ID: 1029996399

View in Genome Browser
Species Human (GRCh38)
Location 7:105012607-105012629
Sequence GCCGCAGCTGTTCTGCCGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029996391_1029996399 13 Left 1029996391 7:105012571-105012593 CCACGAGGACTGTCCTGCGGGGG No data
Right 1029996399 7:105012607-105012629 GCCGCAGCTGTTCTGCCGTATGG No data
1029996387_1029996399 15 Left 1029996387 7:105012569-105012591 CCCCACGAGGACTGTCCTGCGGG No data
Right 1029996399 7:105012607-105012629 GCCGCAGCTGTTCTGCCGTATGG No data
1029996383_1029996399 30 Left 1029996383 7:105012554-105012576 CCAACAGCCGTCACACCCCACGA No data
Right 1029996399 7:105012607-105012629 GCCGCAGCTGTTCTGCCGTATGG No data
1029996385_1029996399 23 Left 1029996385 7:105012561-105012583 CCGTCACACCCCACGAGGACTGT No data
Right 1029996399 7:105012607-105012629 GCCGCAGCTGTTCTGCCGTATGG No data
1029996395_1029996399 0 Left 1029996395 7:105012584-105012606 CCTGCGGGGGCTTTCCCCTGGGA No data
Right 1029996399 7:105012607-105012629 GCCGCAGCTGTTCTGCCGTATGG No data
1029996389_1029996399 14 Left 1029996389 7:105012570-105012592 CCCACGAGGACTGTCCTGCGGGG No data
Right 1029996399 7:105012607-105012629 GCCGCAGCTGTTCTGCCGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029996399 Original CRISPR GCCGCAGCTGTTCTGCCGTA TGG Intergenic
No off target data available for this crispr