ID: 1029985161

View in Genome Browser
Species Human (GRCh38)
Location 7:104916304-104916326
Sequence TTTTTGAGCCCATGAGGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029985159_1029985161 -10 Left 1029985159 7:104916291-104916313 CCAACAGGAGGATTTTTTGAGCC No data
Right 1029985161 7:104916304-104916326 TTTTTGAGCCCATGAGGTCAAGG No data
1029985158_1029985161 -9 Left 1029985158 7:104916290-104916312 CCCAACAGGAGGATTTTTTGAGC No data
Right 1029985161 7:104916304-104916326 TTTTTGAGCCCATGAGGTCAAGG No data
1029985155_1029985161 18 Left 1029985155 7:104916263-104916285 CCAGGCATGGTGGTGAGCATCTG 0: 11
1: 488
2: 5747
3: 21559
4: 54633
Right 1029985161 7:104916304-104916326 TTTTTGAGCCCATGAGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029985161 Original CRISPR TTTTTGAGCCCATGAGGTCA AGG Intergenic
No off target data available for this crispr