ID: 1029985159

View in Genome Browser
Species Human (GRCh38)
Location 7:104916291-104916313
Sequence GGCTCAAAAAATCCTCCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029985159_1029985165 30 Left 1029985159 7:104916291-104916313 CCAACAGGAGGATTTTTTGAGCC No data
Right 1029985165 7:104916344-104916366 CTCACCACTGCACTCCAGGCTGG 0: 28
1: 2109
2: 49635
3: 151324
4: 220334
1029985159_1029985161 -10 Left 1029985159 7:104916291-104916313 CCAACAGGAGGATTTTTTGAGCC No data
Right 1029985161 7:104916304-104916326 TTTTTGAGCCCATGAGGTCAAGG No data
1029985159_1029985164 26 Left 1029985159 7:104916291-104916313 CCAACAGGAGGATTTTTTGAGCC No data
Right 1029985164 7:104916340-104916362 TGATCTCACCACTGCACTCCAGG 0: 9
1: 147
2: 932
3: 2393
4: 3558

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029985159 Original CRISPR GGCTCAAAAAATCCTCCTGT TGG (reversed) Intergenic
No off target data available for this crispr