ID: 1029975332

View in Genome Browser
Species Human (GRCh38)
Location 7:104828302-104828324
Sequence CTGGGGAATTTGAGGTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 416}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029975332_1029975347 30 Left 1029975332 7:104828302-104828324 CCCACCAACCTCAAATTCCCCAG 0: 1
1: 0
2: 0
3: 33
4: 416
Right 1029975347 7:104828355-104828377 ATTCACAAGAAAAAAGGTCCAGG No data
1029975332_1029975346 24 Left 1029975332 7:104828302-104828324 CCCACCAACCTCAAATTCCCCAG 0: 1
1: 0
2: 0
3: 33
4: 416
Right 1029975346 7:104828349-104828371 CACTGAATTCACAAGAAAAAAGG 0: 1
1: 0
2: 3
3: 33
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029975332 Original CRISPR CTGGGGAATTTGAGGTTGGT GGG (reversed) Intronic
900311254 1:2034296-2034318 CTGGGGGATGTGAGCTGGGTGGG - Intergenic
900885947 1:5415527-5415549 TTGGTGAATTTGAGGCTGCTTGG - Intergenic
902635929 1:17735205-17735227 CTGGAGAATCTGGGGTTGCTTGG + Intergenic
902675177 1:18003637-18003659 TAGGGGAAGTTGAGGGTGGTAGG + Intergenic
903796076 1:25929851-25929873 CTGTGGAATGTGGGGTTGGGGGG - Intergenic
904751801 1:32745315-32745337 TTTGGGAGTTTGAGGTGGGTGGG + Intronic
905301955 1:36991656-36991678 CTGGGGAATGTGAGGTTCCTGGG - Intronic
906712930 1:47945035-47945057 CTGGGGAAGTTGGGGGTGGGTGG + Intronic
906890660 1:49709406-49709428 CTGGGACACTTGAGCTTGGTGGG - Intronic
906994519 1:50777308-50777330 CTCGGGAAGCTGAGGTGGGTGGG + Intronic
907250045 1:53132067-53132089 TTAGGGAACTTGAGGCTGGTGGG + Intronic
908601399 1:65744049-65744071 CTGGGACATTTGAGCTTGGTTGG - Intergenic
908929269 1:69297442-69297464 CTGGGGTTTTTTTGGTTGGTAGG + Intergenic
909415672 1:75402986-75403008 CTGGGACACTTGAGGTTGATGGG + Intronic
911318116 1:96379253-96379275 CTGGTGGATTTGGGTTTGGTTGG - Intergenic
911508917 1:98787572-98787594 CTGGGGTTTTTATGGTTGGTAGG - Intergenic
911692040 1:100845490-100845512 CTGGGATGTTGGAGGTTGGTGGG - Intergenic
911941868 1:104057365-104057387 CTGGGACACTTGAGCTTGGTGGG + Intergenic
912848557 1:113101026-113101048 CTAGGGGATTGGAGGTTAGTTGG + Intronic
913507053 1:119526728-119526750 CAGGGGAGCTTGAGCTTGGTGGG - Intergenic
914399986 1:147309937-147309959 CTGGGCCTTTTTAGGTTGGTAGG - Intergenic
914665583 1:149829743-149829765 CTTTGGAATTTTAAGTTGGTTGG + Intergenic
914670182 1:149864051-149864073 CTTTGGAATTTTAAGTTGGTTGG - Intronic
915444116 1:155965233-155965255 CTGGGGGATGAGAGGCTGGTGGG - Intronic
916151439 1:161795957-161795979 CTGGGTAATTTGAGGATAGTTGG + Intronic
917248683 1:173033362-173033384 CTGAGGTTTTTGGGGTTGGTAGG - Intergenic
917713954 1:177714918-177714940 CTGGGCACTTTTTGGTTGGTAGG - Intergenic
918661101 1:187090039-187090061 CTGGGGAATAGGAGGCTGCTGGG + Intergenic
919381302 1:196864880-196864902 CTGGGCTATTTTCGGTTGGTAGG - Intronic
920985593 1:210885684-210885706 CTGGGACACTTGAGCTTGGTAGG + Intronic
921061940 1:211592544-211592566 CGGTGGAATCTGAGGGTGGTGGG - Intergenic
921306126 1:213798605-213798627 CTGGGCAATTTGAGGTCACTGGG - Intergenic
921807248 1:219470118-219470140 CTGGAGAAATTAAGGCTGGTAGG + Intergenic
921919033 1:220645426-220645448 CTGGGCTATTTTTGGTTGGTAGG - Intronic
922184649 1:223263506-223263528 CTGGGGGATTTGCGATGGGTGGG + Intronic
922347440 1:224708074-224708096 CTGGGGAACTTAAGGAAGGTAGG - Intronic
923711847 1:236394305-236394327 CTGGGGAATTTGTAGGTGGGAGG - Exonic
923736395 1:236612242-236612264 CTGGGGAATTTTACCTTGTTGGG - Intergenic
924829008 1:247573020-247573042 CTGGGACATTCGAGCTTGGTGGG - Intronic
924887637 1:248236926-248236948 CTGGGCATTTTTTGGTTGGTAGG - Intergenic
1062776767 10:156741-156763 GTGGAGAATTTCAGGTTGTTTGG + Intronic
1062824052 10:555979-556001 CTTGAGAATTTGAGGTGTGTTGG - Intronic
1063928855 10:11008993-11009015 CTGGGGAATTTGCGGGGGGGGGG + Intronic
1064206053 10:13324717-13324739 CTTGGGAAGCTGAGGTTGGGAGG - Intronic
1064569867 10:16681683-16681705 ATGGGGAAGCTGAGGTGGGTGGG + Intronic
1064677784 10:17779347-17779369 CTGGGCAATTTCAGCTTTGTAGG + Intronic
1065825482 10:29566848-29566870 CTGGGGAAGTTGGGGTTGAGGGG - Intronic
1065951883 10:30659736-30659758 CTCGGGAGGTTGAGGTTGGGGGG + Intergenic
1066257638 10:33696134-33696156 CTGGGATACTTGAGCTTGGTTGG - Intergenic
1066282551 10:33931827-33931849 CTGGGGAATTTGGAGAGGGTGGG + Intergenic
1067319699 10:45205917-45205939 GTGGGGAGTTTGAGGTTGCTTGG + Intergenic
1067762607 10:49059317-49059339 CTGGGCACTGTCAGGTTGGTTGG - Intronic
1068337718 10:55659164-55659186 CTGGGCAAGTTGAGTTTGGTAGG + Intergenic
1069214774 10:65805343-65805365 ATGGGGCATTGGAGGGTGGTAGG + Intergenic
1069496650 10:68910080-68910102 CTTGGGAGGCTGAGGTTGGTAGG + Intronic
1069822788 10:71237909-71237931 CTGGGGAAGATGAGGAAGGTGGG + Intronic
1070840531 10:79484275-79484297 CTGGGGAATTTGTGAATGGGTGG - Intergenic
1070914430 10:80144046-80144068 CTGGGGAAACTGAGGCAGGTAGG + Intronic
1070981556 10:80652538-80652560 CTGGAGAATTGGTTGTTGGTGGG - Intergenic
1071002017 10:80841599-80841621 CTGGGACACTTGAGCTTGGTGGG - Intergenic
1071190058 10:83089483-83089505 CTGGGACACTTGAGCTTGGTAGG + Intergenic
1071340969 10:84648276-84648298 CTGGGCTTTTTGTGGTTGGTAGG + Intergenic
1071481601 10:86069069-86069091 CTGGGGAAGGTTAGGTTGGGAGG + Intronic
1071541008 10:86483959-86483981 TTGGGGAAGTTGAGGCAGGTGGG - Intronic
1071859610 10:89658801-89658823 CTGAGGAATTTGTAGCTGGTTGG - Intergenic
1073102457 10:101013700-101013722 GTGGGAAAGTGGAGGTTGGTGGG + Intronic
1075887926 10:125917969-125917991 CTGGGGAGGCTGAGGTGGGTTGG + Intronic
1076163473 10:128263667-128263689 CTGGGGCTATTGAGGCTGGTGGG + Intergenic
1078325713 11:10379105-10379127 CTGGGGAATGTGGTGGTGGTAGG + Intronic
1079002957 11:16773094-16773116 CTCGGGAAGGTGAGGTTGGAGGG - Intergenic
1080710363 11:34741291-34741313 CTGGGCTATTTTTGGTTGGTAGG - Intergenic
1080933099 11:36833934-36833956 CTGGGCTCTTTTAGGTTGGTAGG + Intergenic
1080965310 11:37207706-37207728 CTGGGGTTTTTTTGGTTGGTAGG + Intergenic
1083774649 11:64888535-64888557 CTGGGGGCTTTCAGGCTGGTGGG + Intergenic
1083832434 11:65241489-65241511 CAGGGGAGGTTGAGGGTGGTGGG - Intergenic
1084132858 11:67150681-67150703 CTGGGGAATTAGAGGTGAGTTGG + Intronic
1084953014 11:72677054-72677076 CTGGGGAACTGGAGGTGGGATGG + Intergenic
1085616821 11:78006570-78006592 CTTGGGAGGTTGAGGTGGGTGGG + Intergenic
1087668127 11:101073843-101073865 CTGGGGTTTTTTTGGTTGGTAGG - Intronic
1087846450 11:102978928-102978950 CTGGGCATTTTTTGGTTGGTAGG + Intergenic
1087907696 11:103718221-103718243 CTGGGCTATTTCTGGTTGGTAGG + Intergenic
1088506086 11:110528753-110528775 CTGGGCTATTTCTGGTTGGTAGG + Intergenic
1089118028 11:116112036-116112058 CTGGGGAGATAGAGGTCGGTGGG + Intergenic
1091781723 12:3218225-3218247 CCGAGGAAGTTGGGGTTGGTGGG - Intronic
1092029476 12:5272257-5272279 ATGGGGAAATTGAGGTTTGGAGG + Intergenic
1092154311 12:6272574-6272596 CTGGGGAATATGGAGTTGGGTGG - Intergenic
1092859931 12:12711573-12711595 CAGGGGAATTTCATGTTGCTGGG + Intergenic
1093545045 12:20336460-20336482 CTGGGATGCTTGAGGTTGGTGGG - Intergenic
1094242812 12:28248219-28248241 AGGGTAAATTTGAGGTTGGTGGG + Intronic
1094660540 12:32466418-32466440 CTGGGGAATTTGCTCTTGCTTGG + Intronic
1094694682 12:32806342-32806364 CTGGGTTTTTTGTGGTTGGTAGG + Intronic
1095118395 12:38384263-38384285 CTGGGGTTTTTTTGGTTGGTAGG - Intergenic
1095954301 12:47797605-47797627 CTGGGCAATGTGGGGCTGGTAGG + Intronic
1096064705 12:48730342-48730364 CTGTGGAATGTAAGGTTGGAGGG + Intergenic
1097101057 12:56589847-56589869 ATGTGGAATTTGGGGTTGGGGGG + Exonic
1097355172 12:58593189-58593211 CTTGGGTCTTTGAGGTTGATGGG + Intronic
1097370233 12:58769875-58769897 CTGGGGTTTTTTGGGTTGGTAGG - Intronic
1097520884 12:60669467-60669489 CTGGGCTTTTTGGGGTTGGTAGG + Intergenic
1097654078 12:62340014-62340036 CTGGGCCTTTTGTGGTTGGTAGG + Intronic
1097948805 12:65403455-65403477 CTGGGAAGCTTGAGCTTGGTGGG - Intronic
1098984763 12:77000162-77000184 CTTGGGTATTTGGGGTTGGAAGG + Intergenic
1099053149 12:77805795-77805817 CTGGGGTTTTTTTGGTTGGTAGG + Intergenic
1099943955 12:89222849-89222871 CTGGGACAATTGAGCTTGGTTGG - Intergenic
1100386659 12:94110128-94110150 CTGTGGAATTACAGGTTGGAAGG + Intergenic
1101089146 12:101266841-101266863 CTGAGGAATTTGTGCTTAGTAGG + Intergenic
1101348763 12:103908585-103908607 CTGGGGAGTCTGAGGTGGGACGG + Intergenic
1101601238 12:106212236-106212258 CTGGGACTTTTGAGCTTGGTGGG - Intergenic
1102547525 12:113667443-113667465 ATGGGATATTTGAGGTTGGGGGG - Intergenic
1105355109 13:19652722-19652744 CTGGGCCACTTGAGCTTGGTGGG + Intronic
1105473600 13:20712851-20712873 CTGTGGAATTTGGGGATGGGAGG + Intronic
1105480444 13:20770953-20770975 CTGGGGAATTTGAGGCTGCAGGG - Intronic
1105672371 13:22633686-22633708 CTGGGGTTTTTTTGGTTGGTAGG + Intergenic
1106226537 13:27790739-27790761 CTGGGAAATTTGAGCTGGGCTGG - Intergenic
1107254156 13:38403432-38403454 CTAGGGCAGTTCAGGTTGGTTGG + Intergenic
1107955108 13:45504166-45504188 CTGGGGATCTTGAGGTAGCTGGG - Intronic
1107968076 13:45615277-45615299 CTGGGGAATTTGTTCCTGGTTGG + Intronic
1108355201 13:49623798-49623820 CTGGGGACTTGGTGGTGGGTAGG + Intergenic
1108674040 13:52721149-52721171 CTGGGACACTTGAGCTTGGTGGG - Intronic
1108922081 13:55688591-55688613 CTGGGGAAGTTGAGGCTGCAGGG - Intergenic
1110942035 13:81362839-81362861 CTGGGAAGGTTGAGCTTGGTGGG + Intergenic
1112157254 13:96831624-96831646 CTTGGGATTATGAGGTAGGTTGG - Intronic
1112231613 13:97593511-97593533 CTGGGGTGATTGAGCTTGGTGGG + Intergenic
1112659896 13:101496012-101496034 TTGTGGAATTTGAAGCTGGTGGG - Intronic
1112845252 13:103634962-103634984 CTGGGGAATTTTAGGATGATAGG - Intergenic
1113126728 13:106987474-106987496 CTGGGGAATTTGTTGTTGTTGGG + Intergenic
1114455082 14:22848842-22848864 CAGGGGCATCTGAGGGTGGTAGG + Intronic
1115461269 14:33663673-33663695 CTGGGGTTTTTTTGGTTGGTAGG + Intronic
1116890789 14:50266173-50266195 CTTGGGAATTTGAGTTTAGAGGG - Intronic
1117930538 14:60837071-60837093 CTGGGACACTTGAGCTTGGTGGG - Intronic
1118521477 14:66590666-66590688 CTGGGTATTTTTTGGTTGGTAGG - Intronic
1119915727 14:78399652-78399674 CTGGTGAATTTGTGGTTAGTTGG + Intronic
1119990221 14:79188567-79188589 CTGGGGAGTTTGAAGTTACTTGG - Intronic
1120193014 14:81456251-81456273 TTGGGGAAGCTGAGGTGGGTGGG - Intergenic
1120448711 14:84637601-84637623 CTGGGCTTTTTCAGGTTGGTAGG + Intergenic
1121405273 14:93715891-93715913 CTGGGTAAGTGGAGGTGGGTTGG + Intergenic
1121756427 14:96406578-96406600 CTGGGGGGTATGGGGTTGGTAGG + Intronic
1122262287 14:100530491-100530513 CTGGGGCCTGTGAGGCTGGTGGG - Intergenic
1122474773 14:101999625-101999647 CTGGGGAAGTTGTGGCTGGCAGG + Intronic
1122707236 14:103629093-103629115 CTGGGGAAACTGAGGCTGGGTGG - Intronic
1202891188 14_KI270722v1_random:159518-159540 CTGGGGAGTCTGAGGTGGGAGGG + Intergenic
1124460112 15:29882143-29882165 TTGGGGAATTTAAGGTTGGCTGG - Intronic
1124666707 15:31598797-31598819 CTGGGGCACTTGAGCTTGGTAGG + Intronic
1125219560 15:37317663-37317685 CTGGGAAGCTTGAGCTTGGTGGG + Intergenic
1125627563 15:41121194-41121216 CAGTGGAATTGGTGGTTGGTGGG - Intergenic
1125700015 15:41674132-41674154 CTTGGGAAGCTGAGGTAGGTGGG - Intronic
1125783422 15:42292136-42292158 CTGTGAAATTGGAGGCTGGTGGG + Intronic
1125787595 15:42334979-42335001 CTGGGCTATTTTTGGTTGGTAGG - Intronic
1126050831 15:44683380-44683402 CTGGGACACTTGAGCTTGGTGGG + Intronic
1126095821 15:45089194-45089216 CTGAGGAGTTTGCGGTTTGTGGG - Intergenic
1126376521 15:48002367-48002389 AAGGGGAATTTGAGATGGGTGGG - Intergenic
1127145859 15:56022894-56022916 CTAGGGATTTTTTGGTTGGTAGG + Intergenic
1128153284 15:65376833-65376855 GTGGGGAACTTGAGGTGGGAGGG + Intronic
1128379159 15:67098838-67098860 CTGGGGGATTTGGGGACGGTGGG + Intronic
1130173501 15:81543352-81543374 CTGGGGCAATGCAGGTTGGTTGG + Intergenic
1130442233 15:83966540-83966562 CTGGGCTTTTTGTGGTTGGTAGG - Intronic
1130627629 15:85532172-85532194 CTGTGTAATTTTAGGGTGGTAGG - Intronic
1130709127 15:86262154-86262176 CTGGGGAATGGGAGGCTGTTTGG - Intronic
1131523016 15:93130747-93130769 CTGAGAAATATCAGGTTGGTGGG + Intergenic
1131714592 15:95094778-95094800 GTGGGGAATGGGAGGTTGGGAGG - Intergenic
1131959759 15:97777147-97777169 CTGGGCTTTTTGTGGTTGGTAGG - Intergenic
1133154596 16:3864109-3864131 CTGGGGAATCTGAGGTGGCTGGG - Intronic
1136659546 16:31744752-31744774 CTGGGCATTTTTTGGTTGGTAGG + Intronic
1136931020 16:34418096-34418118 CTTGGGAAGCTGAGGTAGGTGGG - Intergenic
1136973553 16:34993712-34993734 CTTGGGAAGCTGAGGTAGGTGGG + Intergenic
1137336116 16:47550845-47550867 CTGGGGTTTTTTTGGTTGGTAGG + Intronic
1137576960 16:49606481-49606503 CTGGGATAATTCAGGTTGGTGGG - Intronic
1137750208 16:50855890-50855912 CTGTGGACTTTGAGGTGGGGAGG - Intergenic
1138226282 16:55298051-55298073 CTGGGGAAGTGGGGGATGGTGGG + Intergenic
1140154756 16:72412456-72412478 CAGTAGAATTTGAGGGTGGTGGG - Intergenic
1140472121 16:75221760-75221782 CCCGGGAATTTGAGGTTGCAAGG + Intronic
1142916124 17:3139962-3139984 CTGGGCAGTTTTGGGTTGGTAGG + Intergenic
1147224637 17:38967291-38967313 CTAAGAAATTTGAGGATGGTGGG - Exonic
1147731316 17:42604671-42604693 CTGGGGAATCGGGGGTTGTTGGG - Intronic
1148290719 17:46446270-46446292 CTTGGCATTTTGAAGTTGGTGGG + Intergenic
1148312910 17:46663975-46663997 CTTGGCATTTTGAAGTTGGTGGG + Intronic
1148449004 17:47762030-47762052 TTTGGGAAGTTGAGGTGGGTGGG + Intergenic
1148959571 17:51381983-51382005 CTAGGGAATTTGAGATTGCATGG - Intergenic
1150533484 17:66011087-66011109 CTGGGGTTTTTTTGGTTGGTAGG + Intronic
1151522683 17:74641569-74641591 CTGGGGAAGGGGAGGTGGGTGGG - Intergenic
1151558125 17:74857168-74857190 CTGGGGAGTTTGAGGGAAGTAGG - Intronic
1152638968 17:81441875-81441897 CTGGGGAAGTTGTGGTTGGCCGG - Exonic
1153702047 18:7704301-7704323 CTGGGCTATTTTTGGTTGGTAGG + Intronic
1153798463 18:8647016-8647038 CTGGGGCATTAGAGCTTGGTGGG + Intergenic
1153836110 18:8965547-8965569 CCGGGCAATCTGAGGGTGGTGGG - Intergenic
1155474580 18:26225448-26225470 CTCGGGAATCTGAGGTAGGAGGG + Intergenic
1155476582 18:26241213-26241235 CTGGAGTATTTTTGGTTGGTAGG + Intronic
1155935479 18:31748476-31748498 CTGGGGTTTTTTTGGTTGGTAGG + Intergenic
1156217807 18:35018434-35018456 CAGGGCAATTTTTGGTTGGTAGG + Intronic
1159066465 18:63573378-63573400 CTTGGCAATTTCAGGGTGGTAGG - Intergenic
1161149297 19:2698977-2698999 CTGCAGAATTTGAGCTTCGTTGG + Intronic
1161593179 19:5137842-5137864 CTGGGGAACTTCAGGAAGGTCGG - Intronic
1163410881 19:17153756-17153778 CTGGAGGATTGGAGGTGGGTGGG - Intronic
1164707298 19:30329395-30329417 CTGGGGAATGGGAGGTGGGGAGG + Intronic
1165126852 19:33604157-33604179 CTGGGGCTTCTGGGGTTGGTGGG - Intergenic
1165254884 19:34570385-34570407 CTGGTGAATTTGAGGTTAGACGG + Intergenic
1166694103 19:44842661-44842683 CTGGGAAGTTTGAGGTTAGAGGG + Intergenic
1167668985 19:50838959-50838981 CTGGGGGGTTTGAGGGAGGTAGG + Intergenic
1167910232 19:52695885-52695907 TTTGGGAAGCTGAGGTTGGTGGG - Intergenic
1167974112 19:53210152-53210174 CTGGGACACTTGAGCTTGGTGGG - Intergenic
1168180871 19:54662378-54662400 CTGGTGGCTTTGAGGTTGGAGGG + Intronic
1202666609 1_KI270708v1_random:126356-126378 CTGGGGAGTCTGAGGTGGGAGGG + Intergenic
925071459 2:971265-971287 CTGGGGATTTTCTGGTTGATAGG + Intronic
925148651 2:1599962-1599984 CCAGGGAATTGGAGGGTGGTGGG - Intergenic
925647237 2:6048438-6048460 CTGGGGGTTTTTTGGTTGGTAGG - Intergenic
928584359 2:32743463-32743485 ATGGGAAATTTGAGATTTGTGGG - Intronic
929064745 2:37962540-37962562 CTGGGACATTTGAGCTTGGTGGG - Intronic
930855287 2:56009378-56009400 CTGGGGTATTTGCAGGTGGTGGG + Intergenic
931953351 2:67390150-67390172 CTGAGAAATTGGAGGTTGCTGGG - Intergenic
933834181 2:86232346-86232368 CTGGGGAATTGGGGGTAGTTGGG - Intronic
934726567 2:96624283-96624305 CTTGAGAATTTGATGGTGGTAGG + Intronic
935293509 2:101628956-101628978 CTAGGGAATTTCTGGTTGGAGGG + Intergenic
936274820 2:111086077-111086099 CTGGGCTATTTTTGGTTGGTAGG - Intronic
936808059 2:116361366-116361388 CTGGGGTTTTTTTGGTTGGTAGG - Intergenic
937143134 2:119618877-119618899 CTGGGACACTTGAGCTTGGTGGG + Intronic
937975251 2:127578265-127578287 CTGGGGAATGTGGGGTTCATGGG + Exonic
938265313 2:129923835-129923857 CTGGGGAGATTGAGGCAGGTAGG - Intergenic
939611587 2:144317260-144317282 CCAGGGATTTTGAGGTTGGAGGG + Intronic
940054532 2:149500063-149500085 CTGGGACACTTGAGCTTGGTGGG - Intergenic
940946500 2:159623985-159624007 CTGGGACACTTGAGCTTGGTGGG + Intergenic
941314811 2:163979298-163979320 CTTGGGAGGCTGAGGTTGGTGGG - Intergenic
941493170 2:166167581-166167603 GTGGGAAATGTGAGGTGGGTTGG - Intergenic
941559739 2:167029834-167029856 CTGGGCATTTTTTGGTTGGTAGG + Intronic
942010870 2:171761447-171761469 CTGGTGAATCTTAGGTTGCTGGG + Intergenic
942195882 2:173519658-173519680 GTGGGGAAATTGAACTTGGTAGG - Intergenic
942974783 2:182002938-182002960 CTGGGGGATTTCAGGGTTGTGGG - Intronic
943112025 2:183618608-183618630 CTGGGCTTTTTGTGGTTGGTAGG + Intergenic
943112347 2:183621805-183621827 CTGGGACACTTGAGTTTGGTGGG - Intergenic
943350714 2:186793294-186793316 CTGGGACACTTGAGTTTGGTGGG + Intergenic
945522280 2:210843687-210843709 CTAAGGATTTTGAGGTTGGTTGG + Intergenic
947132062 2:226938634-226938656 CTGGGCTTTTTGTGGTTGGTAGG - Intronic
947492121 2:230603932-230603954 CTGGGACACTTGAGCTTGGTGGG + Intergenic
947523569 2:230865601-230865623 CTGGGGAATTGGGGGTGGGGGGG + Intronic
947681421 2:232037384-232037406 CTGGGACACTTGAGCTTGGTGGG - Intronic
1169173258 20:3484139-3484161 CTTGGGAAGTTGAGGTGGGAGGG + Intronic
1169198650 20:3697040-3697062 CTGGGGACTTGGAGGGTGGAGGG - Intronic
1169496688 20:6122730-6122752 CTGGGGAGCTAGAGGTTGGGAGG - Intronic
1169497559 20:6129824-6129846 CTGGGGAATGGGAGGCTGGATGG + Intergenic
1170038440 20:12015265-12015287 CTTTGGAATTTGTGGTTGGTCGG + Intergenic
1170849109 20:19987921-19987943 CTGGGGAATCTGATGATTGTGGG + Intronic
1171397553 20:24847054-24847076 CTGGGCTTTTTGTGGTTGGTAGG + Intergenic
1172799192 20:37564413-37564435 CTGGAGTCTTTGAGGTCGGTGGG + Intergenic
1173042082 20:39473946-39473968 TTGGGGAATTTGAGCTGGGTAGG + Intergenic
1175032717 20:55971595-55971617 CTGGGGTATTTGAGGCTGACGGG + Intergenic
1177028429 21:15951811-15951833 CTGGGCATTTTTTGGTTGGTAGG + Intergenic
1178006563 21:28227219-28227241 CTGGCGAATTTCAGGCTGGCTGG - Intergenic
1178251362 21:31006491-31006513 CTGGGGAATCTGAGGATTGGAGG + Intergenic
1181809452 22:25394586-25394608 CTGGGCCATGGGAGGTTGGTAGG + Intronic
1182667483 22:31970449-31970471 CTGGGGATTAAGAGGGTGGTGGG + Intergenic
1182796508 22:32994990-32995012 CTGAGGAATGTGAGGTTCGGAGG + Intronic
1183825342 22:40382325-40382347 CTGGGGGATTGGTTGTTGGTAGG + Intronic
949226979 3:1705979-1706001 CTGGGACATTCGAGCTTGGTTGG + Intergenic
949661756 3:6287134-6287156 CTGGGGCATTAATGGTTGGTAGG - Intergenic
949861532 3:8509710-8509732 CTGGAAAATCTGAGGGTGGTTGG - Intronic
951687599 3:25362338-25362360 CTGGGACTTTTGAGTTTGGTCGG - Intronic
951826670 3:26876128-26876150 CTGGGACATTGGAGCTTGGTGGG + Intergenic
952003129 3:28809454-28809476 CTGGGAATTTTGGGGTTTGTGGG + Intergenic
952840550 3:37641757-37641779 CTGGTAAGTTTGAGGGTGGTGGG - Intronic
954813594 3:53263315-53263337 TTTGGGAAATTGAGGTGGGTGGG - Intergenic
956005816 3:64777078-64777100 CTGGGACACTTGAGCTTGGTTGG + Intergenic
958698919 3:97563259-97563281 TTGGAGAATTTGATGTTGGAGGG + Intronic
959828683 3:110833480-110833502 CTGGGGTTTTTTTGGTTGGTGGG + Intergenic
960040354 3:113144084-113144106 CAAGGGAATTTCAGGTTGGAAGG + Intergenic
960586881 3:119328301-119328323 TTGTGGAATTTGGGGTTGGAAGG + Intronic
962666048 3:137654502-137654524 CTGGGGTGTTCGAGCTTGGTTGG + Intergenic
962765718 3:138560663-138560685 CTGGGACACTTGAGCTTGGTGGG + Intronic
963628977 3:147709748-147709770 CTGGGCATTTTTTGGTTGGTAGG + Intergenic
964753447 3:160073527-160073549 CTGGGTAATTTGTGTTTGGATGG + Intergenic
965091061 3:164163261-164163283 CTGGGATATTTGAACTTGGTGGG - Intergenic
965320895 3:167250287-167250309 CTGGGAATTTTGGGGTTTGTGGG - Intronic
965511109 3:169568509-169568531 CTGGGACATTTGAGCTTGGTGGG + Intronic
968006571 3:195247244-195247266 CTGTGAAATCTGAGGGTGGTCGG + Intronic
968217874 3:196909274-196909296 CTGGGCTTTTTGTGGTTGGTAGG - Intronic
968979079 4:3837045-3837067 CTGGGGAGATGGAGCTTGGTAGG - Intergenic
969572936 4:8020635-8020657 TTGGCGAATTTGCAGTTGGTTGG - Intronic
970125075 4:12800003-12800025 CTGGGGCCTATGAGGTTGGAGGG + Intergenic
970647793 4:18142658-18142680 CTGGGGAAGTTGAAGTGGGTGGG - Intergenic
970869883 4:20803547-20803569 CTTGGGAGATTGAGGTTGGGAGG + Intronic
971006411 4:22378764-22378786 CTGGGCTATTTTTGGTTGGTAGG + Intronic
971548347 4:27916094-27916116 TTGAGGAATTAGAGTTTGGTAGG - Intergenic
972150948 4:36090268-36090290 CTGGGATTTTTGTGGTTGGTAGG - Intronic
972219626 4:36939126-36939148 CTGGGCATTTTTTGGTTGGTAGG - Intergenic
972934845 4:44121220-44121242 CTGGGGAAATTGAGCTTTATTGG + Intergenic
974411210 4:61543143-61543165 CTGGGGAAGTCGAGGTGGGGGGG - Intronic
975149954 4:71009793-71009815 TTGTGGAATATGAGGATGGTTGG + Intronic
976715941 4:88122461-88122483 CTGGGAAGCTTGAGCTTGGTGGG + Intronic
976767113 4:88609173-88609195 CTTGGGAGGTTGAGGTTGGAAGG + Intronic
977047212 4:92082482-92082504 CTGGGCTTTTTTAGGTTGGTAGG - Intergenic
977154807 4:93558597-93558619 CTGGGCATTTTTCGGTTGGTAGG - Intronic
977561338 4:98536843-98536865 CTGGGGCACTAGAGCTTGGTCGG - Intronic
978029945 4:103929033-103929055 CTGGGCTATTTCTGGTTGGTAGG - Intergenic
978090292 4:104707143-104707165 CTGGGACACTTGAGCTTGGTAGG + Intergenic
979012324 4:115387538-115387560 CTGGGACATTCGAGCTTGGTGGG + Intergenic
979035250 4:115707697-115707719 CTGGGCATTTTTTGGTTGGTGGG + Intergenic
979673099 4:123382215-123382237 CTTGGGGATTTGAGGTTTGTGGG - Intergenic
979996304 4:127435548-127435570 CTGGGGAAGCAGAGGTTGGGAGG + Intergenic
980887803 4:138782249-138782271 CTGGGCTTTTTGTGGTTGGTAGG + Intergenic
981089897 4:140721628-140721650 CTGTGGAATCTGAAGTAGGTAGG - Intronic
981273179 4:142868011-142868033 CTGGGACACTTGAGCTTGGTGGG + Intergenic
981760113 4:148184989-148185011 CTGGGGATTCAGAGGTTGGTAGG + Intronic
982323877 4:154109072-154109094 CTGGGATGCTTGAGGTTGGTGGG + Intergenic
982393623 4:154892284-154892306 CTGGGAAGCTTGAGCTTGGTGGG + Intergenic
982725603 4:158902835-158902857 CTGGGACGTTTGAGGTTGGTTGG - Intronic
983047479 4:163004569-163004591 CTGGGAAGCTTGAGCTTGGTAGG - Intergenic
983487470 4:168349106-168349128 CTGGGCTCTTTGTGGTTGGTAGG + Intergenic
985317750 4:188676218-188676240 CTGGGCTTTTTGTGGTTGGTAGG - Intergenic
985807965 5:2061205-2061227 CTGGGCTATTTTTGGTTGGTAGG + Intergenic
990183768 5:53191184-53191206 CTGGGACACTTGAGCTTGGTGGG - Intergenic
990782001 5:59375550-59375572 CTGGGGTTTTTTTGGTTGGTAGG - Intronic
991076333 5:62543314-62543336 CTGGAGTATTTTTGGTTGGTAGG + Intronic
991309127 5:65215408-65215430 CTAGGAAATTTGATGTTGCTGGG - Exonic
991397750 5:66222696-66222718 CTGGGACACTTGAGCTTGGTGGG - Intergenic
992254879 5:74911616-74911638 CTGGGACACTTGAGCTTGGTTGG - Intergenic
992371388 5:76147577-76147599 CTGGGGAATTTGAGAGTAGAGGG + Intronic
992572043 5:78068614-78068636 CTGGGCTTTTTGGGGTTGGTAGG - Intronic
993821292 5:92620091-92620113 CTGGGCTATTTTTGGTTGGTAGG + Intergenic
994465441 5:100123147-100123169 CTGGGAAGTTTGAGATTGGATGG - Intergenic
995258004 5:110069582-110069604 CTGGGGTTTTTTTGGTTGGTAGG + Intergenic
996242516 5:121221209-121221231 CTGGGACAATTGAGCTTGGTGGG + Intergenic
996378245 5:122838048-122838070 CTAGGGAGGTTGAGGTTGGGAGG + Intergenic
996691558 5:126345856-126345878 CTGGGGAAGTTGAGGTAGAATGG - Intergenic
996987126 5:129581063-129581085 CTGGGCTTTTTTAGGTTGGTAGG + Intronic
997979633 5:138460830-138460852 CTGGGGAAAATGAGGCTGGAAGG - Intergenic
998406091 5:141875673-141875695 ATTGGGAATTGGAGGTGGGTAGG + Intronic
998780142 5:145647368-145647390 CTGGGATGGTTGAGGTTGGTGGG - Intronic
998927491 5:147142401-147142423 CTGGGACAATTGAGCTTGGTTGG - Intergenic
999451058 5:151678576-151678598 ATGGGGAATCTGAGGTTGAGAGG + Intronic
1000194767 5:158947036-158947058 CTGGGATGCTTGAGGTTGGTGGG - Intronic
1000466949 5:161591017-161591039 CTGGGCTTTTTTAGGTTGGTAGG + Intronic
1000998038 5:167978662-167978684 GGGGGGAATTTGAGGTTTTTTGG + Intronic
1002609471 5:180405307-180405329 TTGGGGAATTGTAAGTTGGTGGG - Intergenic
1002807451 6:590854-590876 CTGAGAAATTTGAGCTTGGTGGG - Intronic
1004249808 6:14014622-14014644 GTGGGGCATGTGAGGTTGGGAGG - Intergenic
1005171491 6:22990429-22990451 CTGGGCAATTTTTGGTTGGTAGG + Intergenic
1005289189 6:24361647-24361669 ATAGGGAATTTTAGGTTGTTTGG - Intergenic
1005799829 6:29409806-29409828 CTGGGGAATCTGAGGTGACTAGG + Intronic
1007285688 6:40745875-40745897 CTGGGAAATGTGAGGTTGCAGGG - Intergenic
1008174235 6:48247076-48247098 CTGGGAACTTTCAGGTTAGTGGG + Intergenic
1008818049 6:55593128-55593150 CTGGGGAATCTGAGCTTTGAAGG - Intergenic
1009777106 6:68218804-68218826 CTGGGGTGCTTGAGCTTGGTGGG - Intergenic
1011001254 6:82590753-82590775 CTGGGGAATTTCAGGGTGGGAGG + Intergenic
1011174101 6:84541112-84541134 CTGAGACATTTGAGCTTGGTGGG + Intergenic
1011301444 6:85878757-85878779 CTGGGACACTTGAGCTTGGTTGG - Intergenic
1011318691 6:86065636-86065658 CTGGGACACTTGAGCTTGGTGGG - Intergenic
1012674633 6:102100017-102100039 CTGGGCTTTTTGTGGTTGGTAGG + Intergenic
1013625344 6:111931619-111931641 CTGGGGTTTTTTTGGTTGGTAGG + Intergenic
1014836551 6:126166963-126166985 CTGGGACACTTGAGCTTGGTGGG - Intergenic
1015691096 6:135924391-135924413 CTGGGGAAATTGAGGAAGCTAGG - Intronic
1016333384 6:142977779-142977801 CTGGGCTTTTTTAGGTTGGTAGG - Intergenic
1016752924 6:147650929-147650951 CATGGGAATTTGAGGCTAGTTGG + Intronic
1018671873 6:166185325-166185347 CTGGGCTATTTTTGGTTGGTAGG - Intergenic
1018764734 6:166924646-166924668 CTGGTGCATTTGATGCTGGTAGG - Intronic
1018990231 6:168668896-168668918 GAGGGGAATGCGAGGTTGGTGGG - Intronic
1019950756 7:4370423-4370445 CTGGGGAAATGAAGGTTGGAAGG + Intergenic
1020471390 7:8539342-8539364 ATGGGGAGTTAGAGGTTTGTTGG + Intronic
1020694468 7:11396642-11396664 CTGGGCTTTTTGTGGTTGGTAGG - Intronic
1021224550 7:18012683-18012705 CTGGGGCATTCGAGCTTGGTGGG - Intergenic
1021311627 7:19104829-19104851 CTGTTGAATTTCAGGTTAGTTGG - Intronic
1021564686 7:22005336-22005358 TTGGGGTTTTTGAGGTTGGAAGG - Intergenic
1022058850 7:26770304-26770326 CTGGGACACTTGAGCTTGGTGGG - Intronic
1022328626 7:29356428-29356450 GTGGGGAATTTGTGGATGTTGGG - Intronic
1022503740 7:30897845-30897867 CTGGGGAGTCTGGGGGTGGTGGG + Intergenic
1022513850 7:30963271-30963293 AAGGGGAAAATGAGGTTGGTTGG - Intronic
1024152979 7:46591323-46591345 CTGGGATATTCGAGCTTGGTGGG + Intergenic
1024580835 7:50799571-50799593 CTGGGTGATTTGAAGTTGTTAGG + Intergenic
1026467684 7:70668644-70668666 CTGGGGAATTTGAGGCCACTTGG - Intronic
1026606469 7:71820284-71820306 CTGGACAACTGGAGGTTGGTGGG - Intronic
1027944394 7:84726412-84726434 CTGGGCATTTTTTGGTTGGTAGG - Intergenic
1028144298 7:87304647-87304669 CTGGGACATTTGAGCTTGGTTGG + Intergenic
1028630270 7:92926532-92926554 CTGAGACATTTGAGCTTGGTAGG - Intergenic
1029975332 7:104828302-104828324 CTGGGGAATTTGAGGTTGGTGGG - Intronic
1030696628 7:112592022-112592044 CTGGGCATTTTTTGGTTGGTAGG - Intergenic
1031667192 7:124499195-124499217 CTTGGGAGGCTGAGGTTGGTAGG - Intergenic
1032367714 7:131315689-131315711 CTGGGACAATTGAGCTTGGTGGG + Intronic
1032604059 7:133330271-133330293 CTGGGACACTTGAGCTTGGTGGG - Intronic
1032659751 7:133970194-133970216 CTGGGACACTTGAGCTTGGTGGG - Intronic
1032883463 7:136114679-136114701 CTGGGGCACTTGAACTTGGTGGG - Intergenic
1033283971 7:140025186-140025208 CTGAGGAATCTGAGGTTTGGGGG - Intronic
1033494041 7:141876218-141876240 CTGGAGATTTTCTGGTTGGTAGG + Intergenic
1036917299 8:12816481-12816503 CTGGGGAACTTGAGAAAGGTAGG - Intergenic
1036968715 8:13330070-13330092 CTGAGGAAGTTGAGGTGGGAGGG - Intronic
1037685470 8:21135594-21135616 CTGGGGTTTTTTTGGTTGGTAGG + Intergenic
1040817211 8:51520694-51520716 CTGGGCAATGTGAAGTTTGTTGG - Intronic
1041785911 8:61633963-61633985 CAGTGGAGTTTGAGGTTAGTCGG - Intronic
1041891461 8:62874343-62874365 CTGGGGTTTTTTTGGTTGGTAGG - Intronic
1044509471 8:93058313-93058335 CTGGGACACTTGAGCTTGGTAGG - Intergenic
1044858645 8:96499971-96499993 CTGGACATTTTGGGGTTGGTTGG + Intronic
1044940254 8:97334989-97335011 CTGGGACACTTGAGCTTGGTGGG - Intergenic
1045389068 8:101697307-101697329 CTGGGCTTTTTTAGGTTGGTAGG - Intronic
1045673074 8:104578405-104578427 CTGGGCATTTTTTGGTTGGTAGG - Intronic
1046011805 8:108557501-108557523 CTGGGGGATGGGAGGGTGGTTGG + Intergenic
1046998778 8:120552716-120552738 ATGGGGAATTGGGGATTGGTGGG + Intronic
1047319915 8:123769080-123769102 CTCCGGAATTTCAGGATGGTGGG + Intronic
1047357096 8:124132849-124132871 CTGGGGTTTTTCTGGTTGGTAGG - Intergenic
1049104174 8:140601104-140601126 CTGGGGAACTTGAGAGTGGAGGG - Intronic
1050404490 9:5293370-5293392 CTGGGACATTCGAGCTTGGTTGG + Intergenic
1050819935 9:9865534-9865556 CTGGGAAATTTAAGGTTGAGAGG - Intronic
1051106176 9:13583027-13583049 CTGGTGAATTTGTGTTTGATAGG - Intergenic
1051596801 9:18832196-18832218 CTGGGGAAGTTCAGGATGGAAGG - Intronic
1052336387 9:27324462-27324484 CTGGGGCACTGGAGCTTGGTGGG - Intergenic
1052668011 9:31519228-31519250 CTGGGACACTTGAGCTTGGTCGG - Intergenic
1052824348 9:33164242-33164264 CGGGTGGTTTTGAGGTTGGTGGG - Intronic
1052967707 9:34353413-34353435 CTGGAGGGTTTGAGGGTGGTTGG - Intergenic
1053602644 9:39626153-39626175 CTGCTGAAGTTGAGGTTTGTGGG + Intergenic
1054250894 9:62716282-62716304 CTGCTGAAGTTGAGGTTTGTGGG - Intergenic
1054564999 9:66750795-66750817 CTGCTGAAGTTGAGGTTTGTGGG - Intergenic
1054741505 9:68810649-68810671 TTGGGGAATTAGAGGTTGAAAGG + Intronic
1054844977 9:69785252-69785274 CTGGGGAATTAGACGTCTGTAGG - Intergenic
1055887950 9:81086920-81086942 CTGAAGAATTGGAGGTTGGGGGG + Intergenic
1056136932 9:83639668-83639690 CTGGGGAAAATGGGGTTGGATGG + Intronic
1056939417 9:90942203-90942225 CTGGGGATGTTAAGGTAGGTGGG - Intergenic
1059728791 9:117035710-117035732 CTGGGGAAGGTGAGCTTGATTGG + Intronic
1059895437 9:118859123-118859145 CTGGGCATTTTTTGGTTGGTAGG - Intergenic
1061175760 9:128995669-128995691 GTGGGGTATTTGAGGGTGTTGGG + Intronic
1186014452 X:5175338-5175360 CTTGGGAAGCTGAGGTGGGTGGG - Intergenic
1186752113 X:12631975-12631997 ATGTGAAATTAGAGGTTGGTGGG - Intronic
1186832507 X:13404560-13404582 CTGGGACAATTGAGCTTGGTAGG + Intergenic
1186920087 X:14269317-14269339 CTGGGTAATTTGAGGCAGATAGG - Intergenic
1187756090 X:22528438-22528460 CTGGGCATTTTTCGGTTGGTAGG - Intergenic
1187784318 X:22866971-22866993 CTGGGACGCTTGAGGTTGGTAGG + Intergenic
1187800362 X:23055295-23055317 CTATAGAATTTTAGGTTGGTGGG - Intergenic
1187898220 X:24002734-24002756 CTGGGGAGTTTGAGGTGGGAGGG - Intronic
1189134385 X:38533558-38533580 CTGGGGAATTTGGGGCTTCTTGG + Intronic
1189189637 X:39089096-39089118 CTGGGACACTTGAGCTTGGTGGG + Intergenic
1189937767 X:46087411-46087433 CTGGGACACTTGAGGTTGGTGGG + Intergenic
1190959764 X:55234669-55234691 CTGGGACACTTGAGCTTGGTTGG - Intronic
1190977426 X:55419735-55419757 CTGGGGTTTTTTTGGTTGGTAGG - Intergenic
1191135080 X:57055378-57055400 CTGGGGTTTTTTTGGTTGGTAGG + Intergenic
1191174165 X:57482087-57482109 CTGGGACAATTGAGCTTGGTGGG - Intronic
1191601772 X:63016757-63016779 CTGGGACACTTGAGCTTGGTGGG - Intergenic
1192692126 X:73374976-73374998 CTGGGACAATTGAGCTTGGTGGG + Intergenic
1192729479 X:73788182-73788204 CTGGGCTATTTTTGGTTGGTAGG + Intergenic
1193068593 X:77283119-77283141 CTGGGACACTTGAGCTTGGTGGG + Intergenic
1193547963 X:82852636-82852658 CTGGGACACTTGAGCTTGGTAGG - Intergenic
1194139864 X:90196250-90196272 CTGGGACACTTGAGCTTGGTGGG + Intergenic
1194166523 X:90522616-90522638 CTGGGCACTTTGAGGAAGGTTGG + Intergenic
1194357014 X:92898098-92898120 CTGGGCTTTTTTAGGTTGGTAGG - Intergenic
1194901204 X:99514206-99514228 CTGGGACAATTGAGCTTGGTCGG + Intergenic
1195149582 X:102052516-102052538 CTGGGATATTTTCGGTTGGTAGG + Intergenic
1195735077 X:108004312-108004334 CTGGGGCATTTTTGATTGGTAGG - Intergenic
1196794448 X:119490950-119490972 GTGGGGAGTTTGGGGGTGGTGGG - Intergenic
1197302652 X:124800231-124800253 CTGGGCTTTTTGTGGTTGGTAGG + Intronic
1197319106 X:125006158-125006180 CTGGGGCAATCGAGTTTGGTAGG + Intergenic
1199469514 X:148178744-148178766 CTGGGGTTTTTTTGGTTGGTAGG + Intergenic
1200485611 Y:3765219-3765241 CTGGGACACTTGAGCTTGGTGGG + Intergenic
1200512792 Y:4100397-4100419 CTGGGCACTTTGAGGAAGGTTGG + Intergenic
1200665347 Y:6015093-6015115 CTGGGCTTTTTTAGGTTGGTAGG - Intergenic
1200760413 Y:7033345-7033367 CTGGAGAATTTTTGGTTGGTAGG - Intronic
1201782075 Y:17734217-17734239 CTGGGCATTTTTTGGTTGGTAGG + Intergenic
1201819478 Y:18171771-18171793 CTGGGCATTTTTTGGTTGGTAGG - Intergenic
1202626783 Y:56867933-56867955 CTGGGGAGGCTGAGGTGGGTTGG - Intergenic