ID: 1029973196

View in Genome Browser
Species Human (GRCh38)
Location 7:104809454-104809476
Sequence GAGGCACTCAACCTGGATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 62}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029973191_1029973196 -4 Left 1029973191 7:104809435-104809457 CCATCCACGTTCTGCCTTTGAGG 0: 1
1: 1
2: 2
3: 18
4: 257
Right 1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG 0: 1
1: 0
2: 1
3: 9
4: 62
1029973193_1029973196 -8 Left 1029973193 7:104809439-104809461 CCACGTTCTGCCTTTGAGGCACT 0: 1
1: 0
2: 0
3: 7
4: 124
Right 1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG 0: 1
1: 0
2: 1
3: 9
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029973196 Original CRISPR GAGGCACTCAACCTGGATAC AGG Intronic
901184324 1:7362705-7362727 GAGGCAGTGAACTTGGATAGAGG + Intronic
903136994 1:21315909-21315931 GAGTCAGTCAACCTGGGTACCGG + Intronic
903674858 1:25057047-25057069 GAAGCATTCAACCTGGCTCCTGG - Intergenic
905225175 1:36474011-36474033 GAGCCACTCTGCCTGGAGACAGG - Intronic
921001329 1:211046693-211046715 GAGGTACTCAGCCTGGAACCTGG - Intronic
1067221635 10:44348152-44348174 AAGGCACTGAACCTGGACATAGG + Intergenic
1071491521 10:86139637-86139659 GAGTCACTCCAGCTGGAAACAGG - Intronic
1077513433 11:2984900-2984922 GAGATACTCAACCTGTATAAAGG - Intronic
1078549338 11:12269612-12269634 GAAGCCCTCATCCTGGACACTGG - Intergenic
1080313678 11:30924364-30924386 GAGGCCCTGAACCTAAATACTGG - Intronic
1080360632 11:31509540-31509562 GAGACCCTCAACCAGGACACAGG + Exonic
1080636449 11:34128069-34128091 GAGCCACTGCACCTGGCTACAGG - Intronic
1091931112 12:4396056-4396078 GAGGCACTCAACTCTGAGACCGG - Intergenic
1096711696 12:53461996-53462018 GATGCACCCAACCTGGAAACTGG + Intronic
1097827979 12:64194126-64194148 GAGACACTACAGCTGGATACTGG + Exonic
1097915090 12:65012869-65012891 GAAGCACTCAACTTGGCAACAGG + Intergenic
1098889851 12:75998571-75998593 GAGGCAATTAACCTGAACACAGG + Intergenic
1102252464 12:111396961-111396983 GAGGCATCCAACCTGGAGCCTGG + Intergenic
1105624442 13:22099328-22099350 GAGGCACTGAATGTGAATACAGG - Intergenic
1112691349 13:101898306-101898328 GAGATACTCAACCTGTATAAAGG + Intronic
1120031725 14:79649284-79649306 GAGGCACTTACCCCGGATCCTGG - Intronic
1123020930 14:105397635-105397657 GAGGCACTGAACCAGGACACTGG - Exonic
1127783464 15:62335856-62335878 GAGGCACTGCACCTGGCTTCAGG - Intergenic
1128525965 15:68412471-68412493 CAGGCACCCAACATGGATTCTGG + Intronic
1128888276 15:71308103-71308125 CAGGCATTCACCCTGAATACTGG + Intronic
1132883386 16:2172061-2172083 GAGGCACGCAACATGGGAACGGG - Intronic
1142013133 16:87727150-87727172 GACGCAATCTACCTGGAGACAGG + Intronic
1156488542 18:37482379-37482401 GAGTCACTCTGCCTGGATTCTGG + Intronic
1158619889 18:59023752-59023774 GAGGCAATCTACCTGGTCACAGG + Intergenic
1160510934 18:79452906-79452928 GAGGCATTCAGCCTTGATAATGG + Intronic
1161601864 19:5189015-5189037 GAGACACTCAGCCTGGAGCCTGG + Intronic
1163988005 19:20970978-20971000 GAGCCACATAACCTGGATGCTGG - Intergenic
1165439789 19:35818614-35818636 GAGGCACACAACCTGGATTGGGG + Intergenic
1167178497 19:47883128-47883150 GGGGCAGTCAACCTGGATACAGG + Intronic
1167421088 19:49403774-49403796 AAGGCACTCAACCTGGCAGCAGG - Intronic
925084775 2:1099506-1099528 AGGGCACTCTACCTGCATACTGG - Intronic
940365445 2:152843713-152843735 GAGGCACTCAACCTAGATCAAGG - Intergenic
946413126 2:219525675-219525697 GAGGCTTTGAACCTGGATACTGG + Intronic
946591285 2:221250834-221250856 GAGTCCATCAACCTGGAAACAGG - Intergenic
1171818772 20:29813166-29813188 GAGGAACTCAAGCAGGATATGGG - Intergenic
1171899024 20:30839858-30839880 GAGGAACTCAAGCTGGATATGGG + Intergenic
1175223896 20:57433751-57433773 GAGCCAGTCAAGCTGGAGACAGG + Intergenic
953055740 3:39385827-39385849 GAGGCACTGAACTTGGACATGGG + Intronic
958608736 3:96395582-96395604 GAGGAAATCAGCCTTGATACTGG - Intergenic
961714649 3:128850046-128850068 GAGGCACTCGACCTGCCCACGGG - Intergenic
971975813 4:33684837-33684859 GATGCACTCTATCTAGATACAGG + Intergenic
972361495 4:38329560-38329582 CAGACACTCAAGCTGGATAACGG - Intergenic
979154429 4:117365233-117365255 GAGGCAGTCAACTTTGCTACTGG + Intergenic
982567357 4:157002473-157002495 GAGGAACTCAAACTGGATTAGGG - Intergenic
986802499 5:11276706-11276728 GAGGAAATCATCCTGGATTCAGG + Intronic
1002023822 5:176383508-176383530 GAGGCCCCCAACCTGGCTTCTGG - Intronic
1003504571 6:6729174-6729196 GAGGCACTGCGCATGGATACTGG - Intergenic
1004843520 6:19613738-19613760 GAGCAGCTCAACCTGGATCCTGG + Intergenic
1007239896 6:40417298-40417320 GAGGCACTGAGCATGGAGACAGG - Intronic
1018780963 6:167064985-167065007 TAGACACTTACCCTGGATACGGG - Intergenic
1021550951 7:21870269-21870291 AAGGCACCGAGCCTGGATACTGG - Intronic
1022548602 7:31213242-31213264 GATGAATTCAACCTGGATTCAGG + Intergenic
1024986852 7:55201653-55201675 GAGGCACACCACCTGCATTCAGG + Intronic
1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG + Intronic
1040383205 8:46893076-46893098 GAGTCACAGAACCTGGATGCTGG + Intergenic
1045875864 8:106979930-106979952 GAGGCATTTAACCTTGATACTGG + Intergenic
1049025914 8:139988738-139988760 GAGGCACTCATCCTGCACGCCGG - Exonic
1056499065 9:87190179-87190201 GAGTCACTGCACCTGGACACAGG - Intergenic
1059395274 9:114030508-114030530 GAGACACTGAAGCTGGAGACCGG - Intronic
1059618607 9:115978204-115978226 GAGGCAATCCAACTGGAAACAGG - Intergenic
1203370436 Un_KI270442v1:298432-298454 GAGGAACTCAAGCAGGATATGGG - Intergenic
1189573123 X:42320900-42320922 GTGGGGCTCAACCTGGTTACAGG + Intergenic
1200854864 Y:7926579-7926601 GAGTCACACAACCTAGATGCTGG + Intergenic
1200859437 Y:7974719-7974741 GAGTCACACAACCTGAGTACTGG + Intergenic
1200862815 Y:8010891-8010913 GAGTCACACTACCTGGATACTGG + Intergenic
1202252213 Y:22885015-22885037 GAGTCACTTCACCTGGCTACTGG + Intergenic
1202405202 Y:24518764-24518786 GAGTCACTTCACCTGGCTACTGG + Intergenic
1202465578 Y:25151318-25151340 GAGTCACTTCACCTGGCTACTGG - Intergenic