ID: 1030002364

View in Genome Browser
Species Human (GRCh38)
Location 7:105079176-105079198
Sequence GTGCCATTGTATTCCAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344113
Summary {0: 43, 1: 2178, 2: 28311, 3: 113281, 4: 200300}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030002364_1030002367 9 Left 1030002364 7:105079176-105079198 CCCAGGCTGGAATACAATGGCAC 0: 43
1: 2178
2: 28311
3: 113281
4: 200300
Right 1030002367 7:105079208-105079230 TCATGTAACCTCCGTCTTCCGGG 0: 1
1: 0
2: 12
3: 131
4: 1095
1030002364_1030002366 8 Left 1030002364 7:105079176-105079198 CCCAGGCTGGAATACAATGGCAC 0: 43
1: 2178
2: 28311
3: 113281
4: 200300
Right 1030002366 7:105079207-105079229 CTCATGTAACCTCCGTCTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030002364 Original CRISPR GTGCCATTGTATTCCAGCCT GGG (reversed) Intronic
Too many off-targets to display for this crispr