ID: 1029973424

View in Genome Browser
Species Human (GRCh38)
Location 7:104811501-104811523
Sequence CTAAGTGAGATTCCTAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 93}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029973415_1029973424 23 Left 1029973415 7:104811455-104811477 CCTCCCAAAGTGTTGGGATTGCA No data
Right 1029973424 7:104811501-104811523 CTAAGTGAGATTCCTAATGGAGG 0: 1
1: 0
2: 0
3: 6
4: 93
1029973421_1029973424 -8 Left 1029973421 7:104811486-104811508 CCACCATGACTAGCTCTAAGTGA 0: 1
1: 0
2: 2
3: 9
4: 204
Right 1029973424 7:104811501-104811523 CTAAGTGAGATTCCTAATGGAGG 0: 1
1: 0
2: 0
3: 6
4: 93
1029973418_1029973424 19 Left 1029973418 7:104811459-104811481 CCAAAGTGTTGGGATTGCAGGCA No data
Right 1029973424 7:104811501-104811523 CTAAGTGAGATTCCTAATGGAGG 0: 1
1: 0
2: 0
3: 6
4: 93
1029973417_1029973424 20 Left 1029973417 7:104811458-104811480 CCCAAAGTGTTGGGATTGCAGGC No data
Right 1029973424 7:104811501-104811523 CTAAGTGAGATTCCTAATGGAGG 0: 1
1: 0
2: 0
3: 6
4: 93
1029973413_1029973424 29 Left 1029973413 7:104811449-104811471 CCTCTGCCTCCCAAAGTGTTGGG No data
Right 1029973424 7:104811501-104811523 CTAAGTGAGATTCCTAATGGAGG 0: 1
1: 0
2: 0
3: 6
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029973424 Original CRISPR CTAAGTGAGATTCCTAATGG AGG Intronic