ID: 1029973422

View in Genome Browser
Species Human (GRCh38)
Location 7:104811489-104811511
Sequence ATCTCACTTAGAGCTAGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029973422_1029973426 7 Left 1029973422 7:104811489-104811511 CCATGACTAGCTCTAAGTGAGAT No data
Right 1029973426 7:104811519-104811541 GGAGGTCAGTCAAGAGAGCAAGG 0: 1
1: 0
2: 2
3: 27
4: 283
1029973422_1029973427 11 Left 1029973422 7:104811489-104811511 CCATGACTAGCTCTAAGTGAGAT No data
Right 1029973427 7:104811523-104811545 GTCAGTCAAGAGAGCAAGGATGG 0: 1
1: 0
2: 2
3: 20
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029973422 Original CRISPR ATCTCACTTAGAGCTAGTCA TGG (reversed) Intronic