ID: 1029985165

View in Genome Browser
Species Human (GRCh38)
Location 7:104916344-104916366
Sequence CTCACCACTGCACTCCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 423430
Summary {0: 28, 1: 2109, 2: 49635, 3: 151324, 4: 220334}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029985162_1029985165 9 Left 1029985162 7:104916312-104916334 CCCATGAGGTCAAGGCTGCAGTG 0: 48
1: 3661
2: 14304
3: 30469
4: 72344
Right 1029985165 7:104916344-104916366 CTCACCACTGCACTCCAGGCTGG 0: 28
1: 2109
2: 49635
3: 151324
4: 220334
1029985159_1029985165 30 Left 1029985159 7:104916291-104916313 CCAACAGGAGGATTTTTTGAGCC No data
Right 1029985165 7:104916344-104916366 CTCACCACTGCACTCCAGGCTGG 0: 28
1: 2109
2: 49635
3: 151324
4: 220334
1029985163_1029985165 8 Left 1029985163 7:104916313-104916335 CCATGAGGTCAAGGCTGCAGTGA 0: 81
1: 4253
2: 13366
3: 29036
4: 83864
Right 1029985165 7:104916344-104916366 CTCACCACTGCACTCCAGGCTGG 0: 28
1: 2109
2: 49635
3: 151324
4: 220334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029985165 Original CRISPR CTCACCACTGCACTCCAGGC TGG Intergenic
Too many off-targets to display for this crispr