ID: 1029988769

View in Genome Browser
Species Human (GRCh38)
Location 7:104944313-104944335
Sequence CCATCTGGGGACCCCCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029988764_1029988769 -8 Left 1029988764 7:104944298-104944320 CCTTTGGGAGATACACCATCTGG No data
Right 1029988769 7:104944313-104944335 CCATCTGGGGACCCCCTCAAAGG No data
1029988763_1029988769 -7 Left 1029988763 7:104944297-104944319 CCCTTTGGGAGATACACCATCTG No data
Right 1029988769 7:104944313-104944335 CCATCTGGGGACCCCCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029988769 Original CRISPR CCATCTGGGGACCCCCTCAA AGG Intergenic
No off target data available for this crispr