ID: 1029975216

View in Genome Browser
Species Human (GRCh38)
Location 7:104827196-104827218
Sequence CCTGCAGCCAGTTCTCCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 3, 2: 3, 3: 31, 4: 276}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029975212_1029975216 27 Left 1029975212 7:104827146-104827168 CCACTATCAATGTGAGCACTGAC 0: 1
1: 0
2: 3
3: 4
4: 99
Right 1029975216 7:104827196-104827218 CCTGCAGCCAGTTCTCCATGTGG 0: 1
1: 3
2: 3
3: 31
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029975216 Original CRISPR CCTGCAGCCAGTTCTCCATG TGG Intronic
900507985 1:3039183-3039205 CCTGCAGCCAGGACCCCCTGCGG + Intergenic
900929570 1:5727939-5727961 CTTGCTGCCAGATCTCGATGTGG - Intergenic
901002510 1:6155595-6155617 CCTTCAGCCAGTTCCTCAGGTGG - Exonic
901123372 1:6912651-6912673 CCAGCAGCCTGTCCTCCAGGCGG + Intronic
901158393 1:7155718-7155740 ACTGCAGCCAGTGAGCCATGAGG + Intronic
901240689 1:7691446-7691468 CCTTCAATCTGTTCTCCATGTGG - Intronic
901975988 1:12944441-12944463 CCTGCAGCCATGTCTCCATTTGG + Intronic
902009184 1:13257324-13257346 CCTGCAGCCATGTCTCCATTTGG - Intronic
902635047 1:17729479-17729501 CCTGCACCCTGCTCTCCAGGTGG + Intergenic
902683765 1:18062244-18062266 CCTTCACCCAGTTCACCTTGGGG + Intergenic
903691225 1:25175062-25175084 GCAGCAGCCTGTTCTCCCTGGGG - Intergenic
903879988 1:26501588-26501610 CCTGGAGCTCTTTCTCCATGTGG - Intergenic
904612211 1:31732013-31732035 CCAGCAGCCAGAACTCCATCAGG + Intronic
904893207 1:33794771-33794793 CCTGTAGCAAGTTCTAGATGAGG + Intronic
905213354 1:36389690-36389712 CATGCAGCCATTTCTCCAGAGGG - Intergenic
906664317 1:47608410-47608432 CCTGCTAGAAGTTCTCCATGAGG + Intergenic
907335821 1:53698727-53698749 CCTGCAGCCACCTCTCCACCAGG + Intronic
907470813 1:54672297-54672319 CCTGAAGCCAGTGGTCCTTGGGG - Intronic
908955253 1:69617847-69617869 CGTTCTGCCAGTTCTCCATAAGG - Intronic
910078882 1:83315198-83315220 CATGTAGCAAGTTCTCCAAGTGG - Intergenic
912102951 1:106234194-106234216 CCAGTAGGCAGTGCTCCATGGGG - Intergenic
913195870 1:116455425-116455447 CAGGCAGCCAGGTCCCCATGTGG - Intergenic
915065867 1:153223321-153223343 CCGGCCGTCAGTGCTCCATGTGG + Intergenic
917980577 1:180266536-180266558 CCAGCCGCCCGTCCTCCATGAGG - Exonic
918427961 1:184429327-184429349 CCTACAACCAGTTACCCATGTGG - Intronic
921759471 1:218896351-218896373 CATGCAGGCAGTTTTACATGTGG - Intergenic
922083833 1:222325981-222326003 CCTCTGGCCATTTCTCCATGGGG - Intergenic
922965558 1:229688181-229688203 CCTGCAGCCAGTTCTTCATGTGG - Intergenic
1064271895 10:13872726-13872748 ACTGAAGCCAGAGCTCCATGTGG - Intronic
1067089222 10:43258132-43258154 CCAGCAGGCAGACCTCCATGAGG - Intronic
1068613619 10:59087967-59087989 CTTGCAGCCAGTTGCCCAGGGGG - Intergenic
1068945227 10:62723102-62723124 ACTGGAGCCAGTTATCCATCTGG + Intergenic
1070672919 10:78390479-78390501 CCAGAAGCCAGGTCTCCCTGAGG + Intergenic
1071708537 10:88025994-88026016 CCTTTAGCCAGTTCTCCACTTGG + Intergenic
1072853437 10:98921723-98921745 GCTGAGGCCAGTGCTCCATGAGG + Intronic
1073136011 10:101220812-101220834 GCTACATCCAGCTCTCCATGGGG + Intergenic
1073329454 10:102661092-102661114 GCTGCAGCCAGCCCTCCAAGGGG - Intergenic
1073496650 10:103897634-103897656 TCTGCACTCTGTTCTCCATGAGG + Exonic
1073880540 10:107975001-107975023 CCTGGAAGCAGTTCTCCATGAGG + Intergenic
1074448103 10:113537054-113537076 CCTTCAGCCACTTCACAATGTGG - Intergenic
1074974630 10:118570004-118570026 TCTCCAGCTGGTTCTCCATGGGG + Intergenic
1076861570 10:133140395-133140417 CCTACATCCACTTCTCCATCCGG + Intergenic
1077211451 11:1372586-1372608 CCTGTAGCCAGACCCCCATGGGG - Intergenic
1077300331 11:1843810-1843832 CCTGCAGCCAGTACCCCATGGGG + Intergenic
1077499500 11:2902788-2902810 CCAGCAGCCAGAGCTCCAAGGGG - Intronic
1077679175 11:4223505-4223527 GCTGCAGCCACTTCTCTAAGAGG + Intergenic
1077688611 11:4320147-4320169 GCTGCAGCCACTTCTCTAAGAGG + Intergenic
1078582176 11:12547160-12547182 CATGCTGCCACTCCTCCATGGGG + Intergenic
1079747784 11:24155188-24155210 ACTCCAGGCAGCTCTCCATGTGG - Intergenic
1081869331 11:46376214-46376236 CCCGCAGCCAGCTCGCCCTGCGG + Intronic
1083409845 11:62484602-62484624 CCTGTGGCCAGAGCTCCATGAGG + Intronic
1083552261 11:63598774-63598796 ACTGATGCCAGTTCTCCATTAGG - Intronic
1087714806 11:101595477-101595499 CCTGCAGCCAGTTCTTCATGTGG + Intronic
1088003795 11:104915986-104916008 CCAGCCGCCAGTTGTCCAAGGGG - Intergenic
1089398258 11:118149755-118149777 CCTGCTGCCAGTCCTCAAGGAGG - Intronic
1089752279 11:120660374-120660396 CCTGCAGCCCGCACTCCTTGAGG + Exonic
1091317965 11:134628934-134628956 CCTGTAACCAGTTCTGCGTGAGG + Intergenic
1092172969 12:6384777-6384799 CCAGCAGCCAGTTTTCCTGGGGG - Intronic
1093831736 12:23769413-23769435 CCTGTAGGTAGTTCTCTATGGGG + Intronic
1094161745 12:27398011-27398033 TCTGGAGCCAGTTCTGCCTGTGG + Intronic
1094433793 12:30398984-30399006 CCTGCACCCAGGCCTCCCTGGGG + Intergenic
1095586747 12:43858296-43858318 CCGGCTGCCAGTTCGCCATCTGG - Intronic
1096648681 12:53051477-53051499 TCTGCACACAGGTCTCCATGCGG + Intronic
1098287941 12:68927386-68927408 CCTTCACCCACTTCTCGATGGGG + Intronic
1099141003 12:78975172-78975194 ATGGAAGCCAGTTCTCCATGAGG + Intronic
1100598834 12:96094913-96094935 CCTGCATTCTGTTCTCCATACGG - Intergenic
1102453721 12:113058330-113058352 CCTTCAGCACGTTCTCAATGTGG - Exonic
1102875707 12:116447116-116447138 CCTCCAGCCAGCTCTCCTTTTGG - Intergenic
1103740945 12:123091209-123091231 CCTGCAGCCAGTTCATTAGGTGG + Intronic
1105215072 13:18279392-18279414 TCAGCAGCCACTACTCCATGTGG + Intergenic
1106355996 13:28983882-28983904 CCTGCAGTCAGTCCTTCCTGCGG - Intronic
1108729353 13:53217401-53217423 CCTGAAGTCACTTCTCCTTGTGG - Intergenic
1109795459 13:67306887-67306909 ACTGCATCCAGTTCACCATCTGG + Intergenic
1112629501 13:101145425-101145447 CATGCAGCGAGTTTTCCATTTGG + Intronic
1113424546 13:110197318-110197340 CCTGGAGCAAGTATTCCATGGGG - Intronic
1113809243 13:113128055-113128077 CCTCCCCCCAGTTCTCTATGAGG - Intronic
1114032033 14:18586602-18586624 CCTGCAGCCAGATATCCACCTGG + Intergenic
1114076812 14:19165632-19165654 CCTGCAGCCAGATATCCACCTGG + Intergenic
1114085349 14:19233936-19233958 CCTGCAGCCAGATATCCACCTGG - Intergenic
1114921969 14:27343367-27343389 CCTGCAGGCACATCACCATGTGG - Intergenic
1115661790 14:35502356-35502378 CCTCCAAACTGTTCTCCATGTGG - Intergenic
1115941751 14:38617964-38617986 CCTGCACCAAGTTCTTCATGTGG - Intergenic
1116601042 14:46922967-46922989 CATGCAGCCAGTTATCCTCGTGG - Intronic
1117588322 14:57237437-57237459 CCTGCACCCAGTTTCCCATTTGG - Intronic
1119551258 14:75515511-75515533 CCTGCAGCGATTTCTCCAGTAGG - Intergenic
1120337766 14:83179974-83179996 CTTGCAGCAAGTTCTCACTGTGG - Intergenic
1121493672 14:94377789-94377811 CCTGAAGCCCATTCTCCATGGGG - Exonic
1121614136 14:95301531-95301553 CTTGCAGCCATTTCACCCTGTGG - Intronic
1202896910 14_GL000194v1_random:15644-15666 CCTGCAGCCAGATATCCACCTGG - Intergenic
1125578539 15:40770492-40770514 CTTTCCGCCAGGTCTCCATGGGG - Exonic
1125768733 15:42151445-42151467 TGTGCAGCCATTTCTCCCTGGGG - Intronic
1126384882 15:48084090-48084112 CCTGCAGCAACTTCACCTTGGGG - Intergenic
1128345740 15:66851375-66851397 CCTGCAGCCTGTTCTCCACACGG - Intergenic
1128683406 15:69667296-69667318 CCTGCAGCCGGTTCTCAAGATGG + Intergenic
1128714043 15:69893956-69893978 CATGCAGCAAGTTCTCCCTGGGG + Intergenic
1129273464 15:74431524-74431546 TCTGGAGCCATTTCTCTATGAGG - Intronic
1131055838 15:89374299-89374321 CCAGCAAGCAGTTCTCCAGGCGG + Intergenic
1132375947 15:101328224-101328246 CCTGCAGCGTCTTCTCCCTGAGG + Intronic
1132537991 16:492810-492832 CTTGGAGCTAGTTCTCAATGTGG - Intronic
1132642097 16:982602-982624 TCTGGAGCCAGTTCTCCTGGCGG + Intronic
1133008512 16:2897644-2897666 CCTGCACCCAGCTCTCCCTGAGG + Intronic
1133125027 16:3641178-3641200 CCAGCAGCCACCCCTCCATGTGG + Intronic
1133817771 16:9211289-9211311 CCTGCAGCCAGTAATCCAAATGG + Intergenic
1133907012 16:10031646-10031668 CCTGCAGCCAGTTCTCCACGTGG + Intronic
1137512005 16:49108917-49108939 CCCACAGCCAGGTCTGCATGGGG + Intergenic
1137707329 16:50544706-50544728 CCTGGAGCCAGGGCTCCTTGAGG - Intergenic
1139161833 16:64519556-64519578 CCTCAAGCCAGTCCTCCATGGGG + Intergenic
1140774733 16:78239388-78239410 CCTGGACCCAGTTCTCCATCAGG - Intronic
1141091961 16:81136522-81136544 CCCGCAGCCAGTGCTCCCTGAGG + Intergenic
1141213134 16:81999602-81999624 CCTGCACCAAGTTATCCACGTGG + Exonic
1141350680 16:83292359-83292381 CCTGTGGCCACTTTTCCATGTGG + Intronic
1142004065 16:87680697-87680719 CTGGCACCCAGTTCTCCAAGGGG - Intronic
1142126144 16:88411602-88411624 CCTACACCCCGTTCTCCCTGAGG - Intergenic
1143007293 17:3845631-3845653 CCAGCAACCAGGTCTCCTTGTGG - Intronic
1144588488 17:16503615-16503637 CTGGCATCCAGGTCTCCATGAGG + Intergenic
1146608920 17:34287621-34287643 CCTGCACCCACTTCTTCTTGGGG - Exonic
1148344533 17:46894653-46894675 CCTGCCACCAGGTCTCCGTGGGG + Intergenic
1148695212 17:49554788-49554810 CATGCAGCCTGTGCTCCAGGTGG + Intergenic
1150221217 17:63496918-63496940 CATGCAGCTCGTTCTCCGTGCGG - Exonic
1152588655 17:81200340-81200362 CCTGAAGCAAGTGCTCCAGGCGG + Exonic
1152928501 17:83098741-83098763 CCTGCAGCCAGCTTTCCTTCTGG - Intergenic
1153048150 18:875446-875468 CATGAGGCCAGTTCCCCATGGGG + Intergenic
1153060032 18:985603-985625 TCTGAAGCCAGATCTGCATGTGG - Intergenic
1153756326 18:8287310-8287332 CATGCAGCCAGTGCTCCATCAGG - Intronic
1153770038 18:8408021-8408043 GCTGCAGCCAGCTCTTCCTGGGG - Intergenic
1158911554 18:62068166-62068188 CCTGTAGCACTTTCTCCATGGGG + Intronic
1159923282 18:74246041-74246063 CATGCAGCCAGCTCTGCATCTGG - Intergenic
1162043261 19:7983108-7983130 CGTGCAGTTAGTTCTGCATGGGG + Intronic
1165161830 19:33820860-33820882 TCTGCAGCCCGCTCTCCAGGTGG - Intergenic
1166295032 19:41884694-41884716 TAAGAAGCCAGTTCTCCATGGGG - Intronic
1166416898 19:42601851-42601873 CCTGCACCACGTTCTCCGTGTGG + Intronic
1167430146 19:49449474-49449496 CTTGCATCCAGTTCTGCATGAGG + Exonic
925223517 2:2162150-2162172 CCTGAAGGCAGACCTCCATGGGG + Intronic
925285930 2:2715697-2715719 CCTGCGGCCAGTTCCCCACGTGG + Intergenic
925290118 2:2742187-2742209 CTTGAAGCCATTTCTCTATGTGG - Intergenic
925505727 2:4561416-4561438 ACTACAGCCAGTTCCCCCTGGGG - Intergenic
926153188 2:10435773-10435795 CCTGGAGTCAGTGCTGCATGTGG + Intergenic
927714404 2:25342455-25342477 CCTGCGGCCAGTGCTGGATGCGG - Exonic
928221014 2:29402754-29402776 CCTAGGGCCAGTTCTCCCTGAGG + Intronic
928255987 2:29723051-29723073 CCTTCAGTCTGTTCTCTATGTGG + Intronic
929361625 2:41098828-41098850 CGTGGAGCCAGTTCTCCCTCGGG - Intergenic
929568764 2:43006699-43006721 CCTGCAGCCCATACTCCTTGAGG - Intergenic
930573713 2:53119897-53119919 ACTGAGGCCAGTTCTCCTTGTGG - Intergenic
931124022 2:59253686-59253708 CCTGGAACCAGATGTCCATGTGG + Intergenic
931213270 2:60217575-60217597 CTTGAATCCAGGTCTCCATGTGG - Intergenic
932420381 2:71597907-71597929 CCTCCAGTCTGTTCTCCATGTGG + Intronic
932442729 2:71748106-71748128 ACAGCAGCCAGGACTCCATGGGG - Intergenic
933750658 2:85600553-85600575 CCTGGAACCAGTTGTTCATGAGG - Intronic
934547650 2:95232055-95232077 CCTCCACCCAGCTTTCCATGGGG - Intronic
934584660 2:95480466-95480488 GCTGCATCCGGTTCTCCATAAGG - Intergenic
934594793 2:95596249-95596271 GCTGCATCCGGTTCTCCATAAGG + Exonic
934787983 2:97029370-97029392 GCTGCATCCGGTTCTCCATAAGG - Intergenic
936715539 2:115182956-115182978 CCAGCAGCCTGTTGTCCATGGGG - Intronic
937692611 2:124772914-124772936 CCTGCAGGGAGGTCTCCTTGAGG - Exonic
938491411 2:131763141-131763163 CCTGCAGCCAGATATCCACCTGG + Intronic
938496150 2:131799182-131799204 CCTGCAGCCAGATATCCACCTGG - Intronic
939977000 2:148729605-148729627 CCTTCACCCAGTTTTCCATTTGG + Intronic
940118321 2:150235166-150235188 CCACCACCCAGTTCTCCAGGTGG - Intergenic
940806929 2:158198109-158198131 CCTCCTGCCAAATCTCCATGAGG - Intronic
942234312 2:173889547-173889569 CCTGCAGCCTGAACACCATGTGG - Intergenic
942258902 2:174137612-174137634 GCTGCAGCAAGTTCTCCAGAAGG - Intronic
948884640 2:240876639-240876661 GCTGCAGCCAGCTTCCCATGAGG + Intronic
1168833114 20:858240-858262 CCTGCAGCCCATTCTCCACTTGG - Intergenic
1169587513 20:7102583-7102605 CCTCCAAACTGTTCTCCATGTGG - Intergenic
1170013110 20:11749648-11749670 CCTGAAGTCAGTTCTCTCTGGGG + Intergenic
1170983987 20:21241651-21241673 CCTGAAGCCATGTCTCTATGAGG - Intronic
1174422703 20:50410487-50410509 CTTGCAGCTAGGTGTCCATGTGG + Intergenic
1175544679 20:59770742-59770764 CCTCCTGCAATTTCTCCATGGGG - Intronic
1176616598 21:9031640-9031662 CCTGCAGCCAGATATCCACCTGG - Intergenic
1176708531 21:10131992-10132014 CCTGCAGCCAGATATCCACCTGG + Intergenic
1177191020 21:17851137-17851159 ACTGCAGCCAGTCTTCCAGGAGG - Intergenic
1179902573 21:44401675-44401697 CCTGCAGCCTCTTCTCCCTGCGG - Exonic
1180292622 22:10859257-10859279 CCTGCAGCCAGATATCCACCTGG + Intergenic
1180456146 22:15513659-15513681 CCTGCAGCCAGATATCCACCTGG + Intergenic
1180495427 22:15888679-15888701 CCTGCAGCCAGATATCCACCTGG + Intergenic
1182074711 22:27487839-27487861 CCTGCAGTCAATTCTCCACATGG + Intergenic
1182353439 22:29711341-29711363 CCTTCAGCCAGGTCACCCTGTGG - Intergenic
1183402819 22:37614565-37614587 CCTGCAGCCAGTGCTTTGTGGGG + Intronic
1183646879 22:39132183-39132205 CCTGCAGCCCTTTCTGCATGGGG - Exonic
949752722 3:7373528-7373550 CAAGAAGCCAGTCCTCCATGAGG + Intronic
950666361 3:14497690-14497712 CCTGCAGCCCAGTCTTCATGTGG - Intronic
950768558 3:15292471-15292493 CCTGCAACCAGTCCCCCACGCGG + Intronic
950799996 3:15542896-15542918 GCTGCAGCCAGTTCTCCAGTGGG + Intergenic
952927918 3:38335372-38335394 CCTGCATCCAGTGCGACATGAGG - Intergenic
954302125 3:49705598-49705620 CCAGCAGCGAGTTCTCGGTGAGG - Exonic
954720178 3:52554784-52554806 CATGCAGCCACTTCACCCTGGGG - Exonic
956105320 3:65811414-65811436 CTTCCTGCCAGATCTCCATGGGG + Intronic
959975139 3:112450332-112450354 CTGGGAGACAGTTCTCCATGAGG + Intergenic
960160941 3:114350239-114350261 CCTGCTGCCAGGCCTCCAGGTGG + Intronic
961552409 3:127676868-127676890 CCTGCAGCCAGGTGGCCAGGTGG + Intronic
961723147 3:128909138-128909160 CCTCCTGCCAGATCTCCTTGTGG + Intronic
962680334 3:137792773-137792795 TCTGCAGCCAGCTGTCCAGGAGG + Intergenic
963907063 3:150781540-150781562 CCTCCAACCCATTCTCCATGTGG - Intergenic
964725921 3:159814411-159814433 CCTGCACCCAGTGCTCTATAAGG + Intronic
965215992 3:165865398-165865420 CGTGCAGCCAGCTCACCACGTGG - Intergenic
965844661 3:172947151-172947173 CCTGCAGCCATCTCTGCATTAGG - Intronic
966928777 3:184662481-184662503 CCTGCAGCCAGCCCTCCAGGGGG + Intronic
967953259 3:194857200-194857222 CCTGCCCCCCGTTCTCCTTGTGG + Intergenic
968643760 4:1728354-1728376 CCTGCAGCCACTTCTTCCTGAGG - Exonic
968960535 4:3741001-3741023 CCTCCAGCCTGTCCTCCAAGTGG - Intergenic
969304337 4:6317278-6317300 CCTGCCGCCAGGTCTTCCTGGGG + Intergenic
969599089 4:8165350-8165372 CATGCAGCCAGGTCCCCAGGAGG + Intergenic
975136770 4:70882506-70882528 AATGCAGCCATTTATCCATGAGG + Intergenic
975185934 4:71402753-71402775 CCTTCAGCCAGGTGTCCCTGAGG + Intronic
975384642 4:73741985-73742007 TCTGCACCCAGTTTTCCTTGGGG - Exonic
976228469 4:82815977-82815999 CTTGCAGCCATTTCTCTATGTGG - Intergenic
977652272 4:99484645-99484667 TCTGCAGCCAGAACTCAATGGGG - Intergenic
979494420 4:121368519-121368541 CCTGCAACCAGTTCTTCATGTGG - Intronic
979790223 4:124771258-124771280 ACTGCAGCAAGGTTTCCATGTGG - Intergenic
980681742 4:136171449-136171471 CCAGCATGCTGTTCTCCATGGGG - Intergenic
981004406 4:139860344-139860366 CTTCCAGAAAGTTCTCCATGAGG + Intronic
981491685 4:145346622-145346644 CTTCCAGAAAGTTCTCCATGAGG + Intergenic
984536577 4:180983212-180983234 ACTTCAGCCTCTTCTCCATGTGG + Intergenic
985677079 5:1237687-1237709 CAGACAGCCAGTGCTCCATGGGG + Intronic
986015057 5:3750586-3750608 TTTGCAGACAGTTCTCCAGGTGG + Intergenic
986068476 5:4259196-4259218 CCTGCTGCTGCTTCTCCATGTGG - Intergenic
987091101 5:14508260-14508282 CCTGCAGCCACTGCTCCTGGAGG - Exonic
988219576 5:28325224-28325246 TCTGCAACCAGGTCTCCCTGAGG + Intergenic
990546347 5:56825586-56825608 CTTGCATTCAGATCTCCATGTGG + Intronic
993771421 5:91932572-91932594 CATTCAGACACTTCTCCATGTGG + Intergenic
993932067 5:93953351-93953373 CCTGCAGCCATATCTGCATTAGG + Intronic
994440635 5:99799112-99799134 CCAATAGCCAGCTCTCCATGAGG - Intergenic
995240715 5:109883017-109883039 CCTCCAGGAAGTTCTCCATGTGG - Intergenic
997474880 5:134137049-134137071 CCTGCAGCCAGGTCTTCCTGGGG + Intronic
997962807 5:138335434-138335456 CCTGGAGCCAGTCATCCAGGAGG - Intronic
998226361 5:140329786-140329808 CCTGCAGCCATTTCTCAAGACGG - Intergenic
998232140 5:140367560-140367582 CCTGCAGTCTGTATTCCATGCGG - Exonic
998446678 5:142204293-142204315 CCTGCAGCCAGTTGGGCATTGGG + Intergenic
1000601330 5:163278718-163278740 CCTGTATCAAGTTCTCCATTTGG - Intergenic
1001527291 5:172437865-172437887 CCTGCCGCCATTTCCCCATTTGG - Intronic
1001570059 5:172725014-172725036 CCTGCAGACAGGTCCCCGTGGGG + Intergenic
1002018559 5:176346689-176346711 CTTGCAGCTAGTTCTTCATGTGG - Exonic
1002066968 5:176656744-176656766 CCTGCAGCCACTTCTCAAACTGG - Exonic
1002576047 5:180174685-180174707 CCTGCACCCAGGATTCCATGTGG - Intronic
1005285000 6:24315828-24315850 TCTGCAGTCTCTTCTCCATGTGG - Intronic
1005681954 6:28216927-28216949 CATGCAGCCTCTTCTCCCTGGGG - Intergenic
1006403487 6:33831172-33831194 CCTGCAGCCTGTCCCACATGGGG - Intergenic
1006463524 6:34177533-34177555 CCAGCAGCCAGCCCTCCCTGGGG + Intergenic
1006614648 6:35318177-35318199 CCTGCAGCCGGATCGCCATCTGG - Exonic
1006831249 6:36969549-36969571 ACTGCTGCCAGTTCCCCACGTGG + Intronic
1007663328 6:43499718-43499740 CTTGCAGCCATATCTCCATCTGG + Intronic
1007732027 6:43953256-43953278 ACTGCAGCATGGTCTCCATGGGG + Intergenic
1008488635 6:52062549-52062571 CCTAATGCCAGTTCTCCATTTGG - Exonic
1016047604 6:139496704-139496726 CCTGCAGCCAGGGCTCCCAGTGG + Intergenic
1016872261 6:148830036-148830058 CCTGAAGCCTCTTGTCCATGAGG + Intronic
1017002606 6:150006363-150006385 CCTGCAGACCGCTCTCCATGTGG - Intergenic
1017764376 6:157594679-157594701 ACTACACCTAGTTCTCCATGTGG + Intronic
1018369658 6:163156144-163156166 CCTGCAGCCTCTTCTCCATCAGG + Intronic
1018392505 6:163351160-163351182 CCTGCTGCCAGTTCTTCTTCTGG - Intergenic
1018838725 6:167504117-167504139 CCTGCAGAAAGTTCACCGTGGGG + Intergenic
1018920164 6:168166991-168167013 CCTGCAGGCAAATCTGCATGAGG + Intergenic
1019130676 6:169871239-169871261 CCTCCACACTGTTCTCCATGGGG + Intergenic
1019345080 7:525718-525740 CCTCCAGCCCCTTCTCCATGAGG - Intergenic
1019640079 7:2098678-2098700 CCTGCTGCCACTGCTCCAGGAGG + Intronic
1019713118 7:2526361-2526383 CCTGCTGCAGGTTCTCCAGGTGG - Exonic
1020667789 7:11069369-11069391 CTTGAAGGCACTTCTCCATGCGG - Intronic
1022502024 7:30887708-30887730 CCTGCAGCCTGGGCTCCAGGTGG - Intronic
1022655363 7:32314481-32314503 CCTGTAACCAGTTATCCATCTGG - Intergenic
1023588403 7:41755054-41755076 TCTGAGGCCAGTTCTCCAAGGGG + Intergenic
1024352557 7:48381757-48381779 CCAGCAGGCAGTTCCCCTTGAGG + Intronic
1024584210 7:50827058-50827080 GATGCAGCCACTTCTCCAGGAGG - Intergenic
1025248122 7:57332983-57333005 CTTGCAGCTAGGTGTCCATGTGG - Intergenic
1025752601 7:64306705-64306727 CCTGCTGCCCTGTCTCCATGGGG - Intergenic
1026019138 7:66694583-66694605 CCTCCAGCTGGTTCTCCATAGGG - Intronic
1026197189 7:68183451-68183473 GTTGCAGCCTGTTCGCCATGGGG - Intergenic
1028156482 7:87435551-87435573 CCTGAAGCCAGTTATCCTTCAGG - Intronic
1029975216 7:104827196-104827218 CCTGCAGCCAGTTCTCCATGTGG + Intronic
1030201615 7:106911450-106911472 CATGCAGCCAGTTGGCCATGCGG + Intergenic
1031895168 7:127340023-127340045 CCTGCAGCCACTTTCCCTTGAGG + Intergenic
1032036561 7:128525697-128525719 CCTGGAGCCAGTCCTGCCTGGGG - Intergenic
1032543619 7:132724457-132724479 CCTCCAGCCCCTTCTCCATGTGG + Intronic
1034099077 7:148436194-148436216 CCTGCACTCAGTCCCCCATGGGG + Intergenic
1035303215 7:157911221-157911243 CATGCAGACGTTTCTCCATGGGG - Intronic
1035346975 7:158206731-158206753 CCTGCAGCCATATCTGCATTAGG - Intronic
1037542376 8:19884897-19884919 TATGCGGCCAGTACTCCATGGGG + Intergenic
1037810409 8:22083176-22083198 CCTGCAGGCAGTCCTCCTTCTGG - Intergenic
1039148999 8:34481901-34481923 TATGAAGCCATTTCTCCATGGGG + Intergenic
1039736003 8:40333641-40333663 CTAGCAGCCAGTTCTCTCTGAGG + Intergenic
1039892650 8:41695457-41695479 CCTGCAGGCAGGTCTCTAAGTGG + Intronic
1043015836 8:74939936-74939958 ACTGCAGCCATATCTGCATGAGG + Intergenic
1043908740 8:85836272-85836294 CATGAAGCCAGATCTCCAGGCGG + Intergenic
1048420953 8:134277881-134277903 TCTGCAGCCCATTCTCCACGAGG - Intergenic
1048919062 8:139211285-139211307 CCTGCATCCTCTTCTCCAAGGGG + Intergenic
1050897835 9:10906343-10906365 ACTGCAACCCGTTCTCCATACGG + Intergenic
1051287470 9:15511186-15511208 CCTGCCGCAAGTTCCCCCTGCGG + Intergenic
1051599948 9:18862755-18862777 CCTGCAGCCAGGCCTCCCTAGGG + Intronic
1051713333 9:19956038-19956060 CCTGCAGCCAGTTCTTAATGTGG - Intergenic
1051747480 9:20308713-20308735 TCTGCCTCCAGATCTCCATGTGG - Intergenic
1052391880 9:27888845-27888867 CCTGGAGCCAGGTGGCCATGTGG - Intergenic
1053645498 9:40117505-40117527 CCTGCAGCCAGATATCCACCTGG + Intergenic
1053760216 9:41346022-41346044 CCTGCAGCCAGATATCCACCTGG - Intergenic
1054326516 9:63715406-63715428 CCTGCAGCCAGATATCCACCTGG + Intergenic
1054539075 9:66258467-66258489 CCTGCAGCCAGATATCCACCTGG - Intergenic
1055637761 9:78295371-78295393 CCTGCAGCCATTCCTCCCGGGGG - Intergenic
1056538934 9:87554854-87554876 GCTTCAGCCAGTTCTCCTGGAGG + Intronic
1057325699 9:94061495-94061517 CCTGGTAGCAGTTCTCCATGAGG + Intronic
1058993461 9:110276479-110276501 CCTGAAGGCTGTTCTCCATCTGG + Intergenic
1060269476 9:122130723-122130745 CCTGCCCCCAGTTCTGCATCTGG + Intergenic
1061902271 9:133678998-133679020 TCTGCACCCAGTTCTGCCTGAGG + Intronic
1062021964 9:134323990-134324012 CATGCAGACAGATTTCCATGTGG - Intronic
1062193064 9:135257514-135257536 CCTGCAGCCAGCTCTCCCCAGGG - Intergenic
1202793292 9_KI270719v1_random:100961-100983 CCTGCAGCCAGATATCCACCTGG + Intergenic
1185753689 X:2635283-2635305 CCTGCAGCCACCTCTCCAAGGGG + Intergenic
1186644505 X:11492036-11492058 CCTTCACCCAGTTTTCGATGGGG + Intronic
1186655935 X:11612130-11612152 CCTGAAGCCAGCTGTACATGTGG - Intronic
1188161724 X:26813481-26813503 CCTGCAGCCATATCTGCAGGAGG + Intergenic
1189847748 X:45152022-45152044 CCTGCCACCAGTGCTCCTTGAGG + Intronic
1192858366 X:75039092-75039114 ACTGCAGCCATATCTCCATTAGG + Intergenic
1193181797 X:78467046-78467068 CCTTCACCCACTTCTTCATGGGG + Intergenic
1197865023 X:131008304-131008326 CCTGCAGCCAGAGCTGCAGGGGG - Intergenic
1199824955 X:151489543-151489565 CCTGCATCCAACTCTCCATAGGG + Intergenic
1199848559 X:151709006-151709028 CCTGCAGCCTGTTTTCCACATGG - Intergenic
1201150006 Y:11090491-11090513 CCTGCAGCCAGATATCCACCTGG - Intergenic
1201264364 Y:12191792-12191814 TCTGCCTCCAGTTCTCCAGGTGG - Intergenic