ID: 1029972907

View in Genome Browser
Species Human (GRCh38)
Location 7:104806809-104806831
Sequence GAGGGAAAGTGCCTGATCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 327}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029972907_1029972915 30 Left 1029972907 7:104806809-104806831 CCTGAGATCAGGCACTTTCCCTC 0: 1
1: 0
2: 2
3: 15
4: 327
Right 1029972915 7:104806862-104806884 TTTTACTCATAATACCTTTCGGG No data
1029972907_1029972911 2 Left 1029972907 7:104806809-104806831 CCTGAGATCAGGCACTTTCCCTC 0: 1
1: 0
2: 2
3: 15
4: 327
Right 1029972911 7:104806834-104806856 TCTCCTTGCTGCTGGAGCCATGG 0: 1
1: 0
2: 3
3: 26
4: 257
1029972907_1029972914 29 Left 1029972907 7:104806809-104806831 CCTGAGATCAGGCACTTTCCCTC 0: 1
1: 0
2: 2
3: 15
4: 327
Right 1029972914 7:104806861-104806883 ATTTTACTCATAATACCTTTCGG No data
1029972907_1029972908 -6 Left 1029972907 7:104806809-104806831 CCTGAGATCAGGCACTTTCCCTC 0: 1
1: 0
2: 2
3: 15
4: 327
Right 1029972908 7:104806826-104806848 TCCCTCACTCTCCTTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029972907 Original CRISPR GAGGGAAAGTGCCTGATCTC AGG (reversed) Intronic
900261572 1:1733122-1733144 CAGGCAGATTGCCTGATCTCAGG - Intronic
900658857 1:3772992-3773014 AAGGGAAAGTGGCTGGTGTCGGG - Intronic
901038859 1:6352238-6352260 GAGGGAAGGTGTCTGATTTGGGG - Intronic
901457913 1:9374083-9374105 CAGGGAAATTGCCTGAGCCCAGG + Intergenic
901766001 1:11500516-11500538 AAGGGAAAGAGCATGATCTTTGG - Intronic
902527668 1:17069938-17069960 GAGGGCAAGTGCCTGAGGTGAGG + Intronic
904051880 1:27644898-27644920 GAGGGAAAGTGACTTACCTAAGG + Intergenic
905186606 1:36201640-36201662 GAGGGCAATGGCATGATCTCGGG + Intergenic
907827817 1:58035860-58035882 TAGTGAAAGTGCCCTATCTCGGG - Intronic
907838729 1:58136008-58136030 GAGTGAATGTGACTGGTCTCTGG - Intronic
908226923 1:62065513-62065535 GAGGCAAATCGCTTGATCTCAGG + Intronic
908657184 1:66400779-66400801 GAGAGAAATAGACTGATCTCAGG - Intergenic
909140408 1:71857382-71857404 GAGGTAGAGTGCTTGAGCTCAGG + Intronic
911270341 1:95794140-95794162 GAAGCAAAGTGCCTGAACCCTGG - Intergenic
912209679 1:107544560-107544582 CAGGCAAACTGCCTGTTCTCAGG + Intergenic
913532581 1:119743228-119743250 GAGGGAAAGTGCCTTATCCAGGG + Intronic
913711663 1:121490303-121490325 AAGGGCAAGTACCTGATCACAGG + Intergenic
914418805 1:147509567-147509589 AAGGGAAGGTGCCTGAGCTCAGG - Intergenic
914459550 1:147870474-147870496 GAGGGAAAGATGCTGAGCTCAGG + Intergenic
915896380 1:159814285-159814307 GAGTGAAGGTGAGTGATCTCAGG + Exonic
916262729 1:162858640-162858662 GAAGGAGAGTGCCAGAACTCAGG - Intronic
916317935 1:163471131-163471153 GAGGCCATGTGCCTGAGCTCTGG + Intergenic
916529017 1:165638249-165638271 GAGGCAAATTGCTTGAGCTCAGG + Intronic
916790787 1:168123216-168123238 CAGGAAAATTGCTTGATCTCAGG + Intronic
917263524 1:173195521-173195543 GGTGGAAAGTGTCTGATATCTGG + Intronic
917362674 1:174194284-174194306 GAGGGCAATAGCATGATCTCAGG + Intronic
918363657 1:183784279-183784301 GAGGGAAGGTGCCTGATACTGGG + Intronic
918605296 1:186417188-186417210 CAGGCAGAGTGCCTGAGCTCAGG - Intronic
921946812 1:220891672-220891694 GAGCAAAAGTGCCTGTTCTGCGG + Intergenic
922105486 1:222509993-222510015 GAGGGCAATGGCGTGATCTCGGG - Intergenic
922265823 1:223982572-223982594 GAGGGCAATGGCATGATCTCAGG - Intergenic
922523279 1:226276807-226276829 GAGAGAAAGTGCAAAATCTCAGG - Intronic
923215614 1:231845541-231845563 TGGGGAAAATGCATGATCTCAGG - Intronic
924347661 1:243087524-243087546 GAGGGCAATGGCGTGATCTCAGG - Intergenic
1064057430 10:12109527-12109549 GAGAGAAGGTGCCTGAGCTCTGG + Intronic
1066207814 10:33207137-33207159 GAGGGAAGTTGCCTGCTTTCTGG + Intronic
1067466214 10:46501295-46501317 GAGGGCACGTGCCTGTTCCCAGG - Intergenic
1067570760 10:47369271-47369293 AAGGGAAAGAGCCTGCTCTGGGG + Intronic
1067580753 10:47444045-47444067 GAGGGAAGGTGCCTGAGACCAGG + Intergenic
1067620974 10:47883310-47883332 GAGGGCACGTGCCTGTTCCCAGG + Intergenic
1069016954 10:63440987-63441009 GAGGAAAAGTGCTTGAGGTCAGG + Intronic
1069282348 10:66670449-66670471 CAAGGAAAGTGATTGATCTCTGG - Intronic
1069519534 10:69107688-69107710 CAGGCAAATTGCCTGAGCTCGGG - Intergenic
1069857045 10:71447099-71447121 TAGGGAAAGTGCCTGTCATCCGG + Intronic
1071574999 10:86718702-86718724 GGGGGAAAGAGCCTAAGCTCAGG - Intronic
1072101785 10:92236285-92236307 GAGGTAGAGTGACTGAACTCAGG - Intronic
1073226575 10:101925816-101925838 CAGGGGAATTGCCTGAACTCAGG + Intronic
1073329035 10:102658948-102658970 AAGGCAAATTGCCTGAGCTCAGG + Intergenic
1073374533 10:103021550-103021572 GAGCGAAAGCGCCAGAACTCTGG - Intronic
1073558258 10:104474395-104474417 GAGGCAAAGTCCCTCATATCAGG + Intergenic
1073857767 10:107697148-107697170 CAGGTAGAGTGCCTGATCTGAGG + Intergenic
1074155504 10:110795395-110795417 TTGGGAAAGTGCTTGACCTCTGG + Intronic
1074708552 10:116158013-116158035 GAAGGAAGGTTCCTGGTCTCTGG + Intronic
1074939065 10:118217167-118217189 GAGGGACATTCCCTGGTCTCTGG - Intergenic
1075417632 10:122276988-122277010 GAGGGGAGGTGCCTGATGACCGG + Intronic
1075723639 10:124600885-124600907 AACGGAATGTCCCTGATCTCAGG + Intronic
1076277271 10:129212282-129212304 GAGGGAAGGTGGCTGGACTCAGG - Intergenic
1078350042 11:10585632-10585654 GAGAGAATGTGTATGATCTCGGG + Intronic
1079197785 11:18345589-18345611 GAGGAGAAGTGCTTGAACTCGGG - Intronic
1079347172 11:19663030-19663052 GAGGAAAAGTGTGGGATCTCAGG - Intronic
1081117934 11:39228495-39228517 CAGGGAGATTGCCTGAGCTCAGG + Intergenic
1081809668 11:45907793-45907815 GAGGGAAAGGCCCTGAGCTGGGG - Intergenic
1084519272 11:69653636-69653658 GAGGGACACAGCCTGGTCTCTGG - Exonic
1084738286 11:71120462-71120484 GAGGGTAAGTTCCTCATCGCTGG + Intronic
1085434843 11:76491484-76491506 GAGGGAAGGTGTCAGAACTCAGG - Intronic
1089118613 11:116115701-116115723 GAGGGAAGGTGATTGATCTTGGG - Intergenic
1089482220 11:118815280-118815302 CAGGCAAATTGCCTGAGCTCAGG + Intergenic
1089503650 11:118948486-118948508 GGGGGAAAGTGACTGAGCTGTGG - Intronic
1089701659 11:120248220-120248242 GAGGCAAAGTGGCTGGTCTAAGG - Intronic
1090949719 11:131463084-131463106 GAGGTAAAGTCACTGACCTCAGG - Intronic
1091128851 11:133127102-133127124 GAGGGAAAGGGGCAGATCTAAGG - Intronic
1091444565 12:536131-536153 GAGGCACAGTGCCTGCTCCCAGG - Intronic
1091515691 12:1178911-1178933 CTGGAAAAGTGCCTGATCTATGG + Intronic
1091775341 12:3181362-3181384 GAAGGAAAGTGCCTTGTCACGGG + Intronic
1091832652 12:3560908-3560930 GAGGTCAAGTGCCTGATATAGGG + Intronic
1093007544 12:14066940-14066962 GAGGTAAAGTTCTTGTTCTCGGG + Intergenic
1095796922 12:46229858-46229880 GAGGCAAAGTGCCTGCCCTTGGG - Intronic
1096575650 12:52551226-52551248 GAGGTTAAGGGACTGATCTCTGG + Intronic
1097176376 12:57145748-57145770 AAGGGACAGTCCCTGGTCTCTGG - Intronic
1098477172 12:70919302-70919324 CAGGGAAAATGCCTCGTCTCTGG + Intronic
1099679006 12:85800358-85800380 GGGGCAAATTGCCTGAGCTCAGG + Intergenic
1101795323 12:107967691-107967713 GAGGGAAAGCGCCTCATCCCTGG - Intergenic
1101962752 12:109262188-109262210 GAGGGAAAGTGACTTGTCTAAGG + Intronic
1102426807 12:112850155-112850177 GAGGTAAAGTGGCTTATCTAAGG - Intronic
1102684429 12:114713653-114713675 GAGGGAAATTGCCTAATCTCAGG - Intergenic
1103926835 12:124427867-124427889 GATGGGAAGTGCCTGTCCTCCGG + Intronic
1105464035 13:20620656-20620678 CAGGGAAATTGCCTGAACCCGGG - Intronic
1107743860 13:43484624-43484646 GAGGGAAAGTACCTGCCCTAAGG - Intronic
1108762641 13:53588287-53588309 GATGGAAAATGCCTGATCCTTGG - Intergenic
1112230005 13:97580460-97580482 GAGCCAAAGTCCCTGGTCTCAGG - Intergenic
1112438039 13:99405527-99405549 TTGGGAAAGGGCCTGATTTCAGG + Intergenic
1112491157 13:99865544-99865566 TAGGGAAAGTGCCTGTCTTCAGG - Intronic
1117784331 14:59266809-59266831 GGTGGACAGTGCCTGGTCTCTGG + Intronic
1118751467 14:68810887-68810909 AAGGGTAAGTGCCTGGTCTTGGG + Intergenic
1118795510 14:69140036-69140058 GAGGGGGATTGCCTGAGCTCAGG + Intronic
1120541448 14:85755969-85755991 GAAGGAAAGTGCATGAACTTTGG + Intergenic
1121823687 14:96992892-96992914 GAGGGAAGGTGGCTGTTCCCTGG - Intergenic
1121901644 14:97698302-97698324 GAGGGCAGGGACCTGATCTCTGG - Intergenic
1121928886 14:97954040-97954062 CAGGCAAATTGCCTGAGCTCAGG - Intronic
1121944194 14:98103449-98103471 GAGGGAAAGGGACAGACCTCTGG + Intergenic
1121952391 14:98183008-98183030 GAGGGACAGAGCCTGAATTCTGG - Intergenic
1122249599 14:100428480-100428502 GGGGGACAGTGCCTGAGCGCCGG + Intronic
1123921271 15:25071441-25071463 GAGGGAATGTGCCTTGGCTCTGG + Intergenic
1124705585 15:31961064-31961086 GAAGGGAATTGCCTCATCTCAGG + Intergenic
1126247494 15:46526501-46526523 GAGGGAAAGAGTATAATCTCAGG + Intergenic
1126887460 15:53166150-53166172 GGGGGAAAGAGCATGATCTCTGG - Intergenic
1127266190 15:57364379-57364401 GAGGGAATGTGCAAAATCTCTGG + Intergenic
1127656414 15:61060427-61060449 CATGGCAAGTGCCTGCTCTCAGG - Intronic
1128385551 15:67145735-67145757 CAGGTCAAGTGCCTCATCTCCGG - Intronic
1129876878 15:78981367-78981389 GAGGGAAAGGGCCTTCCCTCGGG - Intronic
1131777573 15:95819021-95819043 CAGGCAGATTGCCTGATCTCAGG + Intergenic
1133133343 16:3691971-3691993 GAGTGAAAGTGTCTGGTTTCTGG - Intronic
1135247585 16:20870231-20870253 GAGGCAAAGTGCCTGTCCTTAGG - Intronic
1135490498 16:22905249-22905271 GTGGGAACCTGCCTGATGTCGGG - Intronic
1135930186 16:26729659-26729681 GAGGGAAATTGCTTGAACCCAGG + Intergenic
1137532051 16:49283963-49283985 GAGTGAAAGAGCCTGTTTTCAGG + Intergenic
1137552062 16:49444363-49444385 GAGAGAAAGGCCCTGATCTGAGG - Intergenic
1137587414 16:49671910-49671932 CAGGCAGATTGCCTGATCTCAGG - Intronic
1138148837 16:54636818-54636840 GGGGGCAAGTGTCTGAGCTCAGG - Intergenic
1139015307 16:62683380-62683402 GAAGGAAAGTGTATGATATCTGG - Intergenic
1139064498 16:63295792-63295814 AGTGGAAAGTGCCTGAACTCTGG + Intergenic
1141923939 16:87154639-87154661 GAGAGAAAGTGGCTCATCTCAGG + Intronic
1143129634 17:4669610-4669632 AAGGGAAAGAACCTGATTTCTGG - Intergenic
1144833941 17:18147158-18147180 GAGGGACAGTGACTTGTCTCAGG - Intronic
1144888426 17:18479231-18479253 GAGGGAAAGTCCCCGGTCTCTGG + Intronic
1145143780 17:20465071-20465093 GAGGGAAAGTCCCCGGTCTCTGG - Intronic
1145792084 17:27633626-27633648 GAGGAAAAGTCCCCGGTCTCTGG + Intronic
1145806996 17:27741581-27741603 GAGGGAAAGTTCCCAGTCTCTGG + Intergenic
1146630997 17:34469198-34469220 GGGGTAAAGTACCTCATCTCAGG - Intergenic
1146956922 17:36941342-36941364 GAGGGGAAGTCCCTGATCTGGGG - Intronic
1147160169 17:38564855-38564877 CAGGGAATGTGCCTGATTTAGGG + Intronic
1147394127 17:40128275-40128297 AAAGGAAAGAGACTGATCTCTGG + Intronic
1147632286 17:41939869-41939891 GAGCTAAAGTGGCTTATCTCAGG - Intronic
1147863245 17:43536211-43536233 GAGGGATAGTGTCTGCTCTAAGG + Intronic
1148435240 17:47679152-47679174 GTGGGAGATTGCCTGAGCTCAGG - Intronic
1148732731 17:49847294-49847316 GAGGCAAAGATCCTGACCTCAGG - Intronic
1148769600 17:50059234-50059256 GAGGGACAGGGACTGTTCTCTGG + Intronic
1148833132 17:50449242-50449264 GAGGCAGATTGCCTGAGCTCAGG - Intronic
1150117098 17:62562307-62562329 GAGTGAAATGGCATGATCTCAGG - Intronic
1150578957 17:66454936-66454958 GAGGGCAGGTGCCTGACCACAGG + Intronic
1152034014 17:77860910-77860932 GAGGAAAAGTGCCAGCTCTGTGG - Intergenic
1152078879 17:78174482-78174504 GAGGGAGTGTGCCAGATCCCAGG + Exonic
1152431317 17:80249565-80249587 GAGGGTCAGTCCCTGCTCTCAGG + Intronic
1203164516 17_GL000205v2_random:81425-81447 GAGGCAAAGTGACATATCTCTGG + Intergenic
1154272156 18:12929613-12929635 GAGGGAGAGAGACTGAGCTCTGG + Intronic
1157382797 18:47235131-47235153 GAGGGAGAGTGCTTGAACCCAGG + Intronic
1157715070 18:49879287-49879309 GAGAGAAAGACCCTGCTCTCAGG + Intronic
1157883769 18:51346577-51346599 GAGGGGAAGTGGCTCACCTCAGG + Intergenic
1159202584 18:65206542-65206564 GAGATAAACTGCCTGATTTCGGG + Intergenic
1160831245 19:1105802-1105824 CTGGGAAAGTGCGTGACCTCTGG + Exonic
1162059590 19:8086506-8086528 GAGTGCAATTGCCTGATCTTGGG + Intronic
1162352422 19:10158678-10158700 GAGGGAAGGTGCCTGGCGTCCGG - Intronic
1162468700 19:10858986-10859008 GAGTGCAATGGCCTGATCTCTGG + Intronic
1162772505 19:12957616-12957638 GAGGGTAACGGCGTGATCTCGGG + Intergenic
1162874999 19:13614593-13614615 GAGGCAGATTGCCTGAGCTCAGG + Intronic
1163710144 19:18841716-18841738 CAGGGAGAGTGGCTGATCCCCGG + Intronic
1164098703 19:22035111-22035133 AAGGGAAAGTGACTTATCACTGG - Intergenic
1164118573 19:22245334-22245356 AAGGGAAAGTGACTCATCACTGG - Intergenic
1164176155 19:22776916-22776938 CAGGTAAATTGCCTGAGCTCAGG + Intronic
1164201659 19:23024180-23024202 AAGGGAAAGTGACTTATCACTGG - Intergenic
1164387106 19:27781564-27781586 GGGGTAGTGTGCCTGATCTCTGG + Intergenic
1166376009 19:42327407-42327429 CAGAGAAAGTGCCTGATCTGGGG + Intronic
1167688571 19:50971309-50971331 GAGGGATAGGGCCTGGTCACTGG - Intergenic
1168415908 19:56168158-56168180 CAGGCAAATTGCCTGAGCTCAGG - Intergenic
925722444 2:6842247-6842269 GAAGGAAAGTGGCTGAGTTCAGG + Intronic
925752759 2:7104644-7104666 TAGAGAAATTGCCTGATCTCAGG + Intergenic
926492507 2:13542152-13542174 CAGGAAAATTGCTTGATCTCTGG + Intergenic
927137750 2:20109641-20109663 GAAGCAAAGTGACTCATCTCAGG + Intergenic
928029658 2:27767688-27767710 GTGGGAAAATGGCTGATTTCAGG + Intergenic
929220196 2:39456061-39456083 AAGGGAAATGGCCTGATGTCAGG + Intergenic
931403844 2:61956841-61956863 CAGGGAAATTGCTTGAACTCGGG - Intronic
932567870 2:72920850-72920872 CCCGGAAAGTTCCTGATCTCGGG - Intronic
933893827 2:86792721-86792743 GGGGCAAAGCGCCTGACCTCGGG - Intronic
935827947 2:106970016-106970038 GAGGCTAAGTCCATGATCTCAGG - Intergenic
936522321 2:113219104-113219126 GTGGGAAGGTGCCTGAACCCTGG + Intronic
937346621 2:121130077-121130099 GAGGCACAGGGCCTGAGCTCTGG - Intergenic
941185526 2:162317997-162318019 GAGGGCAAGTCCGTGAGCTCAGG + Exonic
943833802 2:192493327-192493349 GAGGCAGATTGCCTGAGCTCAGG - Intergenic
945053644 2:205849305-205849327 GAGGGAAGCTGCCAGAACTCAGG - Intergenic
946200952 2:218070472-218070494 GAGGGAAAGTGACTAATCTTGGG - Intronic
947029147 2:225773042-225773064 GAGGCAGATTGCCTGAGCTCAGG - Intergenic
947075671 2:226341953-226341975 GAGGGAGATGGCCTGATCCCAGG + Intergenic
948565706 2:238884802-238884824 GCCGGAAAGTGCCTGCTCCCTGG + Intronic
1169432414 20:5549963-5549985 AAGGCAAATTGCCTGAGCTCAGG + Intronic
1172333692 20:34096047-34096069 CAGGGAAAGTGCCTGAATTTGGG - Intronic
1172844014 20:37919059-37919081 GAGGGCAGGGGCCTGATCTGTGG + Intronic
1172888481 20:38247268-38247290 GAGGGCAGCTGCCAGATCTCAGG - Intronic
1174026870 20:47584200-47584222 GTGGGAGATTGCTTGATCTCAGG + Intronic
1175178977 20:57131619-57131641 GAGGAAAAGTCATTGATCTCGGG - Intergenic
1175226287 20:57445763-57445785 TAGGGAACGTGCCTAATCCCTGG - Intergenic
1179098577 21:38336948-38336970 GGGGAAAATTGCCTGATCTGGGG - Intergenic
1179572437 21:42285749-42285771 GAGAGGAAGTGGCTGATCGCTGG + Intronic
1179661284 21:42877193-42877215 GAGTGCAAGGGCATGATCTCAGG + Intronic
1179892941 21:44346215-44346237 GAGTGCAAGGGCCTGATCTTGGG + Intergenic
1180754763 22:18153334-18153356 CAGGGGAAGTGCTTGAACTCGGG + Intronic
1180883775 22:19225116-19225138 CAGTGAAAGGGCCTGATGTCTGG - Intronic
1180916647 22:19493535-19493557 GAGGAAAACTGCCTGAACCCAGG - Intronic
1180975175 22:19844194-19844216 CAGCAAAAGTGACTGATCTCTGG - Intronic
1181385689 22:22543969-22543991 TAGGTAAATTGCCTGAGCTCAGG - Intergenic
1181468826 22:23125687-23125709 GAGGAAAGGTGCCTGAGGTCAGG + Intronic
1181965085 22:26650896-26650918 GAGGGAAAGTGACTTATCCGAGG - Intergenic
1183162778 22:36126211-36126233 GAGGGAAAGTGACTTACCTAGGG + Intergenic
1183227256 22:36559012-36559034 GTGGGAAAGGGCCTGGTCTGAGG - Intergenic
1183926994 22:41213416-41213438 GGGGGAAACTGCCTGAGCCCAGG - Intronic
1184453610 22:44597096-44597118 GAGGGAAAGGGCCTGGCCTGGGG + Intergenic
1184565025 22:45286697-45286719 AAACTAAAGTGCCTGATCTCCGG + Intronic
1184849344 22:47111062-47111084 CAGGCCCAGTGCCTGATCTCCGG + Intronic
949380898 3:3444618-3444640 GAGGCAAAGTCCCAGACCTCAGG + Intergenic
949534871 3:4988038-4988060 GAGGGGAAATGCCTTATCTGAGG + Intergenic
950146440 3:10653431-10653453 GAGGGAAGGTGCCTGAGTTGAGG + Intronic
950190372 3:10972326-10972348 TAGGGAAAGTGCATGAGCCCAGG + Intergenic
950626875 3:14253707-14253729 GATGGAAAGTCCCAGATCTCAGG - Intergenic
952804701 3:37337436-37337458 CAGGGGAACTGCCTGAGCTCAGG - Intronic
953685024 3:45070824-45070846 TTGGAAAAGTGACTGATCTCAGG + Intergenic
953715356 3:45312750-45312772 GAGCAAAAGTGCCTCCTCTCTGG - Intergenic
953764939 3:45732000-45732022 GAAGGAAAATGAATGATCTCTGG + Intronic
953794616 3:45974952-45974974 CAGGGAAAATGCCTGGTATCGGG + Intronic
954780114 3:53052527-53052549 GAGGGCCAGTGCCTGTTCTGTGG - Intronic
955226433 3:57064037-57064059 GAGGGGGACTGCCTGAGCTCAGG + Intronic
955283100 3:57613206-57613228 CAGGCAAATTGCCTGAGCTCAGG - Intergenic
955700817 3:61680326-61680348 AAGGGAGAGGGCCTCATCTCAGG + Intronic
958418740 3:93907190-93907212 GAGGGAAAGTGCATGCTGACTGG - Intronic
958653687 3:96973731-96973753 CAGGGAAATTGCCTGAACCCGGG + Intronic
960488336 3:118279881-118279903 GGTGGAAAGAGCTTGATCTCAGG - Intergenic
961135967 3:124511610-124511632 GAGGGAAGGGGCCTGCTCACTGG - Intronic
961180306 3:124871244-124871266 GAGTGCAATGGCCTGATCTCAGG + Intronic
961619382 3:128211741-128211763 CAGGCAAATTGCCTGAACTCAGG - Intronic
962204287 3:133422460-133422482 GAGGGAGAGGGCTTCATCTCAGG - Intronic
964763806 3:160159028-160159050 GAGGGGTAGTGACTGATCCCTGG - Intergenic
965305448 3:167058737-167058759 GAAGGAACTTGCCTGGTCTCAGG - Intergenic
966347620 3:178997028-178997050 GAGGCAAAACTCCTGATCTCAGG - Intergenic
966920446 3:184607808-184607830 CAGGCAAATTGCCTGAGCTCAGG - Intronic
967444343 3:189548189-189548211 GAGGAAAAGTTCCTGCTTTCTGG + Intergenic
968267255 3:197371663-197371685 GAGGGGATCTGCCTGTTCTCTGG + Intergenic
969460344 4:7325747-7325769 GAGGGAAGGTCCCAGAGCTCAGG - Intronic
970961396 4:21875211-21875233 GTGGGAAAGGGCATGAACTCAGG - Intronic
974778095 4:66514287-66514309 CAGAAAAACTGCCTGATCTCAGG - Intergenic
974779527 4:66535448-66535470 GAGGGAAAGTGCTTTAGTTCTGG + Intergenic
974817890 4:67029474-67029496 GAGGAAGAGTGCCTGAACACTGG + Intergenic
975607908 4:76174173-76174195 GAGGGAAACTGCCTGGGCTCAGG - Exonic
977268943 4:94890740-94890762 GAGAGACAGTGCATGCTCTCTGG + Intronic
978275324 4:106942362-106942384 GAGGGAAAGTGACTTAAATCTGG - Intronic
978590421 4:110318184-110318206 GAGGTAAAATGCCTGATTTATGG + Intergenic
980405485 4:132349753-132349775 TAGGGAAAGTACCAGTTCTCAGG - Intergenic
980431740 4:132708700-132708722 CAGGCAAATTGCCTGAACTCAGG - Intergenic
980433487 4:132737301-132737323 GAGGGAAACCACCTGATTTCAGG + Intergenic
981439614 4:144768419-144768441 CAGGCAAACTGCCTGAGCTCAGG - Intergenic
982472402 4:155808904-155808926 GAGGGAAAGAGCCTGGTTTAAGG + Intergenic
982921842 4:161285484-161285506 GAGGGTAAGTGCCTAGTCTGAGG - Intergenic
983031126 4:162803163-162803185 GATGCAAATTGCCTGAGCTCAGG - Intergenic
983904078 4:173167339-173167361 GAGGCAGATTGCCTGAGCTCAGG + Intergenic
984845259 4:184103003-184103025 GAGGCACAGTCCCTGATCTCAGG - Intronic
985701356 5:1375069-1375091 GAGGGAAAATCTCTGATCTAAGG - Intergenic
985731312 5:1550541-1550563 GACGGAAACAGCCTGATCCCAGG - Intergenic
987159013 5:15120683-15120705 CATGGACAGTCCCTGATCTCTGG - Intergenic
989176000 5:38526940-38526962 GAGGGAAGGAGCCTGAATTCTGG + Intronic
990023750 5:51160052-51160074 CAGGGAAAGTGCCTGCTGACTGG - Intergenic
990215307 5:53525003-53525025 AAGGGAAAGTCCTGGATCTCAGG - Intergenic
992097367 5:73375550-73375572 GATGGACAGTGCTTGATTTCTGG - Intergenic
996093774 5:119377057-119377079 CAGGCAAAGTGCCTACTCTCAGG - Intronic
996786064 5:127237764-127237786 GAGGGAAAGTCCCACATCCCTGG - Intergenic
997334769 5:133099220-133099242 CAGGGGAACTGCCTGAACTCAGG - Intronic
999702222 5:154238627-154238649 GAAGGCAAGTCCCTGCTCTCTGG + Intronic
1000807130 5:165809834-165809856 GAGGGCAAGTGCTAGAGCTCAGG - Intergenic
1000903008 5:166931394-166931416 CAGGCAAATTGCCTGAGCTCAGG - Intergenic
1001227753 5:169960012-169960034 GAGGCAGAGTGTCGGATCTCAGG + Intronic
1001268753 5:170295052-170295074 GAGGGAAAGAGGCTGGTCTAAGG + Intronic
1001635559 5:173207614-173207636 GAGGGATGGTGCCAGATTTCTGG + Intergenic
1001772486 5:174306575-174306597 GTGAGACAGTGCCTGAGCTCTGG - Intergenic
1002293170 5:178213318-178213340 GAGGCAAGGTGCCTGTTCTGTGG - Intronic
1002852394 6:1008020-1008042 GAGGGTAAGGGCCTGTGCTCAGG + Intergenic
1004155390 6:13162869-13162891 GAGGCACAGCGCCTGCTCTCAGG - Intronic
1006036077 6:31213405-31213427 CAGGCAAATTGCCTGAGCTCAGG + Intergenic
1006894584 6:37459085-37459107 TAATGAAACTGCCTGATCTCTGG + Intronic
1008004078 6:46391487-46391509 TAGGGCAAGAGCCTGTTCTCAGG + Intronic
1009167387 6:60357319-60357341 GAGGGCAATGGCGTGATCTCAGG + Intergenic
1009595091 6:65725657-65725679 GAGGGTAATTGTCTAATCTCTGG - Intergenic
1010188313 6:73167489-73167511 GAGGGTAAGTACCTCATCTGAGG - Intronic
1010386688 6:75288623-75288645 GAAGCCAAGTGCCTGAGCTCAGG - Intergenic
1013647860 6:112163205-112163227 GGGGGAAAGTGCTTGAACCCAGG - Intronic
1014241482 6:119022645-119022667 CAGGGAGACTGCCTGAGCTCAGG + Intronic
1014850886 6:126338470-126338492 AGGGGAAAGGGCTTGATCTCGGG + Intergenic
1015518979 6:134112959-134112981 GAGGGACAGTGGCTGAGCTGGGG - Intergenic
1017155148 6:151316219-151316241 GAGGAAAACTACCTGATATCAGG - Intronic
1017382314 6:153844893-153844915 GGTGGAAAGTGCTTGAGCTCAGG - Intergenic
1017698768 6:157046901-157046923 GAGGGAAAGTGACTTATTTTAGG + Intronic
1017905690 6:158756326-158756348 GAGGGACGGTGCCTGTGCTCAGG - Intronic
1018686808 6:166309595-166309617 GAGGGAAAGTGCCTGTGAGCTGG - Intergenic
1020068918 7:5212624-5212646 TAGGAAGAGTGCCTGATCCCAGG - Intronic
1020405573 7:7829951-7829973 GAAGATAAGGGCCTGATCTCTGG - Intronic
1023501398 7:40853590-40853612 GAGGCAGATTGCCTGAGCTCAGG - Intronic
1024062242 7:45707981-45708003 GAGGGAAATTGCCTACTCCCTGG + Intronic
1024508029 7:50179541-50179563 GAGGAAAGCTGCCTGAGCTCAGG - Intergenic
1025036257 7:55594165-55594187 GAGGGACAGTGGCTGTGCTCAGG + Intergenic
1025135515 7:56408502-56408524 GAGGGCAATGGCGTGATCTCAGG - Intergenic
1026288918 7:68988322-68988344 GAGGGAAATTGGCTTTTCTCAGG - Intergenic
1027143839 7:75680269-75680291 GCGGGCAATTGCCTGAGCTCAGG - Intronic
1027193302 7:76010634-76010656 GTGGGAAAGTGCCTGCTCTCTGG - Intronic
1028192519 7:87869296-87869318 GAGGCAAACTGCTTGACCTCAGG + Intronic
1028484988 7:91347937-91347959 GAGGGACAGTTCTTGAGCTCTGG - Intergenic
1029972907 7:104806809-104806831 GAGGGAAAGTGCCTGATCTCAGG - Intronic
1030354023 7:108523352-108523374 GAGGGAAAGCTCCTTATCTGAGG + Intronic
1030913681 7:115285117-115285139 GAGGGTAAATGGCTGATCTTTGG - Intergenic
1031141019 7:117943827-117943849 CAGGCAAACTGCCTGAGCTCAGG - Intergenic
1033054419 7:138036657-138036679 CAGGCAAATTGCCTGAACTCAGG - Intronic
1033090796 7:138384302-138384324 GAGGTAGATTGCTTGATCTCAGG + Intergenic
1033785177 7:144721733-144721755 GAGGGGAATTGCTTGAACTCGGG - Intronic
1034747493 7:153536053-153536075 AAGGAGAAGTGCCTGATCTTAGG - Intergenic
1034826586 7:154270762-154270784 GAGTACAAGTGCCTGGTCTCTGG + Intronic
1035607908 8:941085-941107 CTGGGAAAGGGCCTGTTCTCTGG - Intergenic
1038055529 8:23854134-23854156 GAGGGTACGTGCCAGATTTCAGG + Intronic
1039431746 8:37530255-37530277 GTGGCAACGTGCCTGAGCTCAGG - Intergenic
1040097692 8:43462962-43462984 AAGGGACAGTGACTGATTTCAGG + Intergenic
1042716865 8:71783705-71783727 GAGGGCTAGTGCCTGCTCTGTGG - Intergenic
1047175125 8:122533439-122533461 GAGACAAAGTGTCTGTTCTCAGG - Intergenic
1049549025 8:143247910-143247932 GAGGGGAATTGCCTGAACCCAGG - Intronic
1049652179 8:143775667-143775689 GAGGAGAAGTGCTTGAACTCAGG + Intergenic
1049837239 8:144744626-144744648 GAGAGAAAGTGCAAGTTCTCTGG - Intronic
1050206596 9:3202868-3202890 GAGGGAAAGTACCTGAGGACAGG - Intergenic
1050669107 9:7976362-7976384 GAGGGAAAGTGACTTATTTAAGG + Intergenic
1052303776 9:26982506-26982528 GAGTGCAATGGCCTGATCTCTGG + Intronic
1053091440 9:35281435-35281457 GAATGAAAGTCCCTGACCTCAGG + Intronic
1054929432 9:70620268-70620290 AAGGGGAAGTGGTTGATCTCAGG + Exonic
1055528365 9:77158118-77158140 AAGTCAAAGTGCCTGCTCTCAGG - Intergenic
1055565120 9:77560541-77560563 CAGGCAAACTGCCTGAGCTCAGG - Intronic
1056977174 9:91268655-91268677 GAGGTAGATTGCCTGAGCTCAGG - Intronic
1057519654 9:95751377-95751399 GAGGGATAGAGCCTGAGCTGTGG + Intergenic
1057519842 9:95751964-95751986 GAGGGAGGGAGCCTGAGCTCCGG + Intergenic
1057620064 9:96626859-96626881 GAGGAAGACTGCCTGAGCTCAGG - Intergenic
1058247166 9:102641774-102641796 CAGGCAAATTGCCTGAGCTCAGG - Intergenic
1058946717 9:109863985-109864007 CAGGGAAATTGCTTGAACTCAGG + Intronic
1059527044 9:115001697-115001719 GAGGTCAAGTACCTGTTCTCTGG - Intergenic
1059835560 9:118148190-118148212 TAGAGAAAGTGTCTGATATCTGG - Intergenic
1059840411 9:118209304-118209326 GAGGGAAAGTCTCAGATTTCAGG - Intergenic
1060556528 9:124510795-124510817 GAGGGGAAGTGACTGGTCCCAGG - Intergenic
1060662923 9:125414833-125414855 GAGGGCAGGGGCGTGATCTCAGG + Intergenic
1061118940 9:128631405-128631427 GAGTGCAATGGCCTGATCTCGGG - Intronic
1187192021 X:17044269-17044291 GAGGGAAAGGGCGTGTTCTAGGG + Intronic
1189012322 X:37059027-37059049 GAGAGAAAGAGCATGCTCTCTGG + Intergenic
1189036392 X:37497225-37497247 GAGAGAAAGAGCATGCTCTCTGG - Intronic
1189771968 X:44436251-44436273 AAGGGAAAGAGCCTGAACTTAGG - Intergenic
1190749239 X:53346625-53346647 GAGGGAAAATGGCATATCTCTGG - Intergenic
1192151893 X:68717826-68717848 GAGGGAATGTGCCTGGTTTGTGG - Exonic
1200037009 X:153337945-153337967 GAGTGAAAGTGCCTCACTTCAGG + Intronic
1200782912 Y:7232812-7232834 GATGGAAACTGCCTGTTCTTGGG - Intergenic