ID: 1029973422 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:104811489-104811511 |
Sequence | ATCTCACTTAGAGCTAGTCA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1029973422_1029973426 | 7 | Left | 1029973422 | 7:104811489-104811511 | CCATGACTAGCTCTAAGTGAGAT | No data | ||
Right | 1029973426 | 7:104811519-104811541 | GGAGGTCAGTCAAGAGAGCAAGG | 0: 1 1: 0 2: 2 3: 27 4: 283 |
||||
1029973422_1029973427 | 11 | Left | 1029973422 | 7:104811489-104811511 | CCATGACTAGCTCTAAGTGAGAT | No data | ||
Right | 1029973427 | 7:104811523-104811545 | GTCAGTCAAGAGAGCAAGGATGG | 0: 1 1: 0 2: 2 3: 20 4: 258 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1029973422 | Original CRISPR | ATCTCACTTAGAGCTAGTCA TGG (reversed) | Intronic | ||