ID: 1029974037

View in Genome Browser
Species Human (GRCh38)
Location 7:104815890-104815912
Sequence TCTTCAAAGGGGAAAGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 386}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029974037_1029974047 -4 Left 1029974037 7:104815890-104815912 CCTCCCCCTTTCCCCTTTGAAGA 0: 1
1: 0
2: 1
3: 37
4: 386
Right 1029974047 7:104815909-104815931 AAGAATGAGGGATTCATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029974037 Original CRISPR TCTTCAAAGGGGAAAGGGGG AGG (reversed) Intronic
900591664 1:3462984-3463006 TATGCAAAGGGGTAGGGGGGTGG + Intronic
901004372 1:6164793-6164815 TCTTGGAAGGGGAAGGGGGCTGG - Intronic
901260050 1:7864691-7864713 TCTTCTTAGGGGAAAGGAGACGG - Intergenic
902679067 1:18030422-18030444 TCCTCAAAGGGGATAGTGGCAGG + Intergenic
903138479 1:21324584-21324606 TCTTCATGTGGGAAAGGGGCGGG - Intronic
903257339 1:22111705-22111727 GCTTCAACTGGGAAAGAGGGAGG - Intergenic
904008864 1:27378710-27378732 TCTGTAAAGGGGCAAGGGGTGGG + Intergenic
907673667 1:56499080-56499102 TCTTGAAGGGGGGAAGGTGGGGG - Intronic
909167721 1:72249725-72249747 TTTTGAAAGGAGAAAGAGGGAGG + Intronic
909582949 1:77258691-77258713 TTTCCAAAGGGAAATGGGGGAGG + Intergenic
912554999 1:110509303-110509325 TCTTGAAAGGGGAATAGGGATGG + Intergenic
914448886 1:147773429-147773451 GATTCAGAGGGGAAAAGGGGTGG - Intergenic
914746380 1:150504610-150504632 CCTTGAAAGGAAAAAGGGGGGGG - Exonic
914855436 1:151346974-151346996 TCTGCAAAGTGGAGCGGGGGTGG + Intronic
915166069 1:153948444-153948466 TCCTCACAGGTGAATGGGGGTGG - Exonic
915843421 1:159236907-159236929 TTTTTAAAGGGTAAAGGGGCTGG + Intergenic
915927938 1:160038468-160038490 TCTGGAAATGGGAAAGGGAGGGG - Exonic
916417956 1:164610280-164610302 GCTTCAAAGGTGAGAAGGGGAGG - Intronic
916440552 1:164820479-164820501 TCACCAAAGGGAAAAGGAGGAGG + Intronic
916718378 1:167463449-167463471 TTTTAAAAGGAGAAAGGGAGAGG + Intronic
917794105 1:178520663-178520685 TCTTCTAAGGGGACTGGGGGAGG - Exonic
918093744 1:181318026-181318048 TTTTAAAAGGGGAAAGGGGTGGG - Intergenic
918913734 1:190607936-190607958 TGATCCAAGGGGAATGGGGGTGG + Intergenic
919493783 1:198238335-198238357 TTTTCAGAGGGGCAAGGGGCGGG + Intronic
920495239 1:206450030-206450052 TTTTCAAAGGGGAAGCAGGGTGG - Intronic
920701935 1:208224510-208224532 GATTTAAAGGGAAAAGGGGGAGG + Intronic
922031976 1:221810022-221810044 ATTCCCAAGGGGAAAGGGGGTGG + Intergenic
922778277 1:228227724-228227746 TCTTCACAGTGGAAGGGGTGAGG + Intronic
923088491 1:230720403-230720425 TGGACAAAGGGGAAAGGGGTAGG - Intergenic
923412201 1:233721699-233721721 TCTTCATAGGAGAAGGGGTGAGG + Intergenic
923707355 1:236354996-236355018 TCTTCAAAGAGGGAAAGGGCAGG - Intronic
924715370 1:246567844-246567866 TTTTTTAAGGGGAGAGGGGGAGG - Intronic
1064225260 10:13478060-13478082 TCTTTATAGGGGAGAGGGGAGGG + Intronic
1064535641 10:16354888-16354910 AATTTAAAGGGGAAAGGGCGGGG - Intergenic
1065023384 10:21518683-21518705 TTTCCAAAAGGAAAAGGGGGTGG - Exonic
1067250920 10:44586694-44586716 TCTTCAAAGGGCACATGGGTGGG - Intergenic
1067323422 10:45244102-45244124 GCTACAAAGTGGAAAGGCGGGGG - Intergenic
1067809530 10:49416572-49416594 TCTTCAAAGGGGAAAATGATTGG + Intergenic
1068244277 10:54343374-54343396 ACAGCAAAAGGGAAAGGGGGAGG - Intronic
1068319592 10:55394059-55394081 TCTTCAAAGAGGGAAGGGGCTGG - Intronic
1068362191 10:55991464-55991486 AATTCAAAGGGGAATGGAGGTGG - Intergenic
1068392715 10:56419335-56419357 TCTTTAAAGGAGAAAAGAGGAGG - Intergenic
1068539319 10:58273389-58273411 TCTTCTATGAGGAGAGGGGGAGG - Intronic
1068636349 10:59352288-59352310 TCTTCAAAGCGGAGAGCGGGAGG - Exonic
1068864953 10:61885032-61885054 TCTTCAAAAGGGAGAGAGGCAGG - Intergenic
1068994820 10:63190693-63190715 TTTTCCAAGGTGAAAGGTGGAGG - Intronic
1069542526 10:69306054-69306076 TATTTAAAGAGGAAAGGGTGGGG + Intronic
1070050079 10:72880163-72880185 TCTTCAAAGGTGAATAGGAGCGG - Intronic
1070310056 10:75266432-75266454 CATTCAAAGGTGAAAGAGGGAGG - Intergenic
1070760084 10:79018688-79018710 CCTTCCAAGGGGAATGGGGTGGG + Intergenic
1070807681 10:79279950-79279972 CGTGCAAAGGGGAGAGGGGGAGG + Intronic
1072340447 10:94443220-94443242 CCTTCAAAAGGGAAAGGGAGGGG - Intronic
1073216459 10:101839525-101839547 TCTTCAAAGAGGAAAGGAGAGGG - Intronic
1073476245 10:103755993-103756015 CCTTCAAAAGGGAAGGGAGGAGG - Intronic
1076641762 10:131921506-131921528 CCTGCAAAGGGGAGAGAGGGTGG + Intronic
1077143672 11:1035629-1035651 GCTTCAAAGGAGAGAAGGGGTGG + Intronic
1077659695 11:4056573-4056595 TCAGCAAAGGGGAAAGGGGAAGG + Intronic
1077674864 11:4187129-4187151 TCTTTAAAAGGGAATGGGGAGGG - Intergenic
1077753953 11:5005409-5005431 CCTTAAAAGGGGGAAGGGGGAGG - Intergenic
1078641758 11:13103448-13103470 ACTTCACTGGGGAAAGGGGGTGG - Intergenic
1078896969 11:15605398-15605420 TCTCCAAAGGGCAAAGGGGAAGG - Intergenic
1079386992 11:19989249-19989271 TCCTCAAAAGTGAAAGAGGGAGG + Intronic
1080222679 11:29924240-29924262 ACTTCAAAAGGGCAAGAGGGTGG - Intergenic
1080514631 11:33008733-33008755 TATACAAAGGTAAAAGGGGGTGG + Intergenic
1080657108 11:34266775-34266797 TCTACAGAGGGCACAGGGGGTGG - Intronic
1082064925 11:47892299-47892321 CGTGCAAAGGGGAGAGGGGGAGG - Intergenic
1082942842 11:58726406-58726428 GGTTCAAGGGGGACAGGGGGAGG + Intronic
1083925554 11:65803976-65803998 TCCTCAACGGGGAGAGGCGGAGG - Intergenic
1088814677 11:113412955-113412977 TCTTCAGAGGGGGAAAGGGAGGG - Intronic
1089010823 11:115130261-115130283 TCCCCAAAGGGGAAGTGGGGAGG - Intergenic
1089050763 11:115543776-115543798 TCTTGAAGGGGGAAAGGCTGTGG + Intergenic
1089846619 11:121463856-121463878 TCTTGAAAGGGGACAGTGAGAGG + Intronic
1089940537 11:122411780-122411802 CCTTCAAAGGGTGAAGGGGAAGG + Intergenic
1089941102 11:122418490-122418512 CCTTCAGAGGTCAAAGGGGGGGG + Intergenic
1090247294 11:125225447-125225469 TCTTCAAATGTGAAATGAGGAGG + Intronic
1090623092 11:128579227-128579249 TTTTCAAAGAGGAAAGGCTGGGG - Intronic
1090742894 11:129682166-129682188 GCTAGAAAGGGGAAAGGGGAAGG + Intergenic
1092066177 12:5591281-5591303 GCTTCTTAGGGGAAAGGGTGTGG + Intronic
1092114308 12:5988113-5988135 TGGGCAAAGGGGAAAGGAGGAGG + Intronic
1092485277 12:8897497-8897519 TCCTGATATGGGAAAGGGGGCGG + Intergenic
1092644353 12:10553113-10553135 TCTTCAATGCAGAAAAGGGGTGG - Intergenic
1092878969 12:12873079-12873101 TCTTCAAAGGGAGTAGAGGGTGG - Intergenic
1093151649 12:15628070-15628092 TCAAAAAAGGGGAAAAGGGGAGG + Intronic
1094484052 12:30909967-30909989 TCTTCAATGGGGGATGGGGAAGG + Intergenic
1095851177 12:46808570-46808592 TTTTCAAAGGTGAAAGGCAGAGG - Intronic
1099232960 12:80049285-80049307 TCTTAAAAGGGGGGATGGGGAGG - Intergenic
1099922543 12:88977446-88977468 ACTCCAGAGAGGAAAGGGGGAGG - Intergenic
1100385486 12:94101651-94101673 TCTTCCACGGGGAAAGTAGGAGG + Intergenic
1100566925 12:95805065-95805087 TCTTCAAAGCAGAGAGGGAGAGG + Intronic
1101038340 12:100727818-100727840 TGTTCAAAGGGGTAAGGATGGGG - Intronic
1101338115 12:103814884-103814906 TGTTCTAAGAGGAAAAGGGGAGG + Intronic
1101589482 12:106113128-106113150 TCTTTGAAGGGGAGAGGGGTGGG - Intronic
1103428715 12:120862790-120862812 TCTGCAGAGGGGAGAGGGGTTGG - Intronic
1103578359 12:121895705-121895727 TCTTTATAGGTGAAAGAGGGAGG - Intronic
1104265572 12:127229338-127229360 TCTTCAAAGGTGAGATGTGGAGG + Intergenic
1104371041 12:128224240-128224262 TCTTCAAGGAGGGAAGGGGCAGG - Intergenic
1104687486 12:130797186-130797208 TTTACAAAGGGGGAAGGTGGTGG - Intronic
1104705788 12:130946531-130946553 CCTTCAAATGGGAGAGGGGCAGG - Intergenic
1105033080 12:132898378-132898400 TCAGCAAAGGGGAGATGGGGTGG - Intronic
1106100354 13:26689959-26689981 TGTTCATAGGGAAAAAGGGGAGG + Intergenic
1106799366 13:33241550-33241572 CGTGCAAAGGGGAGAGGGGGAGG - Intronic
1108705437 13:52981364-52981386 TCTTCAAAGAGGGAATGGAGGGG - Intergenic
1109406646 13:61909008-61909030 TCTTTATAAGGGAAAGAGGGAGG + Intergenic
1109474299 13:62858151-62858173 TCTTCAAAGAGGGAAGGGAGAGG - Intergenic
1112000924 13:95209241-95209263 TCTTCAAGGGAGAAAGGTGAAGG - Intronic
1112484083 13:99804037-99804059 ACTTCAAAGAGAAAAGGGAGTGG + Intronic
1112751564 13:102588829-102588851 TCCTCACAGGGGAAGGGGTGAGG - Intergenic
1113239698 13:108323244-108323266 TCATCAATGGGGAAACGGTGGGG - Intergenic
1113667321 13:112149733-112149755 TCCTCACAGGGGGAAGGTGGTGG - Intergenic
1114416136 14:22545940-22545962 GCTTTAAAGAGGAAAGGGGGTGG - Intergenic
1115100520 14:29692746-29692768 TTTTGAAAGGGCAAAGGGGAAGG - Intronic
1117514080 14:56482944-56482966 TTTTAAAAGGGGAGAGAGGGAGG - Intergenic
1117951402 14:61085484-61085506 TCTAGAAAGGAGAAAGGGTGGGG - Intergenic
1118193316 14:63600936-63600958 TCTTCAAAAGTGGAAGAGGGAGG + Intronic
1118259488 14:64234184-64234206 TCATTAAAGGGGAAAGGCAGAGG + Intronic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1118748122 14:68788914-68788936 TCTTCCAAGGGGCAGGGGTGGGG + Exonic
1119189403 14:72670161-72670183 TCTTAACAGGGGCAAGGGGAGGG + Exonic
1119248661 14:73133765-73133787 TCAGCAAAGGGAAATGGGGGTGG + Intergenic
1119479395 14:74950232-74950254 TCTTCAAAGAGGAGGTGGGGAGG - Intronic
1120495019 14:85224015-85224037 TCTTCACTGGGGAGAGGGGTGGG - Intergenic
1121024581 14:90605721-90605743 TCTTGAAAGAGGAGAGGAGGAGG + Intronic
1121116167 14:91344439-91344461 ACTTAAAAGGGGGAAGGAGGAGG - Intronic
1121116516 14:91346996-91347018 CCGACAAAAGGGAAAGGGGGAGG - Intronic
1121603177 14:95221169-95221191 TCTTCACAGAGGGGAGGGGGTGG - Intronic
1121723186 14:96126463-96126485 GCTTCAAAGGGAAAAGGAAGGGG + Intergenic
1124098642 15:26672451-26672473 TCTTCTTAGGGGAAAGAGAGAGG - Intronic
1124691821 15:31829663-31829685 TCTTCAGAACTGAAAGGGGGAGG - Intronic
1124694740 15:31854573-31854595 TCTTAAAAGTGGAAGGAGGGAGG - Intronic
1127094253 15:55497108-55497130 TCTTAATAGGGGAAGGGGGAGGG - Intronic
1127614471 15:60670105-60670127 TCTTCTTAGAGGAAAGGGGAAGG - Intronic
1127815463 15:62604905-62604927 TCTTAATGGGGGAAAGGAGGAGG - Intronic
1128460253 15:67861592-67861614 TTTTCACAGGGGATAGGGGCAGG - Intergenic
1128754110 15:70169867-70169889 TCTTCAAAGGGAAAAGGAAGGGG - Intergenic
1131436724 15:92428666-92428688 ATTTCCAAGGGGAAATGGGGAGG + Intronic
1133522645 16:6574049-6574071 TCTTGAAAGGGGAACAGGGTTGG - Intronic
1134216355 16:12319814-12319836 ACTTCAAAGCAGGAAGGGGGAGG + Intronic
1135830844 16:25771499-25771521 TTTGCCAAGGGGAAAGGAGGAGG - Intronic
1136227969 16:28871887-28871909 TCTTCAATGGGGATGCGGGGGGG - Exonic
1137753830 16:50886118-50886140 TCCCCACAGGGGAAAGGGTGAGG + Intergenic
1138360886 16:56425853-56425875 TCTTCAGAGGGTTAATGGGGTGG - Intergenic
1139256307 16:65546259-65546281 TCCTCAAATGGGAAGGGTGGAGG + Intergenic
1139256759 16:65550006-65550028 TCCTCAAATGGGAAGGGTGGAGG - Intergenic
1139797616 16:69496239-69496261 TTTTTAAAGGGGAAAGTGTGTGG - Intergenic
1141289355 16:82703465-82703487 TCTCCAAAGGGGCAAGGGAGTGG - Intronic
1141756663 16:85995875-85995897 TCTTCAGAGGCGAAAGGGGAAGG + Intergenic
1142232469 16:88906262-88906284 GCCTCAAAGGGGAATGGGGTGGG - Intronic
1143756754 17:9073033-9073055 TCTTCAAAGAGAAAGGGGTGGGG + Intronic
1144315369 17:14055787-14055809 CCTGCATAGGGAAAAGGGGGAGG + Intergenic
1145839240 17:27980231-27980253 TCTTTAAGGGGGAGAGGGGCTGG + Intergenic
1145873291 17:28294573-28294595 TCTGCAGAGAGGAAAGGAGGGGG - Intergenic
1147400173 17:40176232-40176254 GCTTGAAAGGGGAAAGTGGCTGG - Intergenic
1147513037 17:41088727-41088749 ACTGCAAATGGCAAAGGGGGAGG - Intronic
1148217276 17:45840046-45840068 TCATCACAGGGGAAGGGGGAGGG + Intergenic
1148566538 17:48636241-48636263 TCTTCAAGGAAGAAAGGGAGTGG - Intergenic
1149455696 17:56786326-56786348 TCTTCCAGGTGGAAAAGGGGAGG - Intergenic
1150037355 17:61818185-61818207 TCTAAAAAGGGGGGAGGGGGGGG + Intronic
1151202210 17:72476820-72476842 ACTACAAAGGGGTCAGGGGGAGG + Intergenic
1151561343 17:74871541-74871563 CCTTCACAGGGGAAGGGGGAGGG + Intronic
1152362214 17:79837902-79837924 TCTTGCAAGGGAAAAGGGAGGGG + Exonic
1153017289 18:595689-595711 TATAAAAAGGGGAAAGGGGAAGG + Intergenic
1153181905 18:2444732-2444754 GCTTCAGAAGGGAAAGGGGGAGG + Intergenic
1153333315 18:3896853-3896875 TCTTCAAGGGAGAAGGGGGAAGG - Intronic
1153568453 18:6444426-6444448 TCTTCAAAGAGGAAAGTTGTGGG + Intergenic
1155301041 18:24429330-24429352 ACATCAACGGGGAAAGGGGCAGG - Intronic
1156927554 18:42600670-42600692 TACTAAAAGGGGAAAGAGGGAGG - Intergenic
1157394640 18:47331502-47331524 CCATCAAAGGGGAAAGGGTGGGG - Intergenic
1158495958 18:57955405-57955427 TCTTCATAGGGGAGAGGGAAGGG + Intergenic
1159485324 18:69048725-69048747 TCTTCCAAGGGGTATGGGGGAGG - Intronic
1159771029 18:72545061-72545083 TCTTCAAAGGGGAGAGGGTTCGG - Intronic
1164991368 19:32686840-32686862 TCTTCAAAGAGGGAAAGGGCAGG + Intergenic
1165117916 19:33540126-33540148 ATTTTAAAGGGAAAAGGGGGTGG - Intergenic
1165572489 19:36787046-36787068 TGTTCAAAAGGGACAGGGAGTGG + Intergenic
1165811309 19:38613759-38613781 TCTTCCAAGGAGAAAGGACGAGG + Intronic
1166385617 19:42378909-42378931 TCTTAAAGGGGGAAGGGGGAAGG + Intergenic
1167128436 19:47568146-47568168 TTTTCAAAGAGGAAAAGAGGTGG - Intergenic
1167483036 19:49744960-49744982 CCTTAAAAGGGCAAAGGGTGGGG - Intronic
1168294201 19:55370656-55370678 AGTTGAAAAGGGAAAGGGGGGGG + Intergenic
925016615 2:531982-532004 TCTTCACAAGGAAAAGGGGAAGG + Intergenic
926644770 2:15277817-15277839 TTTTAGAAGGGGAAAGGAGGGGG + Intronic
926841468 2:17085415-17085437 TCTTCTTAGGTGAAAGTGGGTGG - Intergenic
927257316 2:21050792-21050814 TCTCCAAAGAAGAAAGTGGGTGG + Intergenic
927628626 2:24750910-24750932 GCTTAAAAGGGGGAAGGAGGGGG + Intronic
928701490 2:33903453-33903475 TCTTCAAAGGGGAAATGCCTGGG + Intergenic
929481240 2:42310348-42310370 TCTGCAAAAGGGAAAAGGGAAGG - Intronic
929860059 2:45669219-45669241 TATTTTAAGGGGAAAAGGGGAGG + Intronic
929935283 2:46290410-46290432 TCTTCAAAGGGCAAAGACTGAGG + Intergenic
930108542 2:47658597-47658619 TCTTCCCAGGGGAGAGGGGAGGG + Intergenic
930122167 2:47769154-47769176 TCTTCAAGGGAGAAGGGAGGAGG + Intronic
930165772 2:48202416-48202438 TCTTCAAAGCGGTCAGGGGAGGG + Intergenic
931565756 2:63614191-63614213 TCTTCATAGGGGAGAGGGAATGG - Intronic
931687489 2:64806892-64806914 TCTTCAAATGTGGAAGAGGGAGG + Intergenic
931807612 2:65822951-65822973 TCTTGAAAGGGGAAAGTTGTTGG + Intergenic
935155276 2:100478983-100479005 TCATCCAAGGGAAAAGGTGGAGG - Intronic
935871440 2:107455209-107455231 TGTTAATAGGGGAAAGGGAGGGG - Intergenic
936813840 2:116435305-116435327 TCTTTAAATGTGGAAGGGGGAGG + Intergenic
936922778 2:117706479-117706501 TCTTCAAGGGGAAAGGAGGGTGG - Intergenic
937152325 2:119694587-119694609 CCTTCAAAGGGGCCAGGAGGAGG - Intergenic
939003771 2:136764372-136764394 GCTTCAAAAGGGAGAAGGGGCGG - Intergenic
939280167 2:140053882-140053904 TCTTCATAAGGGAAGGGGAGAGG + Intergenic
941312338 2:163949861-163949883 TCTTAGAAGGAGAAAGGGTGTGG - Intergenic
942158623 2:173158330-173158352 TTTTAAAGGGAGAAAGGGGGAGG + Intronic
942813460 2:180023682-180023704 TTTGCAAAGGAGAAAGGAGGCGG - Intergenic
943075749 2:183191971-183191993 TCTTAATATGGGAAAGGGGGAGG + Intergenic
944051410 2:195474339-195474361 TCTTCCAAAGGGAAAGAGGGAGG + Intergenic
944483699 2:200182003-200182025 TCTTGGAAGGGGGAAGGGGCAGG - Intergenic
945628468 2:212240264-212240286 GCTTCAAAGGAGAAAGGTGAGGG - Intronic
946167720 2:217875646-217875668 TTTTGAAAGAGGAAAGAGGGAGG - Intronic
946672255 2:222117557-222117579 TCTTTAAAGGGGAAAGTACGTGG - Intergenic
947000904 2:225454963-225454985 TCCTTAAATGGGAAAGAGGGAGG + Intronic
947310447 2:228796013-228796035 ATTTCAAAGGGGAAATGGTGAGG + Intergenic
947330513 2:229024907-229024929 TGTTAGAAGGGGAAAGAGGGTGG + Exonic
947347092 2:229203285-229203307 TCTACAAAGGGGATGGGGGAAGG + Intronic
947590071 2:231380360-231380382 TCTTTGAAAGGGAAAGTGGGGGG - Intergenic
948371941 2:237495193-237495215 TCCTCATAGGGGAAAGAGGAAGG - Intronic
1168773624 20:431496-431518 TCTCAAAAGGGGAAGGAGGGTGG - Intergenic
1169360824 20:4947277-4947299 ACGTGAAAGGGGAAAGGGAGGGG + Intronic
1169443761 20:5654464-5654486 ACTGGAAAGGGGAAAGGGGAAGG - Intergenic
1169660402 20:7972641-7972663 TCTCCAAATGGGGAAGGGGGAGG + Intergenic
1170231426 20:14050925-14050947 TCTTCAGAGGAGACAGGAGGAGG + Intronic
1170364049 20:15580796-15580818 TCTTCTTAGGGGAAAGGGGAGGG + Intronic
1170795918 20:19546610-19546632 TTTTTTGAGGGGAAAGGGGGTGG + Intronic
1171993247 20:31712929-31712951 TCCTCAAAGGTGACTGGGGGAGG + Intronic
1172593816 20:36135808-36135830 TCTGGAAAGGGGAAGGGGTGAGG + Intronic
1173470783 20:43321869-43321891 TCTCCCAAGGGGAATGGGTGGGG - Intergenic
1174125843 20:48305438-48305460 GCCTCAAAGGGGAAAGGGGCTGG - Intergenic
1174222234 20:48965564-48965586 TTTTCAAAAGTGAATGGGGGTGG + Intronic
1174581500 20:51575198-51575220 TCTTCAAAGGGCAAAGGTAAAGG - Intergenic
1174678782 20:52384160-52384182 TCTTTACAGGTGAAACGGGGAGG + Intergenic
1174858053 20:54065537-54065559 TCTTCGCTGGGGGAAGGGGGCGG - Intronic
1175349034 20:58305258-58305280 TCTTGAAAGCGGAAAGTGTGTGG - Intergenic
1178144331 21:29721091-29721113 TCTTCATAGGGGAGAGGGGAGGG - Intronic
1179444979 21:41424712-41424734 ACTGCAAAGGTGAAAGGGGTTGG - Intronic
1180094079 21:45546593-45546615 TCTTTACTAGGGAAAGGGGGAGG + Intergenic
1180154188 21:45970299-45970321 TCTGCAAAGGGGAAGGTGAGGGG + Intergenic
1181092872 22:20486247-20486269 TCAGCAAAGGGCAAAGGGAGAGG - Intronic
1181550541 22:23636723-23636745 TCTTTATAAGGGAAAGGAGGAGG + Intergenic
1181797738 22:25321969-25321991 TCTTTATAAGGGAAAGGAGGAGG - Intergenic
1182306991 22:29376898-29376920 TTTTAAAAAGGGAAAGGGGCCGG + Intronic
1183181033 22:36259774-36259796 TCTTCGACGGGGCATGGGGGCGG - Intronic
1184099851 22:42336341-42336363 TCATCCAAGGGGAGAGGGGGCGG - Intronic
949467829 3:4361887-4361909 TCTTTAAAGAGGAAGGGGAGTGG - Exonic
949786318 3:7745686-7745708 ACTTCAAAGGGGAAAGGCCTTGG - Intergenic
950868001 3:16204819-16204841 CCTTCAAAGGGCAGAGTGGGAGG - Intronic
951233944 3:20212568-20212590 TCTGCAAAAGGGAAGGGGAGGGG - Intergenic
953228617 3:41043866-41043888 TCTTCAAAAGGGATGGGAGGTGG - Intergenic
953614154 3:44475012-44475034 TGTTCAAAGGGGATGGGGCGGGG + Intronic
954077860 3:48194453-48194475 TCTTCCATGGGGAAAAGGAGGGG - Intergenic
954584402 3:51720964-51720986 TCCTGACATGGGAAAGGGGGAGG + Intergenic
954617342 3:51976043-51976065 TCTCCAAAGCGGGAAGGGCGGGG - Intronic
954639817 3:52091156-52091178 TCTCCAGAGGGGATAGGGGAGGG + Intronic
954982058 3:54755193-54755215 TCTTCAAAGGGGTGAGGAGAAGG - Intronic
955351506 3:58196759-58196781 CCTTCAATGGGGACAGAGGGGGG - Intronic
955805933 3:62734460-62734482 ACTTCAGAGGGAAAAGGAGGGGG - Intronic
956738369 3:72256177-72256199 TGGTCAAACTGGAAAGGGGGTGG - Intergenic
957450828 3:80379795-80379817 TCTTCATAGTGGAAAGGGGAGGG + Intergenic
958425499 3:93974083-93974105 TTTCCAAAGGGGAAGGGGTGGGG + Intergenic
958927150 3:100171342-100171364 GCTTGAAAGGGGGAAGAGGGGGG - Intronic
960073223 3:113455038-113455060 TTTTTAAAGGGGAAATGAGGAGG - Intronic
960084912 3:113580103-113580125 TGATCAAAAGGGCAAGGGGGAGG + Intronic
960157333 3:114309174-114309196 TCTTCCTAGGGGAAAAAGGGGGG + Exonic
960185881 3:114638248-114638270 TGTTCAAAGAGGGAAGGAGGAGG - Intronic
960641090 3:119823845-119823867 TATTTCAAAGGGAAAGGGGGTGG + Intronic
960661122 3:120060125-120060147 TCTTAAAATCGGAAAGAGGGAGG + Intronic
960770934 3:121191525-121191547 TGTGCAAAGGGGAGAGGGAGAGG + Intronic
961046478 3:123712077-123712099 TCTTCCAAGGGGACCGTGGGGGG - Intronic
961206631 3:125087630-125087652 TATTGAAAGGGGACAGAGGGTGG + Intronic
962256968 3:133878092-133878114 TCTTCAAAGGATGAAGGGAGAGG + Intronic
962503335 3:136018482-136018504 TTTTCAAAGGGGGAAGGGCAAGG + Intronic
962629902 3:137265178-137265200 TCTTCAAATAAGAAAGAGGGGGG + Intergenic
963323886 3:143839948-143839970 TCTCCTATGGTGAAAGGGGGAGG - Intronic
963918860 3:150886771-150886793 TCTTTATAAGGGAAAGCGGGAGG - Intronic
964330688 3:155599013-155599035 TCTTCATATGGGGAGGGGGGCGG - Intronic
965033610 3:163405808-163405830 TCTTCATAGGGGAAAGGGAGTGG + Intergenic
965065613 3:163843675-163843697 TTTTGAAAGGTGAAAGGGGAGGG - Intergenic
965348058 3:167576582-167576604 TCTTTAAATGTGAAAGAGGGAGG + Intronic
966202499 3:177371990-177372012 ACTTCAATAGGCAAAGGGGGTGG - Intergenic
966600787 3:181773260-181773282 TCTCCAAGAGGGAAAGGGAGAGG + Intergenic
968181911 3:196601688-196601710 TCTGAAAAAGGGAAAGGAGGAGG - Intergenic
969384925 4:6837900-6837922 CGTGCAAAGGGGAGAGGGGGAGG + Intronic
970237362 4:13972376-13972398 TCTTTAAAGAGCAAAGGGGAAGG + Intergenic
971150452 4:24025837-24025859 AATTCAATGGGGAAAGGAGGAGG + Intergenic
971454365 4:26830200-26830222 TATTCAAAGGCAAAAAGGGGGGG - Intergenic
972412051 4:38805195-38805217 TATTAAAAGTGGAAAGAGGGAGG + Intronic
972848925 4:43024412-43024434 CCTTCCTAGGGGAAAGGGGGTGG + Intronic
973638164 4:52878927-52878949 CCTGAAAAGGGGAAAGGGAGAGG - Intronic
973794117 4:54406305-54406327 TCTTCACAGGGGAGAGAGGTTGG - Intergenic
973927037 4:55749080-55749102 ACTGGAAGGGGGAAAGGGGGAGG + Intergenic
974787066 4:66632309-66632331 TCTTCACAGGGGTAAGGTTGAGG + Intergenic
974949842 4:68574947-68574969 TCTTCAAAAAAAAAAGGGGGGGG - Intronic
976046125 4:80950255-80950277 ACATCAAATGAGAAAGGGGGGGG - Intronic
976677577 4:87720437-87720459 TCTTTAAAAGGAAAAAGGGGTGG - Intergenic
976703271 4:87994035-87994057 TCTGGAAAGGGGAGAGGGGCTGG - Intergenic
976789602 4:88863198-88863220 TCTAGAGAGGGGAAAGGGGCTGG + Intronic
978227352 4:106353150-106353172 TCTTCAAGGGGAAAAAGAGGTGG + Intergenic
978243389 4:106542994-106543016 CTTTCAGAGGGTAAAGGGGGTGG + Intergenic
978544609 4:109857587-109857609 CCTTTAAAGTGGAAAGGGGCAGG - Intronic
979580879 4:122358386-122358408 ATTTCAATGGGAAAAGGGGGTGG + Intronic
979922127 4:126511472-126511494 TCTGGGAAGGGGAAAGGGAGGGG - Intergenic
979941602 4:126770593-126770615 CGTGCAAAGGGGAGAGGGGGAGG - Intergenic
980082767 4:128361997-128362019 TCTTTAAAAGTGAAAGAGGGAGG + Intergenic
980112272 4:128646299-128646321 TCAGCAAAGGGGATAGGGGTGGG + Intergenic
980941040 4:139274354-139274376 TTTTAATAGGGGAAAGGAGGAGG + Intronic
980969260 4:139554367-139554389 GCTTCAAAGGGGAATGGATGTGG + Intronic
981308596 4:143272651-143272673 TATTCAAAGGGGTCAGGGGATGG + Intergenic
983019371 4:162656222-162656244 TCTTCAGAGGGGAGGGGGGAGGG - Intergenic
984420343 4:179513338-179513360 TCTTCAAAGAGGAAAGAGGCAGG + Intergenic
985174754 4:187189063-187189085 ACTTCAAAGGGGAAAGGCTCTGG - Intergenic
986991513 5:13558345-13558367 TCCTCAAAAGGAAAAGAGGGTGG - Intergenic
986997363 5:13622242-13622264 TCTTCATAGGAGAGAGGGGAAGG - Intergenic
987594456 5:19978780-19978802 TCTTTAAAAGTGAAAGAGGGAGG - Intronic
989112081 5:37916001-37916023 TCTTCGGAGGGGAAGGTGGGGGG + Intergenic
989217904 5:38923990-38924012 TGTTCAAAGAGGCAAGTGGGGGG - Intronic
989350941 5:40486094-40486116 TCTCCAATGGGGAATGGGGGTGG - Intergenic
991005948 5:61828174-61828196 TTGCCAGAGGGGAAAGGGGGAGG - Intergenic
991508111 5:67346037-67346059 TATACAAAGGGGAAAGAGGAAGG + Intergenic
992626953 5:78645047-78645069 TCTTCCAAAGGGAGAAGGGGAGG - Intronic
995543045 5:113203048-113203070 TCTACAAATGGGAAGGGGAGTGG - Intronic
997493138 5:134296338-134296360 TCTTCAAAGAGGAAAAGAGCAGG + Intronic
997736354 5:136215411-136215433 TCCTCAAAGGGGAACTGAGGTGG + Intronic
998092757 5:139380757-139380779 TCTGCACTGGGGAAAAGGGGAGG - Intronic
999069404 5:148727944-148727966 TCTTCCAAGGGTAATGGGGATGG - Intergenic
999103902 5:149052038-149052060 TCATCAAGAGGGAAAGAGGGAGG + Intronic
999962762 5:156775057-156775079 TCTTAAAAGGGGGAAGGGTTGGG - Intergenic
1000263767 5:159615410-159615432 TAGTCAAAGAGGAAAGGGGTGGG + Intergenic
1000418448 5:161009592-161009614 TTTTCAAAGGGAAAAGAGAGAGG + Intergenic
1000841876 5:166230323-166230345 TCAGGAAGGGGGAAAGGGGGAGG - Intergenic
1001521865 5:172400134-172400156 GTTTCAAAGGAGAAAGGGAGAGG - Intronic
1002429162 5:179193046-179193068 TCTCCCAAGTGGAAAGTGGGAGG - Intronic
1003521750 6:6863920-6863942 TCTTCAATGGGGAAGGAGTGTGG - Intergenic
1003916723 6:10793816-10793838 TCTTCCAAGGGGTCATGGGGAGG + Intronic
1004972942 6:20932378-20932400 ACTTCAAATGGGAACGTGGGTGG - Intronic
1004977150 6:20980896-20980918 TCTTCAAATGGGCAAAGGGTAGG - Intronic
1005074764 6:21896235-21896257 TCTTCGAAGGGCATTGGGGGCGG + Intergenic
1005958418 6:30680274-30680296 TCTTAATAGGGCAAAGGGGAAGG - Intronic
1006616302 6:35329864-35329886 TCTTCAAAGAGGGAAAGGGCAGG + Intergenic
1006733775 6:36256909-36256931 TCTTCATAGGGGAGAGGAAGTGG + Intronic
1007122812 6:39397429-39397451 TTTTCAAAGAGGAAAGAGGAAGG + Intronic
1007234423 6:40380023-40380045 CCTTCAAAGGGGGAAGTGGGAGG - Intergenic
1007454657 6:41967193-41967215 TTTTGAAAGGGGGAAGGCGGAGG + Intronic
1008045570 6:46848529-46848551 TATTTAAAGGGGAAAAGTGGAGG + Intergenic
1008150197 6:47940870-47940892 TATTAAAATGTGAAAGGGGGTGG + Intronic
1008909269 6:56715895-56715917 TCTTCACAGGGGAGAGGGAAGGG - Intronic
1008970026 6:57356698-57356720 AATTCAAAGGGTAAAAGGGGAGG + Intronic
1010586116 6:77660049-77660071 TCTTCAGAGGGTAAAGGTGAGGG + Intergenic
1011450177 6:87483765-87483787 CCTTCAGAGGGGGAAAGGGGAGG - Intronic
1011816610 6:91198608-91198630 ACTTTAAAAGGGAAAGAGGGAGG - Intergenic
1012299147 6:97563219-97563241 CATTCCTAGGGGAAAGGGGGTGG - Intergenic
1013476346 6:110510705-110510727 TCTAGAAAGGGAAAAGGGGCTGG + Intergenic
1014080104 6:117276029-117276051 ACTTCAAAGGGGAAATGAGACGG - Intergenic
1014844235 6:126256645-126256667 TCAAAAAAGGGGAAAGTGGGAGG + Intergenic
1016540151 6:145155765-145155787 TGTTCAAAGAGAAAAGGGGCAGG - Intergenic
1016806737 6:148219397-148219419 TGATCATAGGGGAAATGGGGAGG - Intergenic
1016812705 6:148276579-148276601 TATGCAAAGGGAAAAGGGAGCGG + Intronic
1017268302 6:152477293-152477315 ACATCAAATGGGAAAGGGGAAGG + Intronic
1020390441 7:7651957-7651979 TCTTGCAAGGGGAGAGAGGGAGG - Intronic
1021360117 7:19702211-19702233 TGATAATAGGGGAAAGGGGGTGG + Intronic
1022025538 7:26444601-26444623 ACATCCAAGGGGAGAGGGGGAGG - Intergenic
1022527503 7:31048071-31048093 TCTTCATCTGTGAAAGGGGGTGG + Intergenic
1022866231 7:34423987-34424009 TTTTCAAAGGAGAAAAAGGGAGG - Intergenic
1023315206 7:38929210-38929232 TTGTCAATGGGGACAGGGGGAGG - Intronic
1023656400 7:42426059-42426081 TCTTCCAGTGGGAAAAGGGGTGG - Intergenic
1023860236 7:44213992-44214014 TCCTCAAGTGGGAAAGGGAGAGG - Exonic
1023972132 7:44999692-44999714 TCTGAAAAGGGGACGGGGGGCGG - Intronic
1024912623 7:54463430-54463452 TCTTCAAAGGGAAGAGGAGATGG - Intergenic
1025997888 7:66539601-66539623 TATTTAAAGGGGAAAGAGGGGGG + Intergenic
1028745697 7:94323986-94324008 TCTGCCAAAGGGGAAGGGGGTGG - Intergenic
1029434534 7:100555124-100555146 TCTTCAGAGGGAAATGGGTGGGG - Intronic
1029974037 7:104815890-104815912 TCTTCAAAGGGGAAAGGGGGAGG - Intronic
1030603971 7:111619449-111619471 TCTTCATAGGGGAGAAGGAGTGG - Intergenic
1031080063 7:117249505-117249527 TCATCAAAGAGGAAGGGGGTGGG - Intergenic
1032756317 7:134893868-134893890 GATTTAAAGGGGAAAGGGTGGGG + Intronic
1033322138 7:140349524-140349546 GCATCAAAGGAAAAAGGGGGGGG + Intronic
1034488616 7:151381357-151381379 CCCTAAAAGGGAAAAGGGGGCGG + Exonic
1034733344 7:153406977-153406999 TCTGCAAAGGAGGAAGGGGTTGG - Intergenic
1035216750 7:157373307-157373329 TTTTGAAAGGTGAAAGGAGGAGG + Intronic
1041168495 8:55115921-55115943 TCATCAAAGTGGACAGGAGGTGG + Intronic
1042425591 8:68644225-68644247 TCTTCATAGGGGAGAGGGTAAGG + Intronic
1043239064 8:77908248-77908270 ACATAAAAGAGGAAAGGGGGAGG + Intergenic
1044116270 8:88338420-88338442 ACTACAAAGGGAAAAGGAGGAGG - Intergenic
1044891489 8:96840769-96840791 TATTCAAAGGGGGAAGGAGTAGG + Intronic
1045184345 8:99821378-99821400 TCTCCAAAGTGGAAAGATGGAGG + Exonic
1045342999 8:101270904-101270926 TCTTTAAGGGGGAAAGTGGTAGG + Intergenic
1046077363 8:109329270-109329292 TCTTCAAAGGAGAAAAGGAGGGG + Intronic
1047072173 8:121357483-121357505 TCTTCAAACGGGTAACTGGGAGG - Intergenic
1048519652 8:135141836-135141858 TTTTCAAAGGGAAAACAGGGTGG + Intergenic
1049522956 8:143103910-143103932 CCTTCAAAGGGGGAAGGGTGTGG + Intergenic
1050051764 9:1609474-1609496 TCTTCAAAGGGAAAAGTGTGTGG - Intergenic
1050602307 9:7265356-7265378 TATCCAAAAGGGAAAGGGAGAGG - Intergenic
1052077141 9:24157169-24157191 TCCTTAAAAGTGAAAGGGGGAGG + Intergenic
1052730948 9:32284818-32284840 TCTTCAAAGTGAAAAGAGGTTGG - Intergenic
1052785475 9:32824170-32824192 TCTTCAAAGAGGGAAAGGGTAGG - Intergenic
1053652002 9:40178175-40178197 TATTTAAAGGGGAAAAGTGGAGG - Intergenic
1053902390 9:42807489-42807511 TATTTAAAGGGGAAAAGTGGAGG - Intergenic
1054458587 9:65449943-65449965 TCCTCAAAGGGGGCTGGGGGGGG - Intergenic
1054532585 9:66198031-66198053 TATTTAAAGGGGAAAAGTGGAGG + Intergenic
1055030927 9:71770545-71770567 TTTTATAAGGGGAAAGGGGGTGG + Intronic
1055573330 9:77639213-77639235 TCTACCATAGGGAAAGGGGGTGG - Intronic
1055858125 9:80716701-80716723 TGTTTAAAGGGCAATGGGGGTGG + Intergenic
1056528999 9:87470433-87470455 TCTTCATATGGGAGAGGGGAGGG - Intergenic
1057272213 9:93657662-93657684 TCTTCAATGGGAAGAGGGAGGGG + Intronic
1057464926 9:95304333-95304355 TTTTCAAACAGGAAAGGGAGGGG + Intronic
1057618279 9:96613158-96613180 TCTTCACAGGGGAATGTGGAGGG + Intronic
1057771850 9:97975164-97975186 TCTACAAAGTGGAAAAGGGAAGG - Intergenic
1058639253 9:107067152-107067174 TCTCCAAAGGTGAAAGGCAGTGG - Intergenic
1059698236 9:116749028-116749050 TCTACACAGGGGACGGGGGGCGG - Intronic
1060360330 9:122949815-122949837 ACTGCAGAAGGGAAAGGGGGAGG + Intronic
1061849837 9:133407881-133407903 TCTGCAAAGGGGGAAGAGGCGGG + Exonic
1062590694 9:137273213-137273235 TTTTCCAAGGGGAGAGGGCGGGG + Exonic
1185775443 X:2799418-2799440 AATTTAAAGGGGAAAGGGTGGGG + Intronic
1189253452 X:39619463-39619485 TGTTCAAATGGGAAAGGAAGGGG - Intergenic
1190252937 X:48740877-48740899 ACTCGAAAGGGGAAAGGGGAAGG + Intergenic
1192234289 X:69286032-69286054 GCTTCCAAGAGGAAATGGGGAGG + Intergenic
1193380489 X:80810763-80810785 TCTTCAATGATGAAAGGGGTTGG + Intergenic
1195401821 X:104468907-104468929 TATTCAAAGGGCCAAGGGGAGGG + Intergenic
1196321774 X:114349369-114349391 TCTCAAAAAGGAAAAGGGGGGGG + Intergenic
1197662514 X:129189326-129189348 TCTTCATAGGGGAAGGGGAGAGG + Intergenic
1198405184 X:136305217-136305239 TCTTCACAGGGGAATGGAGAAGG - Intronic
1198580584 X:138060018-138060040 TGTCCAAAGGGAAAATGGGGAGG - Intergenic
1199270939 X:145881915-145881937 TCTTGAAAGGGGAATGTGGATGG + Intergenic
1199402516 X:147415662-147415684 TCTTATAAGAGGAAAGGAGGAGG - Intergenic
1201312652 Y:12610889-12610911 TCTCCACAGTGGAGAGGGGGAGG + Intergenic
1201622007 Y:15969906-15969928 ACTCCAAATGGGAAAGTGGGAGG + Intergenic
1201778113 Y:17688587-17688609 TCTGCAAAGGGAAACTGGGGAGG - Intergenic
1201823443 Y:18217405-18217427 TCTGCAAAGGGAAACTGGGGAGG + Intergenic