ID: 1029973421

View in Genome Browser
Species Human (GRCh38)
Location 7:104811486-104811508
Sequence TCACTTAGAGCTAGTCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 204}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029973421_1029973426 10 Left 1029973421 7:104811486-104811508 CCACCATGACTAGCTCTAAGTGA 0: 1
1: 0
2: 2
3: 9
4: 204
Right 1029973426 7:104811519-104811541 GGAGGTCAGTCAAGAGAGCAAGG 0: 1
1: 0
2: 2
3: 27
4: 283
1029973421_1029973427 14 Left 1029973421 7:104811486-104811508 CCACCATGACTAGCTCTAAGTGA 0: 1
1: 0
2: 2
3: 9
4: 204
Right 1029973427 7:104811523-104811545 GTCAGTCAAGAGAGCAAGGATGG 0: 1
1: 0
2: 2
3: 20
4: 258
1029973421_1029973424 -8 Left 1029973421 7:104811486-104811508 CCACCATGACTAGCTCTAAGTGA 0: 1
1: 0
2: 2
3: 9
4: 204
Right 1029973424 7:104811501-104811523 CTAAGTGAGATTCCTAATGGAGG 0: 1
1: 0
2: 0
3: 6
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029973421 Original CRISPR TCACTTAGAGCTAGTCATGG TGG (reversed) Intronic