ID: 1029985164

View in Genome Browser
Species Human (GRCh38)
Location 7:104916340-104916362
Sequence TGATCTCACCACTGCACTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7039
Summary {0: 9, 1: 147, 2: 932, 3: 2393, 4: 3558}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029985163_1029985164 4 Left 1029985163 7:104916313-104916335 CCATGAGGTCAAGGCTGCAGTGA 0: 81
1: 4253
2: 13366
3: 29036
4: 83864
Right 1029985164 7:104916340-104916362 TGATCTCACCACTGCACTCCAGG 0: 9
1: 147
2: 932
3: 2393
4: 3558
1029985162_1029985164 5 Left 1029985162 7:104916312-104916334 CCCATGAGGTCAAGGCTGCAGTG 0: 48
1: 3661
2: 14304
3: 30469
4: 72344
Right 1029985164 7:104916340-104916362 TGATCTCACCACTGCACTCCAGG 0: 9
1: 147
2: 932
3: 2393
4: 3558
1029985158_1029985164 27 Left 1029985158 7:104916290-104916312 CCCAACAGGAGGATTTTTTGAGC No data
Right 1029985164 7:104916340-104916362 TGATCTCACCACTGCACTCCAGG 0: 9
1: 147
2: 932
3: 2393
4: 3558
1029985159_1029985164 26 Left 1029985159 7:104916291-104916313 CCAACAGGAGGATTTTTTGAGCC No data
Right 1029985164 7:104916340-104916362 TGATCTCACCACTGCACTCCAGG 0: 9
1: 147
2: 932
3: 2393
4: 3558

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029985164 Original CRISPR TGATCTCACCACTGCACTCC AGG Intergenic
Too many off-targets to display for this crispr