ID: 1029971490

View in Genome Browser
Species Human (GRCh38)
Location 7:104793950-104793972
Sequence GAATCACTCTTAGAGAGGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029971490 Original CRISPR GAATCACTCTTAGAGAGGCT CGG Intronic
904800847 1:33092232-33092254 GAACCACTCATGGGGAGGCTGGG + Intronic
906535180 1:46547541-46547563 GAATCCATTTTGGAGAGGCTTGG + Exonic
907979573 1:59468467-59468489 GAATTAATCTTAGAAAGGTTGGG + Intronic
909526333 1:76626815-76626837 TAATCACTGTTATGGAGGCTGGG - Intronic
911973772 1:104466497-104466519 GAAGCACTCTTAGAAGGGTTGGG - Intergenic
919053957 1:192545593-192545615 CATTCACTCCTAGAGAAGCTTGG + Intergenic
919352304 1:196473111-196473133 ATATAACTCTTAAAGAGGCTTGG + Intronic
919661659 1:200253672-200253694 GAATTTCTCTTAGAGAGCCCAGG - Intergenic
920272043 1:204772933-204772955 AAGTCACTCTTAGAGATGCGCGG - Intergenic
922402295 1:225272736-225272758 GAATCACTCTTAGAGGGAGGGGG - Intronic
922504617 1:226119278-226119300 GAAACAGTCTCAGAGAGGCTGGG + Intergenic
1072768103 10:98112391-98112413 GAATCACTCTTAGCCTGGTTAGG + Intergenic
1073249913 10:102114985-102115007 GCCTCATTCTGAGAGAGGCTCGG - Intronic
1073388929 10:103155771-103155793 AGATCAGTCTTAGAGAGTCTTGG + Intronic
1077796426 11:5497483-5497505 CAATCAACCTTAGAGAGCCTGGG - Intronic
1077802553 11:5555535-5555557 GAATGTCTCTTGAAGAGGCTAGG - Intronic
1078138485 11:8672518-8672540 GAAACAGTGTTAGAGAGGCTGGG + Intergenic
1078198620 11:9158607-9158629 GAAACAGGCTTAGAGAAGCTAGG + Intronic
1078854352 11:15194774-15194796 GAATTAAACTTAAAGAGGCTGGG - Intronic
1079619420 11:22535118-22535140 GTTTCACTATTAGACAGGCTGGG - Intergenic
1080656634 11:34263604-34263626 GACTCATTCTTGCAGAGGCTGGG + Intronic
1085877072 11:80421260-80421282 GAATCACTCTTCAAGAGGCAAGG - Intergenic
1089816989 11:121184626-121184648 GAAACAGGCTCAGAGAGGCTAGG + Intronic
1090978602 11:131696590-131696612 GAATCAGGCTCAGAGAGGTTAGG - Intronic
1091100267 11:132865746-132865768 TAATCACTCATATATAGGCTGGG - Intronic
1093805389 12:23426278-23426300 GAATCACACTTAGAGTAGCAAGG + Intergenic
1097962660 12:65547661-65547683 ACTACACTCTTAGAGAGGCTGGG + Intergenic
1102802887 12:115751925-115751947 GAAACAGTCTCAGAGAGGTTAGG - Intergenic
1104248717 12:127068717-127068739 GAATTAACCTTTGAGAGGCTGGG - Intergenic
1106421399 13:29589112-29589134 TTAACACTCTCAGAGAGGCTGGG - Intronic
1122271661 14:100571021-100571043 GGATCTCCCTTAGGGAGGCTGGG + Intronic
1124783007 15:32653983-32654005 GAATCTCTCTAACAGAGTCTGGG + Intronic
1124953717 15:34346142-34346164 GTATCACACTTGGGGAGGCTAGG + Intronic
1128624554 15:69186240-69186262 GACCCACTGTCAGAGAGGCTGGG + Intronic
1129604803 15:77019652-77019674 GAAACAAACTTGGAGAGGCTAGG - Intronic
1130018702 15:80208977-80208999 GAATCAAGGTTTGAGAGGCTAGG - Intergenic
1137672754 16:50288956-50288978 GAATTAAAGTTAGAGAGGCTGGG - Intronic
1139960145 16:70712851-70712873 GACTCCTTCTTGGAGAGGCTTGG + Intronic
1143344173 17:6237917-6237939 TAGTCACTCTTGGAGAAGCTTGG - Intergenic
1163919486 19:20275558-20275580 GAATCTCTCTTTTTGAGGCTGGG + Intergenic
1164915842 19:32051865-32051887 GATTCAGTCCCAGAGAGGCTGGG - Intergenic
1165310141 19:35024745-35024767 CCATCACTCATAGAGAGGGTAGG + Intronic
924992941 2:329572-329594 GCAAAACTCTTAGAGAGCCTGGG - Intergenic
926178383 2:10617326-10617348 GGATCACTCTGGCAGAGGCTGGG + Intronic
928420145 2:31132052-31132074 GAATCTCTTTTAGTCAGGCTGGG - Intronic
932901295 2:75703737-75703759 GAATCACTGGTATAGAGGCCTGG - Intronic
942379307 2:175371684-175371706 GAATCACTCCTGGTGGGGCTGGG + Intergenic
945518985 2:210799657-210799679 GCATCATTCTAAGAGAGGATGGG - Intergenic
1170145223 20:13166197-13166219 AAATCACTTCAAGAGAGGCTTGG + Exonic
1172198856 20:33111478-33111500 GAACCAGTCCCAGAGAGGCTCGG + Exonic
1173768884 20:45640564-45640586 GAATTCCTCATAGAGAGACTTGG + Intergenic
1177662024 21:24097037-24097059 TAATTCCTCTTAGAGAAGCTTGG + Intergenic
951336825 3:21433550-21433572 GAAGCACTATTAGAGGGGCAGGG + Intronic
951707647 3:25559195-25559217 GAATGGGGCTTAGAGAGGCTAGG - Intronic
952415008 3:33082186-33082208 TTATCACTCTTAGGGAGGCCAGG + Intronic
961341529 3:126225488-126225510 GAATCCATCTTGGAGAGTCTTGG - Intergenic
972357017 4:38289468-38289490 GAATCTCTGCGAGAGAGGCTGGG - Intergenic
977151514 4:93519060-93519082 GATTCACGTTTAGAAAGGCTGGG - Intronic
980018888 4:127684100-127684122 GAATCAATCTGAGAAGGGCTTGG + Intronic
981780032 4:148418817-148418839 AACTCATTCTTAGAGAGGATAGG + Intronic
983255866 4:165399913-165399935 AACCCACTCTTAGAGAGGCTGGG - Intronic
985409373 4:189667020-189667042 GATTCAATCTTAGAGAGTTTAGG + Intergenic
986204737 5:5612816-5612838 GAATCACTCTTTATGAGGATTGG + Intergenic
990286060 5:54301799-54301821 GAATCCCTCTTGGAGAGACATGG + Intronic
991989791 5:72326274-72326296 GAATTACTGTTCCAGAGGCTTGG - Intronic
1000799254 5:165704310-165704332 AAATAAGTCTTAGAGAGGTTAGG + Intergenic
1000800190 5:165716215-165716237 GAAACACTCTCAGAGTGGTTTGG + Intergenic
1007495591 6:42258481-42258503 AAATCAAGCATAGAGAGGCTAGG - Intronic
1007867963 6:44994638-44994660 GATTTACTCTTAAAAAGGCTTGG - Intronic
1009520944 6:64681587-64681609 GAATCACTTTTAGCGAGGCCAGG - Intronic
1012306697 6:97667798-97667820 GAATTTCTCTGAGAGAGGTTTGG + Intergenic
1016315280 6:142778710-142778732 GAATGATTCTTAGAGAGGTTGGG + Intronic
1019894231 7:3971309-3971331 GGATCACTCTCAGAAATGCTAGG - Intronic
1021991512 7:26145927-26145949 GACGCACTCATAGAGATGCTGGG + Intergenic
1022113646 7:27245704-27245726 GAATCCCTCCGAGAGAGGTTTGG - Intronic
1028678940 7:93503028-93503050 AACTGAGTCTTAGAGAGGCTAGG + Intronic
1029724078 7:102390735-102390757 GAAACAGCCTTAGAGAGGTTAGG + Intronic
1029971490 7:104793950-104793972 GAATCACTCTTAGAGAGGCTCGG + Intronic
1032057711 7:128697155-128697177 GATTCACTCTGAGTGGGGCTTGG + Intergenic
1032861005 7:135879170-135879192 GTTTCACTCTTGGAGAGCCTTGG - Intergenic
1036825681 8:11974148-11974170 AAATCAATCTTAATGAGGCTGGG + Intronic
1038448062 8:27617601-27617623 GAATCACTCTCAGATGGGCGTGG + Intergenic
1038669642 8:29572235-29572257 GAAACTTTCTTAGAAAGGCTGGG + Intergenic
1038753400 8:30317487-30317509 GAATCAGGCTCAGAGAGGTTAGG + Intergenic
1039687713 8:39823871-39823893 AAAGCATTTTTAGAGAGGCTAGG - Intronic
1040278277 8:46024934-46024956 GAAGCCCTCTTACAGAGGCCTGG - Intergenic
1042488896 8:69377099-69377121 AAATCACTCGTAGAGAGGAAAGG + Intergenic
1043625188 8:82248328-82248350 GAATAACTCTAATAGAGGCTTGG - Intergenic
1044377242 8:91490037-91490059 GACTCATTCTTTGAGAGGATAGG - Intergenic
1045400934 8:101817150-101817172 GAATCATTCTCAGAAGGGCTCGG - Intronic
1046801839 8:118437236-118437258 CATTCACTCTTAGAGAAGCAGGG + Intronic
1049552961 8:143269135-143269157 GAATAACGCTTTGAGTGGCTGGG - Intronic
1051786415 9:20749169-20749191 GAATCCCTTTTAGAGAGCCAGGG - Intronic
1053005641 9:34602526-34602548 GGGTCACACTGAGAGAGGCTGGG + Intergenic
1056233522 9:84570054-84570076 GAATGACCCACAGAGAGGCTGGG + Intergenic
1059854382 9:118379506-118379528 GTATCACTCTTAGAGTGTATTGG + Intergenic
1060655470 9:125369670-125369692 CAAACTCTCTTGGAGAGGCTGGG - Intergenic
1185464053 X:345007-345029 GGATGACTCTTAGAGGGGCCGGG + Intronic
1188108454 X:26169342-26169364 GAATCACACATAGATAAGCTAGG + Intergenic
1189045029 X:37581546-37581568 GAATGACTCTAAAATAGGCTTGG - Intronic
1191897548 X:66009385-66009407 GAATGACGGTTACAGAGGCTTGG - Intergenic
1193562395 X:83034570-83034592 GAAACACACATAGACAGGCTAGG + Intergenic
1195137343 X:101922371-101922393 AGCTCACTCTTAGAAAGGCTAGG + Intronic
1195930208 X:110066804-110066826 GAATCAATCAAAGGGAGGCTTGG + Intronic