ID: 1029970092

View in Genome Browser
Species Human (GRCh38)
Location 7:104780289-104780311
Sequence GTCAGGGACTTGCTGGCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 259}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029970092_1029970095 -8 Left 1029970092 7:104780289-104780311 CCCGCTGCCAGCAAGTCCCTGAC 0: 1
1: 0
2: 4
3: 19
4: 259
Right 1029970095 7:104780304-104780326 TCCCTGACACCTCCATTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029970092 Original CRISPR GTCAGGGACTTGCTGGCAGC GGG (reversed) Intronic
900860178 1:5223342-5223364 GTCAGGGACATGCAGGCACCAGG + Intergenic
902156792 1:14494175-14494197 GACAGGGACTTGCTGGCTCTGGG - Intergenic
904127079 1:28248468-28248490 CTCTGGTCCTTGCTGGCAGCAGG + Intergenic
904330701 1:29756143-29756165 GACAGGGACTTGGTGACAGAAGG + Intergenic
904415974 1:30361451-30361473 GACAGGGACTTGGTGACAGAAGG - Intergenic
904896895 1:33824380-33824402 CTCAGGGACTGGATGGCAGAGGG - Intronic
906077846 1:43065253-43065275 GTCTGGGCCAGGCTGGCAGCAGG - Intergenic
906670424 1:47650327-47650349 GTCAGGGGCTGGCTGGCACCAGG + Intergenic
907089205 1:51709089-51709111 GTCAAGGACTTACTGGCCGGAGG + Intronic
907274822 1:53311241-53311263 GGGAGGGCCCTGCTGGCAGCAGG + Intronic
907475901 1:54705333-54705355 GACAGGGACTGGCTTGCAGCAGG - Intronic
907486323 1:54780754-54780776 GTCAGGGCTTTTCTGGCTGCAGG + Exonic
912209788 1:107545284-107545306 TTCAGGCAGTTGGTGGCAGCTGG - Intergenic
912451012 1:109767805-109767827 GGCAGGGAATTGCAGGCAGAGGG + Intronic
912451125 1:109768443-109768465 GGCAGGGAATTGCAGGCAGAGGG - Intronic
912471814 1:109911546-109911568 GCCAGGGACTTGCTGGCAGAGGG + Intronic
915378961 1:155423473-155423495 GTCGGGGAATTGCTGGAACCCGG + Intronic
915601884 1:156927670-156927692 GGGAGGGACCTGCTGGGAGCAGG + Intronic
916758639 1:167797109-167797131 GTGTGGGACTTGCTGGCTGCTGG - Intergenic
918199514 1:182254027-182254049 GTCAGGGAATTGCTTGAACCTGG + Intergenic
919527323 1:198669664-198669686 GTCTGGGAGTGGCTGGCAGGAGG - Intronic
919746850 1:201014238-201014260 GCCAGGGACATGCGGGCGGCTGG + Intronic
919852307 1:201681248-201681270 CTCAGGGAAATGCTGGCAGATGG - Intronic
919980076 1:202637539-202637561 GGCTGGGACTTGAGGGCAGCCGG - Intronic
920953657 1:210597939-210597961 CTCAGAGACTTGCTGGCTTCAGG - Intronic
921167499 1:212517424-212517446 GTCAGGGACCTGCTCTCTGCTGG + Intergenic
922126996 1:222737531-222737553 GTCAGGGAATTGCAGGAAGAAGG + Intronic
923879020 1:238083602-238083624 CTCTGAGACTTGCTGGCATCAGG - Intergenic
924648894 1:245905127-245905149 CTCCGGGACTTGCTGGCTTCAGG + Intronic
924724706 1:246658743-246658765 GTCAGTGACTTGCTGGCATCAGG - Intronic
1062885420 10:1012240-1012262 GTTACTGACTTGCTGGCGGCTGG + Intronic
1063328072 10:5125616-5125638 GTCAGGTAGTTGCAGGCAACAGG - Intronic
1065149969 10:22812618-22812640 CTCTGGGACATGGTGGCAGCTGG + Intergenic
1067787633 10:49262248-49262270 GTCAGAGAATTTCTGGAAGCAGG - Intergenic
1072565822 10:96615832-96615854 GTCAGGCAGCTGATGGCAGCTGG + Intronic
1076649773 10:131979944-131979966 GTCCCGGATTTGCAGGCAGCTGG + Intronic
1076719412 10:132386727-132386749 CGCAGGGACTTGCTGGCTGCAGG - Intergenic
1077195084 11:1275595-1275617 GGGAGGGACATGCTGGCAGCAGG - Exonic
1077359501 11:2134390-2134412 GGCAAGGACTGGCTGGCACCAGG + Intronic
1077930060 11:6721539-6721561 CTGAGGGACTTGCTGACAGAAGG - Intergenic
1078105859 11:8357624-8357646 TTCAGGGACTTCCCTGCAGCAGG - Intergenic
1078519949 11:12054865-12054887 GTCAGGGGCTGGGTGGCAGGGGG - Intergenic
1083505828 11:63156654-63156676 CTCTGGGACTTGCTGGCTTCTGG - Intronic
1084074900 11:66766032-66766054 ATCAGGGAGTCTCTGGCAGCTGG + Intronic
1085517484 11:77119908-77119930 GTCAGGCAGGTCCTGGCAGCTGG + Intronic
1086733674 11:90280343-90280365 CTCAGGGAGTAGCTGGGAGCTGG + Intergenic
1089792919 11:120957313-120957335 TGCAGGGACTTCCTGCCAGCAGG - Intronic
1092174329 12:6392669-6392691 GTTAGGGAGCTGCTGCCAGCCGG + Intergenic
1096771179 12:53936946-53936968 GATAGGGTCTTGCTGGGAGCCGG - Intergenic
1096792598 12:54054269-54054291 GTCGGGGGCTGGCTGGCTGCAGG - Exonic
1097107048 12:56632140-56632162 CTCAGGGACTTGAGGTCAGCAGG - Intronic
1097225778 12:57476149-57476171 GTCAGGGACCAGCGGGTAGCCGG - Exonic
1101607472 12:106258560-106258582 CTCAGGGACATGCTGGCTTCCGG + Intronic
1101668261 12:106840477-106840499 GTCACTGACTTCCTGGTAGCTGG + Intronic
1102317933 12:111905012-111905034 GTCTGAGACTTGCTGGCTTCAGG + Intergenic
1103834084 12:123805151-123805173 GTCAGAGGCTTTCTGGCAGAAGG + Intronic
1104411425 12:128561348-128561370 ATCAGAGACTTGCAGGGAGCAGG + Intronic
1105657630 13:22457853-22457875 GTCGTGGACCTGGTGGCAGCTGG - Intergenic
1105887186 13:24652158-24652180 GTCAGGGCCTGACTTGCAGCGGG - Intergenic
1106227184 13:27794247-27794269 CGCAGCGCCTTGCTGGCAGCCGG + Exonic
1106411023 13:29511600-29511622 GTGGGGGCCTTGTTGGCAGCTGG - Exonic
1108592964 13:51926697-51926719 GACAGGGGCATGCTGGGAGCAGG + Intergenic
1110078944 13:71286786-71286808 CTCAGGGACATGCTGGCTTCAGG - Intergenic
1112427028 13:99311922-99311944 GGCAGGGACTGGGTGGCAGACGG - Intronic
1116114976 14:40636086-40636108 CTCAGAGACTTGCTGGCTTCAGG + Intergenic
1118785578 14:69043065-69043087 GTGAGCGCCTGGCTGGCAGCTGG + Intergenic
1118850722 14:69581247-69581269 GGCAGGGACTTGCAAGCTGCAGG + Intergenic
1119222987 14:72924553-72924575 GTCAATGAGTGGCTGGCAGCCGG - Intergenic
1120531634 14:85639180-85639202 CTCAGGGATTTGCTGGAAGCTGG + Exonic
1122737957 14:103854775-103854797 GCCAGGGAGTTGCAGGCTGCAGG + Intergenic
1124249441 15:28097294-28097316 GTCACTGACCTGCAGGCAGCCGG - Intronic
1124495689 15:30185584-30185606 GGCTGGGACTTGAGGGCAGCTGG - Intergenic
1124747884 15:32353062-32353084 GGCTGGGACTTGAGGGCAGCTGG + Intergenic
1126372626 15:47963405-47963427 GTCAATGGCTTGCTGCCAGCAGG - Intergenic
1128165471 15:65460485-65460507 GTCAGGGACTGGATGGAAGGAGG - Intronic
1128797214 15:70474697-70474719 TTCAGGGACTTGTTGGCTGGAGG + Intergenic
1129245187 15:74274901-74274923 GTTGGGAATTTGCTGGCAGCTGG + Intronic
1130411090 15:83649323-83649345 GGCAGTGACTTACTGGCACCCGG + Intergenic
1131882517 15:96875299-96875321 GGGAGGAACTTGCTGGCTGCTGG + Intergenic
1132937774 16:2490300-2490322 CTCAGGGAGCTGCTGGCAGCTGG + Intronic
1133027060 16:2993093-2993115 GTCGGGGCCTTCCTGGGAGCTGG + Intergenic
1134205590 16:12235294-12235316 GTCAGAGACCAGCTGGCACCAGG + Intronic
1135196301 16:20397841-20397863 GTCAGGCACGTCCTGGAAGCAGG + Intronic
1138383749 16:56621829-56621851 ATGAGGGACTTGCTGGGAACTGG + Intergenic
1138460668 16:57145949-57145971 GTCTGGGACTTGGCTGCAGCTGG + Intronic
1139551489 16:67675450-67675472 TTGAGGGACTCGCTGGCAGTGGG - Exonic
1139613033 16:68072582-68072604 GTCAAGGACTTGCCACCAGCCGG + Intronic
1139905409 16:70362147-70362169 GACAGGGTCTTGCTGTCACCAGG - Intronic
1139959858 16:70711247-70711269 GTGAGGCAGTTGCAGGCAGCAGG - Intronic
1141108627 16:81253934-81253956 GACAGGGTCTTGCTGTCACCAGG - Intronic
1141760110 16:86022696-86022718 GTGAGGGGCTGGCTGGCTGCTGG + Intergenic
1142320469 16:89379175-89379197 TTCTGGGAGCTGCTGGCAGCCGG + Intronic
1142630758 17:1224639-1224661 GTCAGAGCCTTGCTGGGAGGGGG + Intronic
1142681651 17:1553210-1553232 GTTAGACACTTACTGGCAGCTGG - Intronic
1144028895 17:11302393-11302415 GTCAGCCACTTTCTGGCTGCTGG - Intronic
1144809485 17:17989544-17989566 GGCAGGGACTTGCACGCAGGTGG + Intronic
1145209614 17:21003506-21003528 CTCAGGGAGTTCATGGCAGCTGG + Intronic
1146956583 17:36939603-36939625 CTCAGGGACCCACTGGCAGCGGG - Intronic
1147466271 17:40613525-40613547 GACAGGGACTTGCTGGGAAGGGG + Intergenic
1148849912 17:50549543-50549565 GTCAGGGACCTACTGGCTCCTGG + Intronic
1148868796 17:50643472-50643494 GTCAGGGACATGCTGCCTGGGGG - Intronic
1151051622 17:70984857-70984879 ATCAGGAACTTGCTGGGAACTGG - Intergenic
1151321145 17:73352995-73353017 GGCAGGGAATTGCTTGAAGCTGG + Intronic
1151632242 17:75318912-75318934 GTCTGGGACTTGCTGGTTCCAGG + Exonic
1151802346 17:76385605-76385627 GCCAGGGACCCCCTGGCAGCGGG + Exonic
1151962875 17:77416487-77416509 GCCAGGGACATGCCGGCAGCAGG + Intronic
1152673159 17:81621406-81621428 GCCTGGGACCTGCTGGCAGTTGG - Intronic
1152694905 17:81739162-81739184 GTCAGGGCCCCGGTGGCAGCGGG - Intergenic
1153099615 18:1451650-1451672 CTCTGGGACTTGCTGGCTTCAGG + Intergenic
1154246269 18:12702538-12702560 GGCAGCGACATGCTGGCAGCCGG + Exonic
1155282122 18:24250639-24250661 CTCAGAGACTTGCTGGCTTCAGG + Intronic
1156387709 18:36621005-36621027 GTCTTGGACTTGCTGGAAACAGG + Intronic
1156508221 18:37612647-37612669 AGCAGAGACTTGCTGGCAACAGG + Intergenic
1157502709 18:48202512-48202534 GGCAGGGTCCTGGTGGCAGCGGG + Intronic
1157815686 18:50728153-50728175 CTCAGGGAGTAGCTGGCTGCAGG + Intronic
1159192678 18:65067929-65067951 GGCAGGGCCTTGCTGGGAGGTGG - Intergenic
1160013252 18:75122608-75122630 TTCTGGGGGTTGCTGGCAGCCGG + Intergenic
1160540911 18:79621960-79621982 TGCAGGATCTTGCTGGCAGCTGG - Intergenic
1160935249 19:1591738-1591760 GTCTGGGACTTGGCTGCAGCAGG + Intronic
1161724543 19:5920979-5921001 GTCACGGACGAGCTGGCAGCTGG + Intronic
1161907634 19:7168985-7169007 GTCAGGGAAGTGCAGTCAGCAGG + Intronic
1161995474 19:7708766-7708788 CACAGGGCCTTGCTGGCTGCCGG - Intergenic
1162184227 19:8892144-8892166 GTCCTGGGCTGGCTGGCAGCCGG - Intronic
1163250885 19:16125669-16125691 GTCAGGGACATGGTGGGAGCAGG + Intronic
1164429196 19:28172236-28172258 GGCAGAAACTTGCTGTCAGCAGG - Intergenic
1165247280 19:34504893-34504915 GTGAGGGCTTTGCTGGCTGCAGG + Exonic
1165316040 19:35055932-35055954 ATCAGGGCTTTGCTGGCACCTGG - Intronic
1165815510 19:38639692-38639714 GACAGGGTCTTGCTGTCACCTGG - Intergenic
1165905782 19:39193881-39193903 GGCAGGGAGTGGCTGGGAGCCGG - Intergenic
1166730696 19:45057545-45057567 GTCAAGGACTTCTTGGCAGGTGG + Intronic
1167802010 19:51749608-51749630 GTCAGGTTCTTGCTGAGAGCTGG + Intronic
1168422914 19:56217051-56217073 GGCTGTGACTTCCTGGCAGCGGG - Intergenic
926080811 2:9984695-9984717 CTCAGGCACATGCTAGCAGCTGG + Intronic
928695009 2:33840632-33840654 GCCAAGGACTTCCTGGCAGGTGG - Intergenic
928834890 2:35531495-35531517 CTCTGGAACTTGGTGGCAGCTGG + Intergenic
929483591 2:42335955-42335977 AACAGGCATTTGCTGGCAGCAGG - Intronic
929562759 2:42966162-42966184 GTCAGGGACATGTTGGAAGGGGG + Intergenic
932493514 2:72135559-72135581 CCCAAAGACTTGCTGGCAGCTGG - Intronic
933671477 2:85011658-85011680 GTCAGCATCTTTCTGGCAGCAGG - Intronic
933788059 2:85859588-85859610 CTCAGGGTCTTGCTGGTCGCAGG - Intronic
935327159 2:101947623-101947645 GTCAGAGACGAGCTGGGAGCAGG + Intergenic
935576583 2:104717525-104717547 CTCAGAGACTTGCTGGCTTCTGG - Intergenic
936188921 2:110324807-110324829 GGCAGGGCAGTGCTGGCAGCTGG - Intergenic
938208680 2:129445519-129445541 GTCAGGGACAGGCTGGCAGCAGG + Intergenic
938687821 2:133757630-133757652 GTCTGGGATTTGCTGGCAGAGGG - Intergenic
939535863 2:143427694-143427716 GTCTAGGACTTGCTGACTGCTGG + Intronic
939577280 2:143911466-143911488 GTCAGGAGCTGGCTGGCAGAAGG - Intergenic
940443953 2:153754313-153754335 GTCAGAGACTTGCTGGTTTCAGG - Intergenic
941157700 2:161999515-161999537 GCCAGGCTGTTGCTGGCAGCGGG - Intronic
941687049 2:168457143-168457165 GCCAGGGACTTCCTGGCTTCTGG + Intronic
942459054 2:176157161-176157183 GGCCGGGGCTCGCTGGCAGCCGG + Intronic
943129533 2:183839092-183839114 ATCAGGGCCTTCCTGGCACCAGG + Intergenic
946165530 2:217861339-217861361 CTCAGGGACTTGCAGGGAGAGGG - Intronic
946477682 2:220024478-220024500 GTCAGAGACTTAAAGGCAGCTGG - Intergenic
946584779 2:221172870-221172892 GACAGGGACTGGCTGCCACCTGG - Intergenic
946709836 2:222494462-222494484 GTCAGGGAAATGCTGGGAGGAGG + Intronic
947912596 2:233811254-233811276 GGCAGGGATCTGCTGGAAGCAGG + Intronic
948219147 2:236255565-236255587 GTGAGGGAATAGCTAGCAGCTGG + Intronic
948583291 2:239002792-239002814 GTCGGGGAAGTGCTGGCACCTGG - Intergenic
949060922 2:241956840-241956862 GACAGTGACTTGAAGGCAGCTGG + Intergenic
1168981274 20:2006013-2006035 GACAGCGATTGGCTGGCAGCCGG + Intergenic
1169288423 20:4328633-4328655 GGCAGGGACATGCTGGCGGGAGG - Intergenic
1169425875 20:5497057-5497079 GTCAGGGTCTTGGCAGCAGCCGG - Intergenic
1172599018 20:36170882-36170904 GCCAGGCATTTGCTGCCAGCGGG + Intronic
1173103482 20:40109240-40109262 GGCAGGGTCTGGCTGCCAGCTGG + Intergenic
1174398275 20:50261181-50261203 GGCAGGGAGCTGCTGGGAGCTGG - Intergenic
1176258572 20:64166839-64166861 GTCAGGGAGAGGCTGGCAGAGGG + Intronic
1178080643 21:29060623-29060645 GTAAAGGACATGCTGGAAGCTGG - Exonic
1180865290 22:19115227-19115249 CTGATGGACTTGCTGGCACCTGG - Intronic
1182807788 22:33090109-33090131 GACAGGGAATTGCTTGAAGCCGG + Intergenic
1183518576 22:38282864-38282886 GTCAGGGGCATGCAGGGAGCTGG + Intergenic
1184248364 22:43246883-43246905 GGCAGGGAGTAGCTGGCACCTGG + Intronic
1184471639 22:44699299-44699321 GGCAGGGCCTGGCTGGCAGGAGG - Intronic
1185150948 22:49163728-49163750 GTCTGGGGGCTGCTGGCAGCAGG + Intergenic
949478937 3:4474924-4474946 GTCAGGAACATGCTGGGAACGGG - Intergenic
950579304 3:13852238-13852260 CTCTGGGGCTTGTTGGCAGCTGG - Intronic
951817183 3:26767271-26767293 GTCAGGGTTTTGCTGGCTTCTGG - Intergenic
953423019 3:42769810-42769832 GCCAGGGGCTTGCGGCCAGCCGG - Intronic
957691546 3:83577111-83577133 GTGAAAGACTTGATGGCAGCCGG + Intergenic
958128310 3:89385929-89385951 ATGAGGAACTTGTTGGCAGCCGG + Intronic
959803508 3:110524301-110524323 ATGAGGAACTTGCTGGCAACTGG + Intergenic
960427090 3:117522122-117522144 GTCTGGGACATGCAGGCAGTGGG - Intergenic
960680215 3:120239780-120239802 CCCAGGTACTTGCTGGCTGCAGG + Intronic
963086794 3:141444627-141444649 TTCAGGGACTGACTGACAGCTGG - Exonic
963786848 3:149543486-149543508 GTCAGGGACTCGCTTGAACCCGG + Intronic
964647853 3:158977696-158977718 GTCAGGTGCTGGCTGGCACCTGG - Intronic
967263156 3:187665029-187665051 GTCAGGGATGTGCTGGAAACTGG - Intergenic
967420080 3:189262863-189262885 CCCAGGGCCTTGCTGGCAGCTGG + Intronic
972104155 4:35461739-35461761 CTCAGAGACTTGCTGGCTTCAGG - Intergenic
974196261 4:58579768-58579790 GTCAGGGAGTTGGGGGCAGGGGG - Intergenic
974455774 4:62127995-62128017 ATAAGGGACTTGTTGGCAACTGG + Intergenic
975758170 4:77591793-77591815 CACAGGCACTTGCTGGCAGCAGG - Intronic
977327278 4:95591568-95591590 GTCAGAGACTTGCTGTCCACGGG + Intergenic
977821858 4:101481090-101481112 CTCAGGGAATTGCTGAGAGCAGG + Intronic
978938261 4:114405316-114405338 GGCAGTGGTTTGCTGGCAGCAGG + Intergenic
980133232 4:128835783-128835805 GGCTGGGACTTGCTGGCCTCTGG + Intronic
981319010 4:143370062-143370084 GTCAGGGACCTGGTGGGAGGCGG + Intronic
985087618 4:186329556-186329578 GCCAAGGACTTCCTGGCAGGTGG - Intergenic
989540294 5:42610421-42610443 GTCAGCCACTAGCTGGCTGCTGG - Intronic
990392300 5:55337143-55337165 GACAGGGTCTTGCTGTCAACCGG + Intronic
991091667 5:62699382-62699404 GACAGTGACTACCTGGCAGCAGG - Intergenic
992167485 5:74068983-74069005 GCCCAGGACTTGGTGGCAGCAGG - Intergenic
992370166 5:76135498-76135520 GTCTGGAACTTGCTGGAAGAAGG + Intronic
992499562 5:77328538-77328560 TTAAAGCACTTGCTGGCAGCTGG - Intronic
994793106 5:104257695-104257717 GTAGGGGACTTAATGGCAGCTGG - Intergenic
995090251 5:108166672-108166694 GTCAAGAGCTTGCTGGCAGAAGG + Intronic
995774693 5:115712571-115712593 GTGAGGAACTTGTTGGCAACTGG - Intergenic
995800494 5:115988802-115988824 CTCAGGGAGTTGGAGGCAGCAGG + Intronic
996523583 5:124453146-124453168 GTAAGCCACTTGCTGGAAGCTGG + Intergenic
997508423 5:134436584-134436606 GACAGTGACGTGCAGGCAGCTGG + Intergenic
998483390 5:142481298-142481320 CTCAGGGTCTTGCTGCCAGTAGG - Intergenic
1000115792 5:158152065-158152087 GTCAGGGTCTTGGGGGCACCAGG + Intergenic
1001125719 5:169017539-169017561 GGCAAGGCCTCGCTGGCAGCAGG + Intronic
1001809186 5:174614152-174614174 CTCAGGGTCTGGGTGGCAGCAGG - Intergenic
1002303869 5:178272381-178272403 GCCAGGGCCTTGCTGGCAGCAGG + Intronic
1002328041 5:178422549-178422571 CTCAGGGACGTGCAGACAGCGGG - Intronic
1003447900 6:6201370-6201392 GTCAGGAACTTGCAGGCAGTGGG + Intronic
1004916859 6:20340447-20340469 GTCAGGGACTTTCTGAAAGTTGG + Intergenic
1005835885 6:29709347-29709369 CTCAGGGGCATGCTGCCAGCAGG - Intergenic
1006066714 6:31467438-31467460 CTCAGGAACGTGCTGGCAACAGG - Intergenic
1006332995 6:33405500-33405522 GTCCGGGACCTGCTGGCCACTGG + Exonic
1007551373 6:42732562-42732584 GCCAAGGACTTCCTGGCAGGTGG - Intergenic
1009660610 6:66606348-66606370 GTCAGGGACTTGGAAGAAGCAGG - Intergenic
1015767053 6:136729864-136729886 TTCAGGGACTTGGTGGCTACAGG + Intronic
1015815596 6:137208030-137208052 GTGAGGAACTTGCTGGGAACTGG + Intronic
1017379641 6:153813713-153813735 GTGAGAGACTTGCTGGCTTCAGG + Intergenic
1018172795 6:161155024-161155046 CTCAAGGACATGCTGGCAGCGGG - Intronic
1018244990 6:161814045-161814067 CTCAGGGCCTTGCTGACAGAAGG + Intronic
1018397256 6:163387981-163388003 TTCATGGTCTTGCAGGCAGCTGG - Intergenic
1018782426 6:167080240-167080262 GCCAGGGCCTTGCTGTCACCTGG + Intergenic
1019134331 6:169898931-169898953 GTCTGGAGCTTGCTGCCAGCTGG - Intergenic
1019702419 7:2480373-2480395 GTGAGGGGCTTGCTGGGAGCCGG + Intergenic
1023352897 7:39338137-39338159 TTCAGGGACTTGATTGCATCTGG - Intronic
1023525807 7:41101629-41101651 GACAGTAACTTGCTGGCATCTGG + Intergenic
1023758190 7:43439778-43439800 CTCAGGTACTTGCTTTCAGCTGG - Intronic
1024908619 7:54419468-54419490 GCCAAGGACTTCCTGGCAGGTGG + Intergenic
1026780373 7:73262517-73262539 CTCAGGAGCCTGCTGGCAGCTGG + Intergenic
1027021232 7:74815958-74815980 CTCAGGAGCCTGCTGGCAGCTGG + Intronic
1027066794 7:75129979-75130001 CTCAGGAGCCTGCTGGCAGCTGG - Intronic
1028066649 7:86392474-86392496 ATGAGGAACTTGCTGGGAGCAGG - Intergenic
1028953672 7:96665173-96665195 GTCAGGGGCTGGCTGGGAGTGGG - Intronic
1029177591 7:98675778-98675800 GTCAGGGACCTGCTAGGAGGAGG - Intergenic
1029970092 7:104780289-104780311 GTCAGGGACTTGCTGGCAGCGGG - Intronic
1035125303 7:156604727-156604749 GTCAGGGACTTACTAGAATCAGG - Intergenic
1037763214 8:21755997-21756019 GTCAGAGGCTGGCTGGCTGCTGG + Intronic
1037961770 8:23103172-23103194 GGCCGGGACTCACTGGCAGCAGG - Exonic
1039964134 8:42271521-42271543 TTCCGGGCCTTGCAGGCAGCGGG - Intronic
1045243321 8:100421556-100421578 GCCTGGGACTTGCTGAAAGCAGG - Intergenic
1045644325 8:104285312-104285334 GTCAGGCACTTTCTAGGAGCTGG - Intergenic
1045645369 8:104292333-104292355 GTCAGGCACTTTCTAGGAGCTGG - Intergenic
1048230482 8:132635744-132635766 ATCAGGGACTTTCTGGAAACAGG + Intronic
1048396370 8:134017958-134017980 GTCCTGGACATGCTGGCAGGTGG + Intergenic
1049095461 8:140545718-140545740 CCCTGGGACTTGCTGGCAGGTGG - Intronic
1049320851 8:141995446-141995468 CTCAGGGACAGGCTGGCAGGAGG - Intergenic
1049409761 8:142467305-142467327 GCCTGGGACGGGCTGGCAGCCGG + Intronic
1049510841 8:143025937-143025959 GGCAGGGTCCTGCTGGCATCTGG + Intergenic
1049801492 8:144519774-144519796 GGCAGGGCCTGGCAGGCAGCTGG - Exonic
1052728482 9:32258682-32258704 CTCAGTTACTTGCTGGCAGTTGG - Intergenic
1053013092 9:34646582-34646604 GTCAGTCACGTGCTGGCGGCTGG + Intronic
1056701818 9:88917591-88917613 GTCATGGGCCTGGTGGCAGCAGG - Intergenic
1060139875 9:121201202-121201224 GTCTGGGGCTTGCGGGCTGCAGG + Intronic
1061814885 9:133188692-133188714 GTCAGGGACATGCTGGTGGGGGG + Intergenic
1062470896 9:136703874-136703896 GTCAGGGGTCTCCTGGCAGCCGG + Intergenic
1187244859 X:17545058-17545080 GGCAGGGACCTGCTGTCAGGAGG + Intronic
1187401761 X:18966732-18966754 GACAGGGACTGGCTGACAGGTGG - Intronic
1187412254 X:19061820-19061842 GCTAGGGCCTTTCTGGCAGCAGG + Intronic
1189868801 X:45360628-45360650 CTCTGAGACTTGCTGGCATCAGG - Intergenic
1192173400 X:68870782-68870804 GGCAGGGTCTTGCTCTCAGCTGG + Intergenic
1193673557 X:84419167-84419189 GTCAGAGACTTGCTGGCTTCAGG + Intronic
1194215878 X:91129572-91129594 ATGAGGAACTTGTTGGCAGCTGG - Intergenic
1194692931 X:97009539-97009561 GTCAGGGATATGCTGGCTTCAGG - Intronic
1195153497 X:102097805-102097827 GTCACTGACCTGATGGCAGCAGG - Intergenic
1195675469 X:107504203-107504225 CCCAGGGACTTGCTGACTGCAGG + Intergenic
1196441187 X:115721494-115721516 GTCTGGGAGTATCTGGCAGCAGG + Intergenic
1196444715 X:115839482-115839504 GTCTGGGAGTATCTGGCAGCAGG + Intergenic
1196664924 X:118305782-118305804 GTGAGGGACTTGTTGGGAACTGG - Intergenic
1196791451 X:119468540-119468562 GCCAAGGACTTCCTGGCAGGTGG + Exonic
1198121441 X:133596348-133596370 GTAAGGGAATTGCAGACAGCGGG + Intronic
1198415138 X:136412200-136412222 GTCAGGGCATTGGTGACAGCTGG + Intronic
1199439658 X:147854223-147854245 ATCTGAGACTTGCTGGCTGCAGG - Intergenic
1199601726 X:149545129-149545151 GTCAGTGCCTTGGTGGCGGCAGG + Intronic
1199648649 X:149934354-149934376 GTCAGTGCCTTGGTGGCGGCAGG - Intronic
1199762683 X:150917218-150917240 GTCAGGGACTTCTTGCCGGCGGG - Intergenic