ID: 1029973427

View in Genome Browser
Species Human (GRCh38)
Location 7:104811523-104811545
Sequence GTCAGTCAAGAGAGCAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 258}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029973422_1029973427 11 Left 1029973422 7:104811489-104811511 CCATGACTAGCTCTAAGTGAGAT No data
Right 1029973427 7:104811523-104811545 GTCAGTCAAGAGAGCAAGGATGG 0: 1
1: 0
2: 2
3: 20
4: 258
1029973421_1029973427 14 Left 1029973421 7:104811486-104811508 CCACCATGACTAGCTCTAAGTGA 0: 1
1: 0
2: 2
3: 9
4: 204
Right 1029973427 7:104811523-104811545 GTCAGTCAAGAGAGCAAGGATGG 0: 1
1: 0
2: 2
3: 20
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029973427 Original CRISPR GTCAGTCAAGAGAGCAAGGA TGG Intronic