ID: 1029973193

View in Genome Browser
Species Human (GRCh38)
Location 7:104809439-104809461
Sequence AGTGCCTCAAAGGCAGAACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029973193_1029973198 9 Left 1029973193 7:104809439-104809461 CCACGTTCTGCCTTTGAGGCACT 0: 1
1: 0
2: 0
3: 7
4: 124
Right 1029973198 7:104809471-104809493 TACAGGACAGATTTTCTATTAGG 0: 1
1: 0
2: 0
3: 15
4: 175
1029973193_1029973196 -8 Left 1029973193 7:104809439-104809461 CCACGTTCTGCCTTTGAGGCACT 0: 1
1: 0
2: 0
3: 7
4: 124
Right 1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG 0: 1
1: 0
2: 1
3: 9
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029973193 Original CRISPR AGTGCCTCAAAGGCAGAACG TGG (reversed) Intronic
900699012 1:4032427-4032449 AGTGCCTCAAAATAAGAACACGG - Intergenic
900844822 1:5088838-5088860 ACTGCCTCAGAGGCAGCAGGGGG - Intergenic
906130136 1:43450946-43450968 AGTGCTTCAAAGGCAGAGCTGGG - Exonic
909753011 1:79187920-79187942 AGTGCAGAAAAGGCAGAAAGTGG - Intergenic
913501088 1:119473378-119473400 AGGGCCTCAAGGCCAGAATGTGG - Intergenic
913516358 1:119608814-119608836 AGGGCCTCAAGGCCAGAATGTGG - Intergenic
914450454 1:147786948-147786970 AGTTGCTCAAAGGCAGAGCATGG + Intergenic
915190742 1:154148289-154148311 AGTGACTAAAAGGCTGAACATGG + Intronic
922774778 1:228209581-228209603 GGTTCCCCAAAAGCAGAACGGGG - Intronic
922857794 1:228790079-228790101 ACTGCCTCAGAGGCTGAAAGTGG - Intergenic
923892728 1:238234126-238234148 AGTGTCTCAAAGGAAGCACCAGG - Intergenic
924093552 1:240526637-240526659 ATTGCCTCAAAGACAGATGGGGG - Intronic
1063014543 10:2063013-2063035 AGTCCATCAAAGTCAGAACAAGG - Intergenic
1067742118 10:48903386-48903408 AGTGGGTCAAAGGCAGAAGCTGG + Intronic
1068963765 10:62891521-62891543 CGTCCCTCAAAGTCAGAACACGG - Intronic
1069288498 10:66746604-66746626 ATTTCCTCAAATGCAGAATGGGG - Intronic
1070321302 10:75356722-75356744 AGGGCCTCAATGGGAGAACCTGG - Intergenic
1070390593 10:75967157-75967179 AGTGCCACAAAGGAGGGACGAGG - Intronic
1071846098 10:89522704-89522726 AGTGACTAAGAGGCAGAACCAGG - Intronic
1072464992 10:95655359-95655381 AGTGCCTAAAAGACAAAAGGAGG - Intronic
1077027924 11:449989-450011 AGCGCCCCAAAAGGAGAACGGGG + Intronic
1080153152 11:29076890-29076912 AGTGCCCCAATGGCAGAAGTGGG - Intergenic
1080869503 11:36225218-36225240 ACTGCCTCACAGGCAGAACAAGG + Intronic
1081673105 11:44952667-44952689 AGTGCCAGAAAGGCAGAAGAGGG - Intergenic
1082114377 11:48312357-48312379 AGTGGCCCAAAGGCAGCAGGTGG + Intergenic
1083637865 11:64129988-64130010 AGTGCCTCAAAGGCACTGCAGGG + Intronic
1084220345 11:67674126-67674148 AGCTCCTCAAAGGGAGGACGGGG + Intronic
1085747676 11:79129042-79129064 AGTGCCCCAACTGCAGAAGGGGG + Intronic
1088236064 11:107724631-107724653 AGTGCCTCCAATTCAGAATGTGG - Intergenic
1089182110 11:116590286-116590308 TGGGGCTCAAAGGCAGAAAGAGG - Intergenic
1093199865 12:16173492-16173514 AGTGACTCAAAGTGAGTACGAGG + Intergenic
1094717522 12:33027926-33027948 AGTGACTAAAAGGCAGAGTGTGG + Intergenic
1096738714 12:53676459-53676481 AGTGCCTAAAATGCAGCAGGAGG + Intronic
1097491294 12:60273539-60273561 AGATCCTCAAGGGCAGAACACGG - Intergenic
1098119210 12:67217961-67217983 AGTTGCACAAAGACAGAACGCGG + Intergenic
1101013826 12:100478706-100478728 ATTGCCTCTAATGCAGAAAGAGG - Intronic
1102260413 12:111439948-111439970 CATCCCTCAAAGGCAGAAAGTGG - Intronic
1103169255 12:118799544-118799566 AGTGAGACAAAGGCAGAAGGTGG - Intergenic
1107744775 13:43492682-43492704 AGTGTCTCAATGACAGAATGAGG - Intronic
1112343453 13:98571331-98571353 AGAGCATCAAAGTCAGAAAGAGG + Intronic
1116019479 14:39442695-39442717 ATTTCCTCAAAGGCAAAAAGTGG - Intergenic
1118738459 14:68719980-68720002 AGTGACTCAGAGGCAGGAGGAGG - Intronic
1119867792 14:77988586-77988608 AGTGACTCAGAGGCAGAGTGGGG + Intergenic
1119979837 14:79067625-79067647 ACTGCCTCAATTTCAGAACGTGG + Intronic
1122483680 14:102064021-102064043 TCTGCCTCAAAGGAAAAACGTGG + Intergenic
1127703000 15:61519294-61519316 AGTGCCTGAAATGCAAAATGTGG - Intergenic
1127956087 15:63854778-63854800 AGTGCCACACAGCCAGAAAGAGG - Intergenic
1128649153 15:69397864-69397886 AGTGCCACCAAGGCAGCACCTGG - Intronic
1134185566 16:12082433-12082455 ACTTCCTCAAAGACAGAAAGCGG - Intronic
1138280440 16:55768800-55768822 AGCTACTCAAAGGCAGAACCAGG - Intergenic
1144025096 17:11270597-11270619 TGTGCTTCAAGGGCAGAACTGGG - Intronic
1148803283 17:50247215-50247237 AGTTTCTGAAAGGAAGAACGTGG - Intergenic
1154374654 18:13799062-13799084 GTTGCCTGAAAGCCAGAACGTGG - Intergenic
1155061809 18:22235505-22235527 ACTTCCTCAAAGGCAGAATCTGG - Intergenic
1156154195 18:34281978-34282000 AGGGACACAATGGCAGAACGGGG + Intergenic
1156833695 18:41527024-41527046 AGTGACTCAATGGCAGAACAAGG + Intergenic
1156834210 18:41532884-41532906 AGTGCCTCGAGGGCAGGACCTGG - Intergenic
1158485207 18:57860038-57860060 AGTGCCTCAGAGTCAGATCTTGG + Intergenic
1159636099 18:70806776-70806798 AGTTCCTTAAAGGCAGGAGGTGG - Intergenic
1160738380 19:674922-674944 AGTGCCACTAAGGCAGAACTTGG + Intergenic
1161238939 19:3211204-3211226 AGAGCCTCAAACCCAGCACGGGG + Intergenic
1161947784 19:7449062-7449084 AGTTCCTCAAAGCCAGGAGGGGG + Intronic
1166550097 19:43659849-43659871 AGTGACTCAAATGAAGAACTCGG - Intronic
1166984936 19:46654120-46654142 AGTGGACCAAAGGCAGAAGGAGG - Intronic
1167736674 19:51298659-51298681 AAGGCCTCAAAAGCAGAATGGGG - Intergenic
1168368513 19:55810990-55811012 ATTGCCTCAAAGGAAAAACTGGG - Intronic
930486622 2:52018458-52018480 AGTGCCTCAACTGCAGAAGAGGG - Intergenic
935291666 2:101616201-101616223 AGTGACTGAAAGGGAGAATGAGG - Intergenic
936519138 2:113200865-113200887 AGTGCCTCAAAGATGGAACATGG + Intronic
938554831 2:132415574-132415596 TCTGCCTCAAAGGAAGAACATGG - Intergenic
940283544 2:152011287-152011309 AGGACCTCAAAGGAAGAAGGTGG - Intronic
943096883 2:183440130-183440152 ATTACCTAAAAGGCAGAACTTGG + Intergenic
943620411 2:190141874-190141896 ACTGCCTTAAAGTCAGCACGAGG - Intronic
943836180 2:192516632-192516654 AGAGACTCAAAGGCAGACAGGGG + Intergenic
943971843 2:194419790-194419812 AGTGCATCAAGGGCAGAAGTAGG + Intergenic
945049191 2:205807148-205807170 AGTTTCTAAAAGGCAGAACTGGG - Intergenic
946202691 2:218080168-218080190 GGGGCCTCAAAGGCAGAGTGAGG + Intronic
948791862 2:240383377-240383399 AGTGCCTGAAAGACACAACTGGG - Intergenic
1172518642 20:35553421-35553443 AGTGCCTGAAAGGAAGAGCCAGG + Intronic
1174769201 20:53282539-53282561 AGCCCCTCAAGGGCAGAACAGGG + Intronic
1175609894 20:60342151-60342173 AGTGAGTAAAAGGCAGAACTGGG - Intergenic
1175744184 20:61442614-61442636 AGAGACTCAAAGGCAAAACGTGG + Intronic
1176089295 20:63311879-63311901 AGAGCCTCAAGGCCAGCACGCGG - Intronic
1177318146 21:19487761-19487783 AGTGCCTCACCTGCAGAACCTGG - Intergenic
950287479 3:11756171-11756193 AGTGCCTCAAGGGCAGAGAAGGG - Intergenic
958789630 3:98636238-98636260 ACTGCCTGAAAGCCAGAACAAGG + Intergenic
960079815 3:113529552-113529574 AGAGACTCAAAGGCAGGAAGGGG + Intergenic
960823943 3:121762714-121762736 AGTGCCACACAGGCATAAAGAGG - Intergenic
961471869 3:127120211-127120233 AGAGACTCAAAGGCAGACAGTGG + Intergenic
961826617 3:129602461-129602483 CGTGCCGCAAAGGGAGAATGAGG - Intronic
962440871 3:135415115-135415137 AATGGCTCAAAGGCATAACTGGG + Intergenic
965863472 3:173175610-173175632 AGTACCTCAAAAGCAGAAAATGG - Intergenic
974517736 4:62938732-62938754 AGTGCCTCAAAAGCTGATCTAGG - Intergenic
978135903 4:105259302-105259324 AGTGACTGAAAGGCAAAATGAGG + Intronic
979985046 4:127303580-127303602 ACTATCTCAAAGGCAGAAAGAGG - Intergenic
983341039 4:166461387-166461409 TGTGCCTCATGGGCAGAACATGG - Intergenic
986178509 5:5372233-5372255 TGTCCCTCAATGGCAGAACATGG + Intergenic
988714856 5:33815448-33815470 AGTGCCTGCAAGCCAGAAAGAGG + Intronic
990197659 5:53336665-53336687 ATTGCTTCAAATGCAGAAAGAGG - Intergenic
1000296749 5:159918816-159918838 AGTGCCTCAGAGGAAGGACAAGG - Intronic
1001144865 5:169175019-169175041 AATACTTCAAAGGCAGAAGGTGG + Intronic
1003062054 6:2871541-2871563 AGTGAATCAGAGGCAGTACGTGG + Intergenic
1011840219 6:91488346-91488368 AGTGCCTGAATGGAAGAACTTGG + Intergenic
1016573097 6:145536861-145536883 AGTGACTAAAAGGCAGACAGAGG + Intronic
1018023256 6:159782963-159782985 AGTCCCTCAAATGGAGAACAGGG + Intronic
1018090985 6:160347365-160347387 AGTGAGCTAAAGGCAGAACGTGG + Intergenic
1019425224 7:972266-972288 ACAGCCCCAAAGGCAGAACGTGG + Intronic
1019602204 7:1890318-1890340 ATTCCCTCAAAGGCAGTACCAGG - Intronic
1019900875 7:4019905-4019927 AGTCCCTCAAAGGGAGGACGGGG - Intronic
1020641276 7:10757119-10757141 AGTGTCTGAAAGACAGAAAGAGG + Intergenic
1021066547 7:16182695-16182717 AGTGCCTCAAAGTGAGAATTGGG - Intronic
1021292874 7:18867346-18867368 AGTGCATCAAAGAAAGAATGAGG - Intronic
1021925830 7:25532760-25532782 AGTGCCTAGAAGGCAGAGAGTGG + Intergenic
1024616755 7:51121687-51121709 AGTGCCTCAAAGACAGGAATTGG + Intronic
1029973193 7:104809439-104809461 AGTGCCTCAAAGGCAGAACGTGG - Intronic
1034778616 7:153855749-153855771 AGTGCCTCAAGGTCAGACAGAGG + Intergenic
1036764861 8:11543077-11543099 AAGACCTCAAAGTCAGAACGTGG - Intronic
1041628265 8:60055934-60055956 CGTGCCCAAAAGGCAGAACCAGG + Intergenic
1043322524 8:79007437-79007459 ATTAACTCAAAGGCAGAACTGGG + Intergenic
1047040155 8:120984797-120984819 AATGGGTCAAAGGCAGAAGGAGG + Intergenic
1052988256 9:34503293-34503315 AGTGCCTCCATGGGAGAAAGAGG + Intronic
1056756492 9:89385178-89385200 TGATCCTCAAAGGCAGAAGGGGG - Intronic
1059761204 9:117339357-117339379 TGTGCCGCAGAGGCAGAAAGAGG + Intronic
1062121016 9:134834061-134834083 AGTGGCTCAGGGGCAGAAGGAGG + Intronic
1186781042 X:12912342-12912364 TGTGGCTCAAAGGAAGAACTTGG + Intronic
1190635021 X:52424908-52424930 AGGACCTCATAGGCAGAAGGAGG - Intergenic
1191903702 X:66065000-66065022 AGTCCCCCAAAGGCAGAAGTGGG - Intergenic
1192039089 X:67598250-67598272 AGTGCCACAAAAGCAGTAAGAGG - Intronic
1197042329 X:121953070-121953092 AATATCTCAAAGGCAAAACGAGG - Intergenic
1198058919 X:133024011-133024033 ACTGCCTCAAAGGCAGGAAAAGG + Intergenic
1199057987 X:143319739-143319761 AGTGCCCCAAATGCAGAAGTGGG - Intergenic
1200474188 Y:3624337-3624359 TGTACCTCAAAGACAGAACCAGG + Intergenic