ID: 1029986687

View in Genome Browser
Species Human (GRCh38)
Location 7:104929166-104929188
Sequence GTCTCCTTGAAACTCCACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029986680_1029986687 21 Left 1029986680 7:104929122-104929144 CCATGCAAGTGCAGGGGTGTTTT No data
Right 1029986687 7:104929166-104929188 GTCTCCTTGAAACTCCACTCTGG No data
1029986684_1029986687 -10 Left 1029986684 7:104929153-104929175 CCCAACCAGTGATGTCTCCTTGA No data
Right 1029986687 7:104929166-104929188 GTCTCCTTGAAACTCCACTCTGG No data
1029986683_1029986687 -9 Left 1029986683 7:104929152-104929174 CCCCAACCAGTGATGTCTCCTTG No data
Right 1029986687 7:104929166-104929188 GTCTCCTTGAAACTCCACTCTGG No data
1029986682_1029986687 -8 Left 1029986682 7:104929151-104929173 CCCCCAACCAGTGATGTCTCCTT No data
Right 1029986687 7:104929166-104929188 GTCTCCTTGAAACTCCACTCTGG No data
1029986681_1029986687 -3 Left 1029986681 7:104929146-104929168 CCATACCCCCAACCAGTGATGTC No data
Right 1029986687 7:104929166-104929188 GTCTCCTTGAAACTCCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029986687 Original CRISPR GTCTCCTTGAAACTCCACTC TGG Intergenic
No off target data available for this crispr