ID: 1029974451

View in Genome Browser
Species Human (GRCh38)
Location 7:104819816-104819838
Sequence GGCACATGGACAATTTATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029974447_1029974451 0 Left 1029974447 7:104819793-104819815 CCACCACAGCTTGCATTTTTGAA 0: 1
1: 0
2: 2
3: 34
4: 288
Right 1029974451 7:104819816-104819838 GGCACATGGACAATTTATCAAGG No data
1029974446_1029974451 17 Left 1029974446 7:104819776-104819798 CCACATTTACAGATGCACCACCA 0: 1
1: 0
2: 1
3: 17
4: 185
Right 1029974451 7:104819816-104819838 GGCACATGGACAATTTATCAAGG No data
1029974449_1029974451 -3 Left 1029974449 7:104819796-104819818 CCACAGCTTGCATTTTTGAAGGC 0: 1
1: 0
2: 1
3: 22
4: 215
Right 1029974451 7:104819816-104819838 GGCACATGGACAATTTATCAAGG No data
1029974445_1029974451 22 Left 1029974445 7:104819771-104819793 CCACACCACATTTACAGATGCAC 0: 1
1: 0
2: 1
3: 15
4: 210
Right 1029974451 7:104819816-104819838 GGCACATGGACAATTTATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029974451 Original CRISPR GGCACATGGACAATTTATCA AGG Intronic
No off target data available for this crispr