ID: 1029977910

View in Genome Browser
Species Human (GRCh38)
Location 7:104851539-104851561
Sequence GGCCAACGCATTGGTCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 66}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029977910 Original CRISPR GGCCAACGCATTGGTCACCC TGG Intronic
900619321 1:3579790-3579812 GGCCAGGGCCTTGGTCCCCCAGG + Intronic
902757012 1:18555702-18555724 GGCCTCAGCATTGCTCACCCAGG + Intergenic
903333462 1:22609335-22609357 GTCCCACCCATTGGTCACCTTGG - Intergenic
912277633 1:108276382-108276404 TGCCAACAAATTGGTTACCCTGG - Intergenic
912290593 1:108417976-108417998 TGCCAACAAATTGGTTACCCTGG + Intronic
1064021270 10:11811038-11811060 GGCAAAAGCATTCATCACCCTGG - Intergenic
1075840172 10:125494577-125494599 GGACCAGGGATTGGTCACCCTGG + Intergenic
1080199581 11:29652919-29652941 GGCTTACTCATAGGTCACCCAGG - Intergenic
1084384296 11:68833020-68833042 TTCCCAGGCATTGGTCACCCGGG - Intronic
1090228534 11:125085736-125085758 GGCCAACGCTTTGGACCTCCAGG - Intronic
1106114148 13:26802348-26802370 GGCAAAGGCCTTGTTCACCCAGG - Intergenic
1111094673 13:83497155-83497177 GCCCAATGCATTGGTCGTCCTGG - Intergenic
1122088287 14:99321853-99321875 AGCAAACACTTTGGTCACCCTGG + Intergenic
1124439342 15:29675234-29675256 GGCCCCCGCTTTGGCCACCCAGG + Intergenic
1126451113 15:48810673-48810695 GGACCCCGCCTTGGTCACCCTGG - Intronic
1135510631 16:23080046-23080068 TGCCATCGCATTGGTCCCCGTGG - Exonic
1139249557 16:65481878-65481900 GGCCCACCCATAGGTCACCATGG + Intergenic
1144810751 17:17997381-17997403 GGCCAAGGTGTTGGTAACCCTGG - Intronic
1146172082 17:30642023-30642045 GGCAGAGGCTTTGGTCACCCTGG - Intergenic
1146345534 17:32058049-32058071 GGCAGAGGCTTTGGTCACCCTGG - Intergenic
1147671417 17:42178988-42179010 GGCCAACGCACAGGGCACACGGG - Exonic
1157753271 18:50196261-50196283 GGTCAATGCATTTGTCACCCTGG - Intergenic
1162990342 19:14298014-14298036 GGCAGAGGCTTTGGTCACCCCGG + Intergenic
1165019545 19:32912482-32912504 GGCCAGCCCATTGGAAACCCAGG - Intronic
1166822781 19:45590897-45590919 GGCCAATGCCTCGCTCACCCTGG - Exonic
926576285 2:14585771-14585793 GGCCAAGGCTTTGGTCAGCCAGG + Intergenic
927807943 2:26164775-26164797 GGCCACCTCAGAGGTCACCCAGG - Intergenic
932939038 2:76140002-76140024 GGGTAGGGCATTGGTCACCCGGG - Intergenic
934493487 2:94778495-94778517 GGCCAATGCAATGGATACCCAGG + Intergenic
938934302 2:136115744-136115766 GGGCAATGGATTGGTCATCCTGG - Exonic
947610741 2:231523747-231523769 GGCCAAGTCATTGCTCAGCCAGG - Exonic
1176300276 21:5095952-5095974 GGCCCCCACACTGGTCACCCAGG - Intergenic
1179856746 21:44165959-44165981 GGCCCCCACACTGGTCACCCAGG + Intergenic
1183367162 22:37412878-37412900 GGCCCACTCCTGGGTCACCCGGG - Intronic
1184974365 22:48050761-48050783 GGCTAGAGCATTGGTAACCCAGG - Intergenic
962447300 3:135478512-135478534 GGCCAACAAATTGGACAACCTGG - Intergenic
966861428 3:184233033-184233055 GGCTAATGCATTGGTGACGCAGG - Intronic
969695066 4:8729628-8729650 GGCCTTGGCAGTGGTCACCCAGG - Intergenic
970394919 4:15655760-15655782 GCCAGAAGCATTGGTCACCCAGG - Intronic
984581283 4:181512610-181512632 CGCTAACTCATTTGTCACCCAGG + Intergenic
984714336 4:182912841-182912863 GGCCCACTCAGTGCTCACCCAGG + Intronic
987696456 5:21340597-21340619 GGCCAACAGATTGCTCACCTGGG + Intergenic
988755743 5:34245972-34245994 GGCCAACAGATTGCTCACCTGGG - Intergenic
991743997 5:69711791-69711813 GGCCAACAGATTGCTCACCTGGG - Intergenic
991753711 5:69843451-69843473 GGCCAACAGATTGCTCACCTGGG + Intergenic
991795569 5:70291523-70291545 GGCCAACAGATTGCTCACCTGGG - Intergenic
991803328 5:70400178-70400200 GGCCAACAGATTGCTCACCTGGG + Intergenic
991823369 5:70587059-70587081 GGCCAACAGATTGCTCACCTGGG - Intergenic
991833028 5:70718564-70718586 GGCCAACAGATTGCTCACCTGGG + Intergenic
991887937 5:71291042-71291064 GGCCAACAGATTGCTCACCTGGG - Intergenic
993409928 5:87560747-87560769 GGCCACCACATTGCTCACACTGG - Intergenic
998710380 5:144818095-144818117 GGCCAACGTGTTGGGGACCCAGG + Intergenic
1003970067 6:11290710-11290732 GCCCAGCGCAGTGTTCACCCAGG - Intronic
1005554387 6:26957748-26957770 GGCCAACAGATTGCTCACCTGGG - Intergenic
1006739057 6:36294369-36294391 GACCCACGCATTGTTCCCCCCGG + Exonic
1018792162 6:167157153-167157175 GGCCCAGGCACTGGTCACCTTGG - Exonic
1019804442 7:3112970-3112992 GCCCAAAGCTGTGGTCACCCTGG - Intergenic
1023951757 7:44851700-44851722 GGCCAAGGCATGAGTCACCAGGG + Intergenic
1026604039 7:71800722-71800744 GGCCTCTTCATTGGTCACCCTGG - Intronic
1029977910 7:104851539-104851561 GGCCAACGCATTGGTCACCCTGG + Intronic
1032019040 7:128396467-128396489 GGCCCATGCCTGGGTCACCCCGG + Intronic
1038012132 8:23483616-23483638 GGCCAACGCAGTCCTCAGCCTGG + Intergenic
1048066309 8:130972721-130972743 GCCCAACACATTTGCCACCCTGG + Intronic
1057293387 9:93821063-93821085 GGCCAGCCCATCAGTCACCCAGG - Intergenic
1059470826 9:114504190-114504212 GGCCTCCGCGTGGGTCACCCGGG + Exonic
1062273972 9:135722006-135722028 TGCCCACTCCTTGGTCACCCAGG - Intronic
1198281080 X:135143382-135143404 TGACAATGCAATGGTCACCCAGG - Intergenic
1198289878 X:135229134-135229156 TGACAATGCAATGGTCACCCAGG + Intergenic
1198519704 X:137440541-137440563 GACCAAGGCATTGCTCACACTGG + Intergenic