG + Intergenic
1121115902 14:91342556-91342578 AAGGAGAAGCCCGGGGTGGGTGG - Intronic
1121655998 14:95596114-95596136 AAGCTGAAGCTGGCTGTCAGAGG + Intergenic
1121685966 14:95835433-95835455 AAGGGGAAGTTGGGTGTGGGAGG - Intergenic
1122146790 14:99694789-99694811 GAGGAGAAATTGGCTGGGGGTGG - Intronic
1122282066 14:100629378-100629400 AAGCAGAAGCTCGCTGAGGCTGG + Intergenic
1122282804 14:100634196-100634218 GAGGAGCAGCTGCCAGTGGGCGG - Intergenic
1122540262 14:102493998-102494020 AATGAGCAACTGGCAGTGGGTGG - Intronic
1122552766 14:102558917-102558939 AAAAAGAAGCAGGCAGTGGGTGG - Intergenic
1122785768 14:104162687-104162709 GTGGAGGAGCTGGCTCTGGGTGG + Intronic
1122809080 14:104279148-104279170 CAGGAGATGCTGGCTTGGGGAGG + Intergenic
1122858698 14:104572434-104572456 AGGGACAGGCTGGCTGGGGGAGG - Intronic
1124146722 15:27134584-27134606 AAGGAGAAGCCGGGCATGGGTGG - Intronic
1124252461 15:28115869-28115891 CAGGAGGTGCTGGCTGTGGTGGG + Intronic
1124368821 15:29091788-29091810 AGGGATCAGCTGGCTGAGGGAGG + Intronic
1124880512 15:33638241-33638263 AAGGAGAGGATTTCTGTGGGTGG + Intronic
1124999009 15:34752587-34752609 AAGATCAAGCTGGCTGTGCGAGG - Exonic
1124999534 15:34755384-34755406 ATGGAGATGCTGGCTGAGGGAGG + Intergenic
1125058517 15:35391214-35391236 GAGGAGTACCTGGCTGTGCGAGG + Intronic
1125537255 15:40448807-40448829 AAGGAGATGCTGGGTGGGCGTGG - Intronic
1125844905 15:42843207-42843229 CAGGCCAAGCTGGCTATGGGAGG + Intronic
1126237424 15:46402036-46402058 GAAGAGAAGCTGGCTGGGTGCGG + Intergenic
1126849212 15:52787386-52787408 AATGAGAAGCTGGGGGTGGCAGG - Intronic
1127430899 15:58907167-58907189 GAGGTGAATCTGGCTGTGAGAGG + Intronic
1128592677 15:68915438-68915460 AAGCAGAAGCTGTCTGTGAATGG + Intronic
1129241675 15:74255773-74255795 AAGCAGAACCCAGCTGTGGGGGG - Intronic
1129254388 15:74325869-74325891 AAGGAGGAGCTGGGTTAGGGAGG - Intronic
1129323445 15:74787289-74787311 AGGGAGAGGCTGGCTTTGGGTGG + Intronic
1129452568 15:75659136-75659158 AAGAGGACGCTGGCTGTTGGGGG + Exonic
1129562740 15:76589244-76589266 AGGGAGGATCTGGCGGTGGGTGG + Intronic
1129651807 15:77496433-77496455 AAGGAGAAACTGGATGGAGGAGG - Intergenic
1130922323 15:88357826-88357848 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1131400780 15:92124045-92124067 CAGGAGGGGCTGGCAGTGGGCGG + Intronic
1131470326 15:92691044-92691066 AAAGAGAAGATGGCTGAGTGTGG - Intronic
1131640061 15:94283058-94283080 AGGCAGAAGAAGGCTGTGGGTGG + Intronic
1131852367 15:96556730-96556752 AGGCAGAGGCTGCCTGTGGGTGG - Intergenic
1132028390 15:98421404-98421426 GAGGAGACGCTGGCTGCAGGGGG - Intergenic
1132080984 15:98865432-98865454 AAGGAGGGGCTGGCTGGAGGTGG + Intronic
1132270677 15:100521325-100521347 AAGGAAGAGCTGGCTGTGCTGGG - Intronic
1132311552 15:100861439-100861461 GAGCAGAAGCTGTCTGTGGAGGG - Intergenic
1132390659 15:101436102-101436124 AAGGACATGGTGGCTTTGGGTGG - Intronic
1132409244 15:101564306-101564328 AAGGAAAGGCTGGCTGGGCGCGG - Intergenic
1132934390 16:2473559-2473581 AAGGGGAAGCTGGCGGAGGAGGG - Intronic
1133218059 16:4305423-4305445 AAGGAAAAGCTAGCTGCTGGTGG + Intergenic
1133255777 16:4514763-4514785 AGGGAGAAGCCGGATGTGGAAGG - Exonic
1134491852 16:14701594-14701616 ATGGAGAGGCTGGGTGTGTGTGG + Intergenic
1134497233 16:14740712-14740734 ATGGAGAGGCTGGGTGTGTGTGG + Intronic
1134765032 16:16750406-16750428 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1134981021 16:18608805-18608827 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1136009468 16:27353819-27353841 AAGGAGATGCTAGGTGTGAGAGG + Intronic
1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG + Intronic
1136183824 16:28573256-28573278 GAGGAGGAGCTGGAGGTGGGTGG + Intronic
1136347242 16:29684036-29684058 AAGGAGAAGAGGGTTTTGGGAGG - Intronic
1136392011 16:29971405-29971427 TAGGAGGAGCTGGCTCTGTGTGG + Exonic
1136606643 16:31338638-31338660 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1137257114 16:46785124-46785146 AGGGAGAAGCTGGGAGTTGGGGG - Intronic
1137583810 16:49651798-49651820 AAGGAGAGGCTGGCAATGGCTGG + Intronic
1137728161 16:50670732-50670754 CAGGAGGAGCTGGCTGTGGCAGG + Intronic
1137968848 16:52963599-52963621 AGGGAACAGCTGGCTTTGGGAGG - Intergenic
1138218271 16:55224816-55224838 CAGGAGAAGATGGCTGGGTGAGG + Intergenic
1141127443 16:81410880-81410902 AAGGAGTTACTGGCTGTGGCTGG - Intergenic
1141464541 16:84197096-84197118 AAGGAGGAGCCTGCTGTGGTTGG + Exonic
1141563201 16:84883994-84884016 AAAGATTAGCTGGGTGTGGGTGG - Intronic
1141592171 16:85076641-85076663 GCGGAGAGGATGGCTGTGGGAGG - Intronic
1142189790 16:88712551-88712573 AAGGTGGGGCTGTCTGTGGGGGG + Intronic
1142483938 17:234878-234900 TAGCAGCAGCTGGCTCTGGGCGG + Intronic
1142567646 17:851036-851058 ACGGAGAAGCTGTTTGTGTGTGG - Intronic
1142611285 17:1110143-1110165 CAGGGGAAGCTGGCTGGGAGTGG - Intronic
1143165035 17:4893385-4893407 AGGGAGAAGCTGGGCCTGGGTGG - Intronic
1143786393 17:9258926-9258948 CAGGACAAGCTGGCTGTGTACGG - Intronic
1144238492 17:13286147-13286169 AAAGAGAAACTGGCAGTGGCTGG - Intergenic
1144750788 17:17646959-17646981 AAGGAGAAGGGGGATGTGCGGGG + Intergenic
1145731231 17:27188298-27188320 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1146123003 17:30211276-30211298 AAGGGGAAATGGGCTGTGGGAGG - Intronic
1146266123 17:31454007-31454029 GAGCAGCAGGTGGCTGTGGGTGG - Intronic
1146315356 17:31802678-31802700 AGGGAGAAACAGGCTGTGGCTGG - Intergenic
1146643712 17:34562388-34562410 AAGGAGAAGATTGCTCTGGAGGG + Intergenic
1146717387 17:35098053-35098075 AGGATGAAGCTGGCTGTGAGGGG + Intronic
1146739998 17:35275124-35275146 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1147697383 17:42366194-42366216 GAGGAGAAGCCGGCTGGGAGAGG - Intronic
1147697936 17:42370552-42370574 AATGAGAAGATGGCTGGGCGCGG - Intronic
1147963985 17:44183564-44183586 AAGGCTGAGCTGGCTGTGGTCGG - Intergenic
1148198644 17:45733130-45733152 TGGGAGAGCCTGGCTGTGGGGGG + Intergenic
1148566656 17:48636897-48636919 AAGGAGATTCGGGCTGTGGAAGG - Intergenic
1149449374 17:56737964-56737986 TAGCAGGCGCTGGCTGTGGGAGG - Intergenic
1149664787 17:58357993-58358015 CAGGAGAAGGTGGCTCTGGCTGG + Exonic
1150140446 17:62724083-62724105 AAATAGGATCTGGCTGTGGGGGG + Intronic
1150937963 17:69658338-69658360 AAAGGAAAGCTGGCTGTGGTGGG - Intergenic
1151213601 17:72562495-72562517 AAGGGGCATCTGGCTTTGGGGGG - Intergenic
1151548453 17:74807534-74807556 AAGGAGGGGCTGGCTGTGCATGG - Intronic
1151592699 17:75056713-75056735 AAGATGAAGTTGGCTGTGTGTGG + Intronic
1151817008 17:76476312-76476334 AAGAAGAAGCTGGGGCTGGGAGG - Intronic
1151852791 17:76700977-76700999 AAGGAGTCTGTGGCTGTGGGGGG + Intronic
1152123038 17:78430361-78430383 AGGAAGAAGCTGACTGTGAGCGG - Intronic
1152283856 17:79401224-79401246 TCCGAGAAGCTGGCTGTGAGTGG - Intronic
1152309419 17:79540531-79540553 CAGGAGCACCTGGCAGTGGGAGG - Intergenic
1152540623 17:80972576-80972598 CAGGAGGAGGTGCCTGTGGGCGG + Intergenic
1152559562 17:81071186-81071208 AAGGAGAAGCTGGTGGCTGGAGG + Intronic
1153212301 18:2780402-2780424 TACCAGAAACTGGCTGTGGGTGG + Intronic
1154320604 18:13348444-13348466 GAGGAGTACCTGGCTGTGTGAGG + Intronic
1154475277 18:14748672-14748694 GAGGAGGAGGCGGCTGTGGGAGG + Intronic
1154529455 18:15330012-15330034 GAGGAGGAGGAGGCTGTGGGAGG - Intergenic
1155513490 18:26600476-26600498 AGAGTGAAGCTGGCTGGGGGGGG + Intronic
1156244783 18:35287941-35287963 AAGGTGGAGCTTGCAGTGGGTGG - Intronic
1157381950 18:47226495-47226517 AAGGAGAAGCTGGAATTGAGTGG - Intronic
1157528958 18:48406149-48406171 AAGGACCAGCTGGCTGAGGCTGG - Intronic
1158054261 18:53260575-53260597 GAGGAGTACCTGGCTGTGTGAGG + Intronic
1159977879 18:74738447-74738469 AAGGAGAAGTTGGCCGGGTGTGG + Intronic
1160034342 18:75286917-75286939 AAGGAGAAGCCGCCTGTGGCTGG + Exonic
1160308216 18:77761095-77761117 AAGGAGAAGCAGGCTGCAGCAGG - Intergenic
1160346637 18:78137646-78137668 AAGGAGAACCTAGCTATGGCCGG + Intergenic
1160520987 18:79507838-79507860 TCGGAGGAGCTGGCTGTGGAGGG + Intronic
1160533878 18:79580964-79580986 AGGGAGAAGCTGTCTGCTGGTGG - Intergenic
1160829088 19:1094611-1094633 AAGAAGAATCAGGCTGCGGGGGG + Intronic
1160968805 19:1758392-1758414 AAGAAGGAGGGGGCTGTGGGAGG - Intronic
1161204593 19:3034415-3034437 AAGGTGAAGCTGGCTGGGGCAGG - Intronic
1161511514 19:4674879-4674901 AAGGAGGTGTTGGCTGGGGGAGG + Intergenic
1161684938 19:5697989-5698011 AAGGAGCAGCTGGGTGAAGGTGG - Intronic
1162022996 19:7876455-7876477 AAGGAGGCACTGGGTGTGGGTGG - Intergenic
1162864908 19:13538351-13538373 AAGCAGAAGCTGGGAGGGGGAGG + Intronic
1162916477 19:13877062-13877084 AGGGAGGAGCAGGCTGTGGGAGG - Intronic
1163131099 19:15273489-15273511 TAGGAGATGCTGCCTGTGTGTGG + Intronic
1163250952 19:16126026-16126048 ATGAAGATGCTGGCTTTGGGAGG - Intronic
1163549151 19:17955793-17955815 AAGTAGAGGCTGTGTGTGGGGGG - Intronic
1165324722 19:35107832-35107854 AAGGAGAAAGTGGCTGTGCTAGG + Intergenic
1165421476 19:35724108-35724130 ATAGAGAAGGTGGCTGAGGGCGG + Intronic
1165788264 19:38475304-38475326 AATAAGAAGCTGGTAGTGGGAGG - Exonic
1165944489 19:39433620-39433642 ATGGAGGAGGTGGCTCTGGGAGG - Intronic
1166631354 19:44410457-44410479 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1166665959 19:44680611-44680633 AGTGAGGAGCTGGGTGTGGGGGG - Intronic
1167149249 19:47699393-47699415 AAGGAGAAGCCGGGTGAGAGGGG + Exonic
1167580230 19:50337009-50337031 GAGGACAAGCTGACTGTGAGTGG - Intronic
1167583797 19:50361655-50361677 GAGGACAAGCTGACTGTGAGTGG - Exonic
1167741406 19:51326754-51326776 GAGGTGAAGCCGTCTGTGGGGGG - Exonic
1167876178 19:52414454-52414476 AAGGAGATGGTGGCAGGGGGAGG + Intronic
1168148995 19:54435050-54435072 AAGGCGGAGCTGGCGGTGGCTGG + Intronic
1202648894 1_KI270706v1_random:163157-163179 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1202649372 1_KI270706v1_random:166431-166453 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
926143526 2:10383080-10383102 AAGGTGAATCTGGCTGGGCGCGG + Intronic
926373490 2:12204083-12204105 AATGGGAACCTGGGTGTGGGAGG + Intergenic
927239708 2:20910839-20910861 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
927598040 2:24414735-24414757 AAGGAGAGGATGGCTGGGCGAGG - Intergenic
927843978 2:26461987-26462009 AGAGGGAAGGTGGCTGTGGGTGG - Intronic
928474437 2:31611985-31612007 AAGGATAAACTGGCTGAGTGTGG + Intergenic
929052860 2:37852838-37852860 AAGTAGAAACTGCCTTTGGGCGG + Intergenic
929374414 2:41268176-41268198 AAGTAGAAGGTGGCTGTGTTGGG - Intergenic
929473520 2:42221226-42221248 AAGGACAAGCTGACTGTTGAGGG + Intronic
929669055 2:43854767-43854789 AGGGAGATCCTGGCTGTGGCTGG + Intronic
930922742 2:56777220-56777242 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
931721896 2:65072697-65072719 AGGGGGAAGCTGGCTTTGGCTGG - Exonic
931818587 2:65929559-65929581 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
932167608 2:69522511-69522533 AAGAAAAAGCTGGCTGGGTGTGG + Intronic
932461220 2:71883169-71883191 AACAGGAAGCTGGCTGGGGGTGG + Intergenic
932487501 2:72093507-72093529 AAGGAGAAGCTTGCTGGGGAAGG - Intergenic
932599044 2:73111831-73111853 ACGTAGAAGCTGGCTGCAGGGGG - Intronic
933865866 2:86516855-86516877 AAGGAGAAGGTGGAGATGGGAGG + Intronic
934487248 2:94726666-94726688 AAGGAGGAGCTGACTTTGGCAGG - Intergenic
934523343 2:95033433-95033455 AGGGAGAAGCCGGCTGGGAGTGG + Intronic
934526360 2:95054240-95054262 AAGGAGAAGCTGCCCCTGGCTGG - Intergenic
934710484 2:96511047-96511069 AAGGAGAAACTGGATGTTGGTGG + Intergenic
934922840 2:98359765-98359787 AAGGAGCAGCTGTTTGTGGGGGG - Intronic
934997500 2:98978575-98978597 GAGGAGTACCTGGCTGTGGGAGG - Intergenic
935277612 2:101488755-101488777 TAGGAGAAACTGTGTGTGGGAGG - Intergenic
935678535 2:105616986-105617008 AAGGAAAAGCTGCCTGAGGTTGG - Intergenic
937698465 2:124836386-124836408 GAGGATAAGCTGTCTGTGGCAGG - Intronic
937769952 2:125709029-125709051 AAGGAGAAGCCAGCTTTGTGAGG - Intergenic
937902112 2:127027812-127027834 ATGAAGAAGCTTGCAGTGGGGGG + Intergenic
938104552 2:128521049-128521071 AAGGAGGAGGTGGCTGTGCCAGG - Intergenic
938421102 2:131147506-131147528 TTGGAGAAGCTGGCTGGGCGCGG + Exonic
938528553 2:132161434-132161456 GAGGAGGAGGAGGCTGTGGGAGG - Intronic
938541628 2:132288041-132288063 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
938601667 2:132848666-132848688 AAGGAAAAGCCTGCTGTGCGTGG + Intronic
939582258 2:143964646-143964668 AAGGAGAAGATGGAAGTGGAGGG + Intronic
939995576 2:148916111-148916133 ATGCAGGAGCTGACTGTGGGAGG + Intronic
941610135 2:167651538-167651560 TAGAAGCAGCTGGCTGTGTGTGG - Intergenic
942819930 2:180100835-180100857 AAGGAGGAGCGGGCAGTGAGTGG - Intergenic
944414270 2:199467534-199467556 AAGGGGAAGAGGGCTGAGGGCGG + Intronic
944490006 2:200248814-200248836 AAGGAAGAGCTGGCTGGGCGTGG + Intergenic
944546595 2:200805046-200805068 AGGGAGCAGCTTGCTGTGTGTGG - Intergenic
944834959 2:203570223-203570245 AGTGAGAAGATGGCTGTGGCTGG - Intergenic
945314983 2:208361068-208361090 CAGGACAAGTTTGCTGTGGGCGG - Intronic
946026968 2:216677728-216677750 AAGGAGAGCCTGGCTGTGAAGGG + Intronic
946164796 2:217857416-217857438 AAGGTGAAGATGGCTGGGGCTGG + Intronic
946431688 2:219629810-219629832 AAAGAGGAGCAGGGTGTGGGAGG + Intronic
946873950 2:224110053-224110075 GGGGAGAAGCTGCCTTTGGGAGG + Intergenic
947054071 2:226080449-226080471 AAGGGGAAGAAGGCTGTGGCAGG + Intergenic
947481386 2:230503657-230503679 AAAGGGAAGCTTGGTGTGGGGGG - Intronic
947772489 2:232681809-232681831 ATGGAGATGCTGGCTCAGGGAGG - Exonic
948170474 2:235897730-235897752 TAGGAGAGGATGACTGTGGGGGG + Intronic
948243215 2:236455975-236455997 AAGGAGAGGCTGGCTGGTGGTGG - Intronic
948426931 2:237894453-237894475 AGGGCGAGGCTGGCTGTGGAAGG + Intronic
948632036 2:239308542-239308564 AAGCAGTATCTGGCTGTGGATGG - Intronic
948841309 2:240650805-240650827 CAGGAGCACCTGGCTGTGGCAGG - Intergenic
948889936 2:240902651-240902673 GAGGAGACGCTGGCCCTGGGGGG - Intergenic
948992245 2:241561075-241561097 CATGAGAGGCTGGCTGGGGGCGG - Intronic
1168799563 20:635462-635484 AGGGAGCAGATGGTTGTGGGGGG + Intergenic
1169016924 20:2299612-2299634 AAGGAAAATCAGGCTGAGGGAGG - Intronic
1170082542 20:12492356-12492378 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1170347325 20:15401326-15401348 AAGAACAAGCTGGCTGGGTGTGG - Intronic
1170662652 20:18358181-18358203 AAGGAGGTGATGGCTGGGGGAGG + Intergenic
1170960345 20:21020100-21020122 CTGTGGAAGCTGGCTGTGGGAGG - Intergenic
1171390076 20:24795574-24795596 CAGGGGAAGTTGGCTGTGGCTGG - Intergenic
1172111120 20:32545597-32545619 ATGGAGAAGCCTGCTGGGGGAGG - Intronic
1172386119 20:34535329-34535351 CAGGAAAAGCTGGCTGTAAGGGG - Intronic
1172663918 20:36586143-36586165 AAATAGAAGTTGCCTGTGGGAGG - Intronic
1173589072 20:44210405-44210427 AAGGGGAAGCTGCCGCTGGGCGG + Intronic
1173870864 20:46341391-46341413 AAGGAGAAGGTGGCCGTGTCAGG - Intergenic
1174246619 20:49187196-49187218 AAGAAGAAGCTGGATGATGGCGG + Intronic
1174405026 20:50297219-50297241 TAGGAGGAGCCCGCTGTGGGCGG - Intergenic
1175081802 20:56426867-56426889 GGGGAGAAGCTGGCTGGGTGCGG - Intronic
1175272757 20:57746453-57746475 AAGGAGATGCGGGCAGGGGGAGG + Intergenic
1175337670 20:58206744-58206766 AAGTAGTGGCTGGCTGGGGGAGG - Intergenic
1175432382 20:58914726-58914748 AAGGAGAATCTGCCTCTGGGAGG + Intergenic
1175670991 20:60902770-60902792 CAGGAGAAACTGGCTGTGATGGG - Intergenic
1175780399 20:61678788-61678810 AGGGAGAAGATGGCTATGGGAGG - Intronic
1175935598 20:62512546-62512568 AAGGAGCAGCAGGGGGTGGGTGG - Intergenic
1176602449 21:8806115-8806137 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1176602928 21:8809384-8809406 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1176611894 21:8991218-8991240 AGGGAGAAGCTGGCTGAGGCAGG - Intergenic
1176767943 21:13038456-13038478 GAGGAGGAGGAGGCTGTGGGAGG + Intergenic
1176838046 21:13812553-13812575 AAGGAGGAGCTGACTTTGGCAGG - Intergenic
1177639004 21:23821917-23821939 AGGGAGAAGTTGGCTGAGCGCGG - Intergenic
1178431505 21:32522211-32522233 AAGGAGCAGCAGGCTGAGTGTGG - Intergenic
1178568677 21:33713751-33713773 AAGGAGAACCTCGCTGTGATTGG + Intronic
1178605473 21:34032988-34033010 AAGGAGAAGGTAGCAGTGGAGGG - Intergenic
1178877680 21:36425323-36425345 AAGGAGCAGCTGCCTATGGTGGG + Intergenic
1179791997 21:43761240-43761262 AAGGAGAGGCTGGCATTTGGGGG - Exonic
1179941903 21:44645640-44645662 AAGAGGAAGCTGGCTGAGCGTGG - Intronic
1180071299 21:45436954-45436976 GGGGAGCAGCTGGCTGTGGCAGG + Intronic
1180077017 21:45468127-45468149 AAGGAGAAACTGAGTCTGGGAGG - Intronic
1180090730 21:45532723-45532745 ATAGAGAAGCTGGCTGGGTGTGG - Intronic
1180344734 22:11697668-11697690 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180345214 22:11700941-11700963 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180352557 22:11816662-11816684 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180352994 22:11819182-11819204 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180385698 22:12175695-12175717 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180432505 22:15264738-15264760 GAGGAGGAGGCGGCTGTGGGAGG + Intergenic
1180515077 22:16132718-16132740 GAGGAGGAGGCGGCTGTGGGAGG + Intergenic
1180698976 22:17771531-17771553 AAGGAGGAAGTGGCTTTGGGAGG - Intronic
1181009699 22:20033057-20033079 GAGGTGAAGCTGGCAGGGGGAGG + Intronic
1181797637 22:25321444-25321466 CAGGAGAGGCTGGGTGTGGCTGG - Intergenic
1181921898 22:26327096-26327118 CAGCAGAAGCTGGCAGTGGCTGG - Intronic
1182180169 22:28339263-28339285 GAGGAGTACCTGGCTGTGTGAGG + Intronic
1183264088 22:36815223-36815245 AAGGAGTCGGTAGCTGTGGGGGG + Exonic
1183310582 22:37107466-37107488 AAGAAGGGGCTGGCTTTGGGGGG - Intronic
1183356370 22:37361978-37362000 AAGGAGTAGCTGCGTGTGGGAGG - Intergenic
1183489600 22:38109434-38109456 AAGCGGGAGCTGGCTGTGAGGGG - Intronic
1183591117 22:38779833-38779855 AAGAAGAAACTGGCTGAGGCGGG + Intronic
1183966419 22:41445533-41445555 AAGCTGAAGCTTGCTGTGCGGGG + Intronic
1183978933 22:41528452-41528474 AAGGAGAAGGTGGGTGTGGGTGG - Exonic
1184141120 22:42577883-42577905 AAGGAGAAGCTGGAGCTGGCTGG - Intergenic
1184149232 22:42628851-42628873 AAGGGGAAGGTGGCTGGGGGAGG + Intronic
1184192762 22:42905939-42905961 AAGGAGTGGGTGGCGGTGGGTGG - Intronic
1184212496 22:43044110-43044132 AGGGAGAAGATGGGGGTGGGTGG - Intronic
1184505596 22:44899574-44899596 AAGAAGAGGCTGGGTGTGGTAGG - Intronic
1184531848 22:45061385-45061407 GGGGAGCAGCTGGCTGTGGGAGG - Intergenic
1185127721 22:49021167-49021189 AGAGAGCAGCGGGCTGTGGGGGG - Intergenic
949705400 3:6810860-6810882 AAGTTGAAGGTGGCTGTTGGTGG + Intronic
950014710 3:9747467-9747489 CAGGGGAAGCTGGGTGGGGGAGG + Exonic
950213568 3:11141548-11141570 AAGTTGATGCTGGCTGTTGGTGG + Intronic
950548401 3:13652585-13652607 AGGGAGGAGCAGGCTGGGGGTGG + Intergenic
950642381 3:14356719-14356741 AAGGAGAAACTGGCCGGGCGTGG + Intergenic
952181894 3:30925522-30925544 AAGGAGACGCTCACTGTGGATGG + Intergenic
952341769 3:32453059-32453081 AAGAAAAAGCTGGCTGGGTGCGG - Intronic
952696034 3:36266015-36266037 AAGGGAAAGCTGGCTGAGCGTGG - Intergenic
953121169 3:40044057-40044079 AAGCAGAAGCTGGATGAGGAAGG + Exonic
953183759 3:40619851-40619873 AAGGAGGAGGTGGGTGTGGCAGG - Intergenic
953886989 3:46719706-46719728 AGGGAGAAGCAGCCTCTGGGAGG + Exonic
954380789 3:50217992-50218014 AAGGAGTAGGTGTCTGTGGCTGG + Exonic
954384447 3:50236905-50236927 AAGGAGAAGGAGGGAGTGGGTGG - Intronic
955114318 3:55982074-55982096 AAGGAGAGGCTGGCTGGAGAGGG + Intronic
955398990 3:58577779-58577801 CAGGAGAAAATGGCTCTGGGGGG + Intronic
955403074 3:58607362-58607384 AAAGGGGAGCTGGCTGTGGTGGG + Intronic
955528311 3:59844005-59844027 AAAGAGAAGGAGGGTGTGGGAGG - Intronic
955902670 3:63774099-63774121 AAGGAGAAACTGGCCGGGTGCGG + Intergenic
956106425 3:65823531-65823553 CAGGAGAAGCAGGCTGTGGAAGG - Intronic
956209471 3:66788323-66788345 AAGGAAAAGATGGAAGTGGGTGG - Intergenic
957692995 3:83596336-83596358 AGGCAGAAGTTTGCTGTGGGTGG + Intergenic
958037570 3:88188596-88188618 CAGGAGGGGCTGGCTCTGGGAGG + Intergenic
958109437 3:89121163-89121185 TAGGCGGAGCTGGCAGTGGGAGG + Intronic
958731817 3:97968092-97968114 GAGGAGCACCTGGCAGTGGGCGG - Intronic
960718457 3:120601620-120601642 AAGCACAAGCTGCCTGTGTGGGG + Intronic
960999926 3:123367357-123367379 CAGGAGAAGCAGTTTGTGGGTGG - Intronic
961034366 3:123632163-123632185 AAGGAGAAGCTGGCTAGGCGCGG - Intronic
961830799 3:129622106-129622128 CAGGAGAGGATGGGTGTGGGTGG - Intergenic
961956100 3:130805390-130805412 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
962053697 3:131846480-131846502 AAAGGGAAGCTGGCTGTGCTGGG - Intronic
962927902 3:140012024-140012046 AAGGCAAAGCTGACTGTGGCTGG + Intronic
963235211 3:142948807-142948829 AAGGAAAAGCTGGCCGGGCGTGG - Intergenic
963450541 3:145475742-145475764 AAAGAAAAGCTGGCTGGGTGTGG + Intergenic
963833103 3:150029825-150029847 AAGGAGTAGTTGGAGGTGGGAGG + Intronic
964185723 3:153940347-153940369 AAAGAGAAGCAGGGAGTGGGTGG - Intergenic
964211846 3:154237259-154237281 AAAAAGAAGCTGGCTGGGTGTGG + Intronic
964261773 3:154847644-154847666 AAGGAAAATCTCGCTGTGGCTGG + Intergenic
964504504 3:157383990-157384012 AGGTAAAAGCTGGATGTGGGGGG + Intronic
965640740 3:170826270-170826292 AAAGCAAAGCTGGCTGTGTGAGG - Intronic
965711632 3:171561527-171561549 GAGGAGAGGCTGGATGAGGGAGG + Intergenic
967817632 3:193812855-193812877 AAGGGGAAGCTACCAGTGGGCGG + Intergenic
967852708 3:194094077-194094099 AGGGATGAGCTGACTGTGGGAGG - Intergenic
968015632 3:195329908-195329930 AAAGAGAAGCTGACTTGGGGCGG - Intronic
968517020 4:1019680-1019702 AATGAGATGGCGGCTGTGGGGGG - Intronic
968615053 4:1573949-1573971 AGGGAGGAGCTGGATGAGGGAGG - Intergenic
968706358 4:2080234-2080256 AAGGAGGAGGTGGCTGGGCGAGG + Intronic
969352992 4:6608932-6608954 AAGGCCACACTGGCTGTGGGTGG + Intronic
969606979 4:8206657-8206679 AAGGGAAAGCTGGCTTGGGGTGG + Intronic
969660867 4:8526663-8526685 CAGGAAAAGCTGAATGTGGGAGG + Intergenic
969869579 4:10096228-10096250 AGCTAGAAGCCGGCTGTGGGTGG - Intronic
970065684 4:12090742-12090764 GAGGAGTATCTGGCTGTGTGAGG - Intergenic
970866937 4:20770092-20770114 CAGAAGAAGCAGGCTGTGGGAGG - Intronic
971703720 4:30012903-30012925 ATGCAGAAGCTGGCTGTAGTAGG + Intergenic
972665560 4:41161664-41161686 AATAAGAAGTTGGCTGTGTGGGG - Intronic
973375099 4:49280976-49280998 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973375998 4:49286998-49287020 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973376923 4:49293161-49293183 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973377843 4:49299316-49299338 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973378787 4:49305596-49305618 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973379431 4:49310058-49310080 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973380304 4:49316054-49316076 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973381227 4:49322220-49322242 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973382312 4:49329265-49329287 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973385851 4:49513877-49513899 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973859006 4:55042045-55042067 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
974470268 4:62310013-62310035 AAGGGGTACCTGGCTGTGTGAGG - Intergenic
974821072 4:67067739-67067761 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
975522699 4:75317808-75317830 ATGGGGCAGCTGGCTGGGGGGGG - Intergenic
975578229 4:75884136-75884158 AAAGAAAATCTGGCTGTGTGCGG + Intronic
975656760 4:76649140-76649162 AAGGAGATGGTTGCTGGGGGTGG - Intronic
975733493 4:77359629-77359651 AAGGACAGGATGGCTGTGGGTGG - Intronic
976143753 4:82020321-82020343 GAGGAGTACCTGGCTGTGTGAGG - Intronic
976220546 4:82753722-82753744 AAGGGGAAGATGGCTGAGGGGGG - Intronic
977580929 4:98724034-98724056 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
977718794 4:100214565-100214587 CAGGAAAAGCTGGCTGTGTTAGG - Intergenic
978336315 4:107672830-107672852 GAGGAGTACCTGGCTGTGTGAGG - Intronic
979398398 4:120218001-120218023 AAGGAGGAGCTCGCAGTGAGTGG - Intergenic
979626419 4:122849969-122849991 ATGCAGAAGCTGGCTGGGCGCGG + Intronic
980231464 4:130051569-130051591 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
980862574 4:138517349-138517371 AAGCAGAAGGTAGGTGTGGGTGG - Intergenic
981241537 4:142482119-142482141 AAAGAGAACATGGCTGGGGGTGG + Intronic
982055555 4:151545665-151545687 AAGGATAAGGAGGCTGGGGGAGG - Intronic
985045524 4:185936811-185936833 GAGCAGAAGCTGAGTGTGGGAGG - Intronic
985159510 4:187029761-187029783 AAGGAGAAGGTGGTTGGTGGTGG - Intergenic
985275257 4:188232236-188232258 AAGAAGAGGCAGGGTGTGGGTGG - Intergenic
985766002 5:1779920-1779942 AAGGACAGGCTGGGTGGGGGAGG - Intergenic
985814721 5:2118133-2118155 AAGCAGAAGCTTGCATTGGGCGG - Intergenic
986590306 5:9362065-9362087 AAGAGGAAGATGGCTGTGGGTGG - Intronic
987249171 5:16080935-16080957 AAGGAAAAGGAGCCTGTGGGTGG - Intronic
987609168 5:20179898-20179920 ATGTAGGAGCTGGCTGTTGGAGG + Intronic
987610921 5:20201215-20201237 AGAGAGAAGATGGCTGTAGGAGG - Intronic
987855325 5:23413074-23413096 AAGGAGGAACTGCCTGGGGGAGG - Intergenic
987977676 5:25035742-25035764 GAGGAGATGCTGGGGGTGGGTGG - Intergenic
988530532 5:32023317-32023339 AAGGAGAGGCTGTCTGGGAGGGG - Intronic
988829990 5:34977940-34977962 AAGGAGAAGGCTGCTGGGGGTGG - Intergenic
988871652 5:35396848-35396870 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
988992705 5:36687048-36687070 AAGGACAGGATGGCTGTGTGTGG + Exonic
989275750 5:39586431-39586453 AAGGAGAGTTTGGCTGGGGGCGG + Intergenic
989305176 5:39946877-39946899 AAGGAGAAGCTGAGTTTGAGAGG - Intergenic
989508794 5:42259608-42259630 AAGGAGTACCCGGCTGTGTGAGG + Intergenic
990437536 5:55808689-55808711 GAGGAGTACCTGGCTGTGTGAGG + Intronic
992295336 5:75321813-75321835 AAAGCGAAGCTTGCTATGGGTGG + Intergenic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
992898682 5:81270577-81270599 AGGGAGAACCAGGCAGTGGGCGG - Intergenic
993500887 5:88665739-88665761 AAGCTGCAGATGGCTGTGGGTGG + Intergenic
995245210 5:109927636-109927658 AAGGAGAAGGAGACTGTTGGAGG - Intergenic
995480023 5:112584195-112584217 AAGGGCAAGCTGGCTGAGCGTGG - Intergenic
995570135 5:113471543-113471565 GAGGAGTACCTGGCTGTGTGAGG + Intronic
997112256 5:131087910-131087932 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
997387718 5:133486751-133486773 GAGCAGGAGCTGGCGGTGGGTGG + Intronic
997444124 5:133928902-133928924 AGGGAGCAGCTGGCTGAGGGAGG - Intergenic
997820971 5:137065335-137065357 AAGCAGAAGCTACCTGTTGGTGG - Intronic
998057153 5:139087927-139087949 AGTGAGCACCTGGCTGTGGGTGG - Intronic
998151359 5:139759311-139759333 AAGCAGAAGTAGGCTGTGAGTGG - Intergenic
998426538 5:142033658-142033680 AAGGGGAAACTTGGTGTGGGAGG + Intergenic
998523007 5:142817518-142817540 AAGGATAAGAGGGCTGTTGGTGG + Intronic
998604388 5:143618697-143618719 AAGGAGAAGGGGGCTGATGGTGG + Intergenic
998957728 5:147454138-147454160 GACGAGGAGCTGGCTGGGGGCGG - Intronic
999682950 5:154076766-154076788 GGGGAGAAGATGGCAGTGGGAGG - Intronic
999947184 5:156610415-156610437 AAGGAGTACCCGGCTGTGTGAGG + Intronic
1000284661 5:159816628-159816650 AAAGTGAAGGTGGCTGTGGCTGG - Intergenic
1000517634 5:162259054-162259076 AAGCAGAAGCTGGCAATGAGAGG - Intergenic
1000764637 5:165271947-165271969 AAGTGGAAGCTGGCCGTGCGCGG + Intergenic
1000940751 5:167357026-167357048 ATGGATAAGTTGGCTCTGGGAGG + Intronic
1001196503 5:169677876-169677898 AAAGGGAAGCTGGATGTGGGAGG + Intronic
1001268433 5:170292338-170292360 AAGGGGCAGATGACTGTGGGTGG + Intronic
1001437577 5:171712203-171712225 AATGAGAGGCAGGCTGAGGGTGG - Intergenic
1001571240 5:172732066-172732088 AAGGAGAAACTGCCTGTCCGGGG + Intergenic
1001579935 5:172791576-172791598 ATGAAGAAGCTGGGTGTGGGTGG - Intergenic
1002521557 5:179795574-179795596 AGGGAGAAGTAGGCTGGGGGAGG - Exonic
1002808771 6:604827-604849 AAGCAGAGGCCGGCGGTGGGCGG - Intronic
1003194873 6:3905829-3905851 AACAAGAAGCTGGATGTGGCTGG + Intergenic
1003395544 6:5749484-5749506 AAGGAGGAGCTGGCAGCAGGAGG - Intronic
1003425767 6:5997261-5997283 TTGGAGAAGGTGGCTGTGGGAGG - Intergenic
1003750204 6:9047133-9047155 AAGGAGATACTGGCTGGGTGTGG + Intergenic
1003882480 6:10491117-10491139 AGGGAGATGCTGGCTGGGTGCGG - Intergenic
1003964504 6:11240176-11240198 AAGGACAAGCTGCCTGGGGTGGG + Intronic
1004991020 6:21138879-21138901 AAGGAGAAGCTTGCTGCCGGAGG - Intronic
1006304158 6:33208755-33208777 AAGGCGAAGAAGGCTGGGGGTGG - Exonic
1006336333 6:33422757-33422779 AAGGAGAAGATGGCTTTTGTCGG - Intronic
1006677560 6:35775408-35775430 AAGCAGAAGCAGGCTGGGAGTGG + Intergenic
1007590906 6:43020533-43020555 AAGTAAGAGGTGGCTGTGGGTGG + Intronic
1007642683 6:43355236-43355258 CAGGAGAAGGTGGGTGTGGATGG + Exonic
1008085151 6:47236597-47236619 AAGCAGCAGCAGGGTGTGGGTGG - Intronic
1008118314 6:47579389-47579411 CTGGAGAAGCTGGCTGGTGGAGG + Exonic
1008448563 6:51622150-51622172 AAGCTGTAGCTGACTGTGGGTGG - Intronic
1008673815 6:53798447-53798469 AAGGAGGAGCTTGCAGTGAGTGG - Intronic
1008679443 6:53856808-53856830 AAGGACAGCCTGGATGTGGGAGG + Intronic
1008978558 6:57457160-57457182 GAGGAGTAGCTGGCTGTGTGAGG + Intronic
1010031107 6:71271268-71271290 AAGGAGTACCTGGCCGTGTGAGG - Intergenic
1010271277 6:73918274-73918296 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1010974711 6:82298844-82298866 AAGGTGAAGCTTGCAGTGAGCGG - Intergenic
1011012045 6:82713630-82713652 AAGGAGAAGCGGGCTAGTGGAGG + Intergenic
1011130402 6:84046489-84046511 AAGGAGAATTTGGCTGGGTGCGG + Intronic
1011551585 6:88535508-88535530 AAGGAGAAGTGGGTTGTGGCAGG + Intergenic
1012977872 6:105799420-105799442 AAGATGAGGCTGGCTGAGGGAGG + Intergenic
1013270994 6:108545247-108545269 GAGGAGCAGGTGGCTGTGAGTGG + Intergenic
1014157967 6:118134153-118134175 AAGGAGAAACTGCCTGTGCAGGG + Intronic
1014345795 6:120268111-120268133 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1014849810 6:126327359-126327381 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1015379652 6:132551728-132551750 AGGGGGAATCTGGCAGTGGGTGG + Intergenic
1015411211 6:132895760-132895782 AAGGAGAAACAGGCTGGGTGCGG + Intergenic
1015520039 6:134120869-134120891 GAGGCGGAGCTGGCAGTGGGTGG + Intergenic
1015535985 6:134268198-134268220 AGGGAGTAGCTGACTGTGAGTGG + Intronic
1016357976 6:143238451-143238473 AAGGAAAAGTTGGCTGGGGGAGG - Intronic
1016524886 6:144990455-144990477 GTGGAGAAGCTGGGTGTAGGAGG + Intergenic
1017653610 6:156605452-156605474 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1017809429 6:157974359-157974381 GAGGAGCAGGTGGCTGGGGGTGG - Intergenic
1018614996 6:165678693-165678715 AGGGAGATGCTGAGTGTGGGCGG - Intronic
1018891287 6:167985174-167985196 AAGAAGAAGCTGGCAGAGAGTGG + Intergenic
1019164016 6:170087340-170087362 AAGGAAAAGCATGGTGTGGGGGG + Intergenic
1019504099 7:1382008-1382030 AAGCAGAAGCTGGAAGTGGGGGG - Intergenic
1019930964 7:4222832-4222854 AAGGGCCAGCTGGCTGTGTGAGG - Intronic
1019936243 7:4260065-4260087 AAGGAGAAGCTGGCTGCTCTGGG + Intronic
1020225822 7:6279196-6279218 AACGAGAAGGTGGCGGTGGAAGG - Intergenic
1021481554 7:21123374-21123396 AAAGTGAAGATGGCTGTGGAAGG - Intergenic
1021800726 7:24304050-24304072 AAGGAGAAGCTTGGTGTTGGGGG + Intergenic
1022499059 7:30871205-30871227 ACAGAGAAGCTGGCTCTGGGGGG - Intronic
1023116564 7:36868636-36868658 AAGGAGAAGCGGGCAGGGTGTGG - Intronic
1023635226 7:42202982-42203004 AAGGAGGAGCTGACCATGGGAGG + Intronic
1023650257 7:42362010-42362032 AAGGAGAAGCTCACTGAAGGTGG - Intergenic
1023769084 7:43538248-43538270 AGGGAGAAACTGGATGAGGGAGG + Intronic
1023794191 7:43778530-43778552 GAGGAGTACCTGGCTGTGTGAGG + Intronic
1024174788 7:46827875-46827897 AGGGAGAATCTGGTGGTGGGTGG - Intergenic
1024497833 7:50068589-50068611 AAAGAGAAGCTGGCTTTGCAAGG - Intronic
1024741202 7:52356724-52356746 AAGGAAGAGGTGGCTATGGGTGG + Intergenic
1025795563 7:64736677-64736699 CAGGAGGCGCTGGCTGTGGTCGG - Intergenic
1025868395 7:65407178-65407200 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1026454588 7:70559622-70559644 GAGTAGAAGCTGGCTGGGAGTGG - Intronic
1026543383 7:71300110-71300132 AAGGAGAGGCAGGCTTTGAGAGG - Intronic
1026661688 7:72308348-72308370 AGTGAGATGCTGTCTGTGGGGGG + Intronic
1026808130 7:73440594-73440616 CAGGGGAAGCTGGCGGTGGTGGG + Exonic
1027145130 7:75688740-75688762 AATTTGAAGCTGGCTGTTGGGGG - Intronic
1027330689 7:77089911-77089933 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1027623813 7:80524398-80524420 AAGGAGAAGCTTGACATGGGAGG - Intronic
1028073992 7:86488047-86488069 AAGGAGACACTGACTGTGGTTGG - Intergenic
1029151921 7:98486322-98486344 GAGGTGAAGCTGGGTGAGGGGGG - Intergenic
1029564122 7:101323730-101323752 AAGGAGAACCGGGCTGGGCGCGG - Intergenic
1029602007 7:101571704-101571726 AAGTAGGAGCCTGCTGTGGGTGG + Intergenic
1029731495 7:102441249-102441271 AAGAAAAAGCTGGCTGGGTGTGG + Intronic
1029969603 7:104776447-104776469 AAGGAGAAGCTGGCTGTGGGGGG - Intronic
1029986423 7:104927266-104927288 GAGCAGGAGCGGGCTGTGGGCGG + Intergenic
1029997610 7:105023513-105023535 AAGGCGGAGCTTGCAGTGGGTGG - Intronic
1030065155 7:105653752-105653774 CAGGAGAAGGTGGCTGGGGCAGG - Intronic
1030165870 7:106554311-106554333 AAAGAGAAGCTGGTAGGGGGAGG + Intergenic
1030313578 7:108092007-108092029 GAGCAGAACCTGGCAGTGGGGGG - Intronic
1030324282 7:108203543-108203565 AAGGAGAAGCTGGTTCAGGGAGG - Intronic
1032006165 7:128303591-128303613 CTGGAGCAGCTGCCTGTGGGTGG - Exonic
1033961549 7:146919714-146919736 AAGGAGGATCAGGCAGTGGGCGG + Intronic
1034483515 7:151341663-151341685 AAGGCGAAGCCAGCTGTGGGCGG - Intergenic
1034523034 7:151635453-151635475 ATGGTGAAGCGGGCTGTGGTAGG + Intronic
1034847802 7:154463495-154463517 AAGGAGAAGTAGGCTGGGCGCGG - Intronic
1034907026 7:154958260-154958282 ATGGAGATGCTGACTGTGGTAGG - Intronic
1034969240 7:155408907-155408929 AAGGAGACGGTGGCTGGGGCGGG - Intergenic
1034980130 7:155470610-155470632 AAGGAGAAGATGGCTCTGCTGGG - Intergenic
1035459896 7:159032144-159032166 AGGGGGCAGCTGGGTGTGGGAGG + Intronic
1036727699 8:11234177-11234199 AAGGAAGAGCTAGCTCTGGGAGG - Intergenic
1037264601 8:17044806-17044828 AAGGAGCAGTTGGCTTGGGGTGG + Intronic
1037877286 8:22554350-22554372 GAGGAGGGGCCGGCTGTGGGAGG - Intronic
1038447316 8:27612940-27612962 GAGGAGAAGATGGCGGGGGGTGG + Intronic
1038929028 8:32172115-32172137 GAGGAGTACCTGGCTGTGGGAGG - Intronic
1039423096 8:37461042-37461064 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1039468839 8:37801419-37801441 AGGGAGAACCTGGGTGTGGGAGG + Intronic
1039669127 8:39576734-39576756 TAGGAGAAAATGGCTGTGGTTGG - Intergenic
1039695435 8:39905547-39905569 GAGGAAGAGCTGGATGTGGGAGG - Intronic
1039825883 8:41173804-41173826 AAGCAGAAGCAGGCTGGGTGCGG + Intergenic
1040438978 8:47421981-47422003 GAGGAGTACCTGGCTGTGTGAGG + Intronic
1040510021 8:48085070-48085092 AAGGAGAAGCTGGGTGAGGCTGG + Intergenic
1040516241 8:48137381-48137403 AAGGAGATGGTGGCTGTCGTTGG + Intergenic
1041215193 8:55593447-55593469 AAGGAGATGCGGCCTTTGGGAGG - Intergenic
1041246241 8:55891060-55891082 AAGGAAATGCTGGCTGGGTGCGG + Intronic
1041256528 8:55983739-55983761 AATGAGAAGCTGGCTGGTGAGGG - Intronic
1041523426 8:58779201-58779223 AAGGAGCAGCAGGCCGTGGAAGG + Intergenic
1041845322 8:62321701-62321723 GAGGAGTACCTGGCTGTGTGAGG + Intronic
1042958915 8:74281833-74281855 AGGAAGAGGCTGGCAGTGGGTGG - Intronic
1043176872 8:77032608-77032630 TATGTGAAGGTGGCTGTGGGTGG + Intergenic
1044598579 8:93981534-93981556 AAGAAGAGGCTGGCTGGGGTGGG - Intergenic
1045293495 8:100853077-100853099 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1045366234 8:101478704-101478726 AATGAGAGGGTGGTTGTGGGAGG - Intergenic
1045775179 8:105794450-105794472 GAGGAGTATCTGGCTGTGTGAGG + Intronic
1045949529 8:107835971-107835993 AAGGAACAGCTGGCTCTGGCAGG - Intergenic
1046019579 8:108648400-108648422 TAAGAGAAGCTGTCTGTGCGAGG + Intronic
1046054275 8:109060675-109060697 AAGGGGGAGCTGGCTGGGCGTGG + Intergenic
1046057663 8:109097990-109098012 AGGGAGATACTGGATGTGGGAGG - Intronic
1046122110 8:109859393-109859415 AAGGAGTACCTGGCCGTGTGAGG - Intergenic
1046768961 8:118099893-118099915 TAGGGGAAGTTGGCTGTGGCAGG - Intronic
1046812670 8:118549300-118549322 GAGGAGTACCTGGCTGTGTGAGG - Intronic
1047361833 8:124176117-124176139 GAGGAGAAGCTGCCTGTCTGTGG + Intergenic
1047492474 8:125386260-125386282 AAGGAGAAGCCTGCTGTTGTTGG + Intergenic
1047530180 8:125667346-125667368 AAAGAGGAGCTGGCTGGGTGAGG - Intergenic
1047547002 8:125827942-125827964 AAGGAGAAGTTGGTGGTGGTTGG + Intergenic
1048090653 8:131237010-131237032 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1048151296 8:131897467-131897489 AAGGGTAAGCTGGCTGGGTGTGG + Intergenic
1048287148 8:133150798-133150820 CAGGAGGCGCTGGCTTTGGGTGG - Intergenic
1048337687 8:133515070-133515092 ATGAAGAAGCTGGCAGAGGGTGG - Intronic
1048502860 8:134994503-134994525 AAGGAGAAGATGCCTGTGGAAGG + Intergenic
1048708131 8:137177586-137177608 AAGGGAAAACTGGTTGTGGGGGG + Intergenic
1048991904 8:139765475-139765497 AAGGACAGGGTGGCCGTGGGTGG + Intronic
1049098089 8:140560559-140560581 AAGGAACAGCTGCCTCTGGGTGG + Intronic
1049103406 8:140596290-140596312 AAACAGAAGCTGGCTGGGTGTGG + Intronic
1049108813 8:140630019-140630041 TGGGAGAAGCAGGGTGTGGGAGG - Intronic
1049215653 8:141406724-141406746 AAGAAGAGGCGGGCTGTCGGTGG - Intronic
1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG + Intergenic
1049391093 8:142372052-142372074 AAGGAGACGAAGGCTGTGAGAGG + Intronic
1049583162 8:143421786-143421808 AGGGAGAAGCTGGGGATGGGTGG + Intronic
1049616388 8:143577497-143577519 AAGGAGGGGCTGGGTGAGGGTGG - Intronic
1049661486 8:143821543-143821565 GAGGAGATGGTGGCTGTGGTGGG + Intronic
1049753100 8:144294934-144294956 GTTGAGAAGCTGGCTGAGGGAGG - Intronic
1049907776 9:235269-235291 GAGGAGTACCTGGCTGTGTGAGG + Intronic
1050331997 9:4555086-4555108 ATGGAGAAGCTGAGTCTGGGAGG + Intronic
1050690400 9:8221172-8221194 AAGGAGAAGCAGGGTGGGGGAGG + Intergenic
1051739171 9:20235098-20235120 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1052603196 9:30665652-30665674 CAGGGGAAGCTGGCCGTGGTGGG + Intergenic
1052626324 9:30981336-30981358 AAGAAGGAGCTCTCTGTGGGAGG + Intergenic
1053670555 9:40357685-40357707 AAGGAGGAGCTGACTTTGGCAGG + Intergenic
1053707171 9:40767774-40767796 GAGGAGGAGGCGGCTGTGGGAGG - Intergenic
1053920346 9:42984029-42984051 AAGGAGGAGCTGACTTTGGCAGG + Intergenic
1054381678 9:64497748-64497770 AAGGAGGAGCTGACTTTGGCAGG + Intergenic
1054417084 9:64888542-64888564 GAGGAGGAGGCGGCTGTGGGAGG - Intergenic
1054514058 9:66018615-66018637 AAGGAGGAGCTGACTTTGGCAGG - Intergenic
1055502184 9:76912206-76912228 AAGGAGAATCTACCTGTGAGAGG - Intergenic
1055592293 9:77829687-77829709 ATGCAGAAGCTGCTTGTGGGTGG - Intronic
1056090797 9:83203732-83203754 AGTGAGGAGCTGGCTATGGGTGG + Intergenic
1056598014 9:88023629-88023651 GGGGAGAAGCTGGCTGTTGGTGG + Intergenic
1056775932 9:89512613-89512635 AAGGAGAAGCTTGGGGTGGAGGG - Intergenic
1057261332 9:93586474-93586496 CAGGAGAAGCCAGCTGGGGGAGG + Intronic
1057279860 9:93701668-93701690 AAGGAGAGGATGGGGGTGGGGGG - Intergenic
1057429092 9:94978057-94978079 AAGGAGGGGTTGGCTTTGGGAGG - Intronic
1057699804 9:97355730-97355752 AAGGAGAAGGTGGCTGCGTGGGG + Intronic
1057859517 9:98628793-98628815 TAAGAGAAGCTGGCTGGAGGGGG - Intronic
1058305756 9:103438905-103438927 GAGGGGTAGCTGGCTGTGTGGGG + Intergenic
1059392156 9:114006061-114006083 GAGGTGAAGCTGGTGGTGGGAGG + Intronic
1059416790 9:114167571-114167593 AAGGACCAGGTAGCTGTGGGTGG + Intronic
1059757655 9:117308821-117308843 TAGGAGATGCTGGCAGTGAGGGG + Intronic
1059880497 9:118683648-118683670 GAGGAGAAGCTTGCAGTGAGCGG + Intergenic
1060176169 9:121499187-121499209 AAGGGGAATCTGGGAGTGGGGGG - Intergenic
1060297890 9:122355508-122355530 GAGGAGAAGCTGGGAGTGGGTGG - Intergenic
1060306109 9:122414015-122414037 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1060633229 9:125178777-125178799 TAGAAGAAGCTGGCTGCAGGAGG - Intronic
1060975528 9:127762709-127762731 GGGCAGAAGCTGACTGTGGGTGG - Intronic
1060993189 9:127860689-127860711 AAGAGGGAGGTGGCTGTGGGTGG - Intergenic
1061025881 9:128049146-128049168 GTGGAGAAGTTGGCTGAGGGCGG + Intergenic
1061311885 9:129768972-129768994 AAAGAAAAGATGGCTGTGTGCGG + Intergenic
1061876559 9:133546988-133547010 AAGGCCAAACTGGCTGGGGGAGG - Intronic
1061989524 9:134151287-134151309 ATGGAGAAGCCGCCTCTGGGAGG - Intronic
1062062131 9:134502381-134502403 AGGGAGAAGCTGGGGTTGGGGGG - Intergenic
1062189636 9:135241311-135241333 AAGGACCAGCAGGCTGGGGGAGG + Intergenic
1203698817 Un_GL000214v1:119225-119247 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203699773 Un_GL000214v1:125523-125545 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203479507 Un_GL000224v1:113-135 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203480473 Un_GL000224v1:6409-6431 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203481440 Un_GL000224v1:12737-12759 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203482404 Un_GL000224v1:19046-19068 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203548993 Un_KI270743v1:152910-152932 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203549457 Un_KI270743v1:155639-155661 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203550415 Un_KI270743v1:161951-161973 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203569112 Un_KI270744v1:115471-115493 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203570061 Un_KI270744v1:121760-121782 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1186571131 X:10715814-10715836 GAGGAGTACCTGGCTGTGTGAGG - Intronic
1187624001 X:21089936-21089958 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1188534054 X:31175761-31175783 AAAGAGAAGGTGGTGGTGGGTGG - Intronic
1188702095 X:33277663-33277685 AAGGAGTAGGAGGCTGAGGGTGG - Intronic
1192101113 X:68265298-68265320 GAGGAGTACCTGGCTGTGTGAGG - Intronic
1192110160 X:68355892-68355914 AAGAATTAGCTGGGTGTGGGTGG + Intronic
1192444283 X:71198942-71198964 AAGGCGAAGCTGGCTGGGCGTGG - Intergenic
1192683783 X:73282117-73282139 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1193236484 X:79113624-79113646 AAGCAGAAGCAGGCTGAAGGTGG + Intergenic
1193735139 X:85147592-85147614 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1193806195 X:85997657-85997679 GTGAAGAAGCTGGCTGGGGGCGG + Intronic
1194973834 X:100373289-100373311 TAGGAGAAGGAGGCTGGGGGAGG - Intronic
1195079638 X:101358708-101358730 AAAAAGAAGCTGTCTGTAGGAGG + Intronic
1195108855 X:101625082-101625104 AAGGAAAAAATGGCTGAGGGTGG + Exonic
1195134863 X:101894892-101894914 AGTGAGAAGGTGCCTGTGGGGGG + Intronic
1196466931 X:115982429-115982451 GAGGAGAAGCTAACTTTGGGAGG + Intergenic
1197088422 X:122507888-122507910 AAAGAGAAGGTGGTGGTGGGGGG - Intergenic
1197684803 X:129427744-129427766 AAGTGGCATCTGGCTGTGGGTGG + Intergenic
1197764305 X:130049959-130049981 AGGGAGAAGCAGGCTGGGTGGGG + Intronic
1198874284 X:141206108-141206130 TAGGAGAAACTGTGTGTGGGAGG + Intergenic
1199509868 X:148609914-148609936 AAGAACAAGATGGATGTGGGAGG - Intronic
1199548508 X:149032876-149032898 AGGGAGAATCTGGCTGCTGGTGG + Intergenic
1199746993 X:150778201-150778223 AGGGAGTAGCTGTCTGTGGAAGG - Intronic
1200070413 X:153526298-153526320 GAGGAGCAGCTGGTGGTGGGAGG + Intronic
1200415619 Y:2906909-2906931 AAGGAGAAGGAGGCTGGGTGTGG - Intronic
1200956162 Y:8948417-8948439 AAGGGGTACCTGGCTGTGTGAGG + Intergenic
1200969064 Y:9130466-9130488 GAGGAGAAGCTATCTGTTGGGGG + Intergenic
1201599642 Y:15713750-15713772 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1202141765 Y:21732033-21732055 GAGGAGAAGCTATCTGTTGGGGG - Intergenic
1202145100 Y:21771769-21771791 GAGGAGAAGCTATCTGTTGGGGG + Intergenic
1202344325 Y:23905737-23905759 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1202526443 Y:25764346-25764368 GAGGAGTACCTGGCTGTGTGAGG - Intergenic