ID: 1030002365

View in Genome Browser
Species Human (GRCh38)
Location 7:105079177-105079199
Sequence CGTGCCATTGTATTCCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278115
Summary {0: 15, 1: 1000, 2: 15290, 3: 76969, 4: 184841}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030002365_1030002366 7 Left 1030002365 7:105079177-105079199 CCAGGCTGGAATACAATGGCACG 0: 15
1: 1000
2: 15290
3: 76969
4: 184841
Right 1030002366 7:105079207-105079229 CTCATGTAACCTCCGTCTTCCGG No data
1030002365_1030002367 8 Left 1030002365 7:105079177-105079199 CCAGGCTGGAATACAATGGCACG 0: 15
1: 1000
2: 15290
3: 76969
4: 184841
Right 1030002367 7:105079208-105079230 TCATGTAACCTCCGTCTTCCGGG 0: 1
1: 0
2: 12
3: 131
4: 1095

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030002365 Original CRISPR CGTGCCATTGTATTCCAGCC TGG (reversed) Intronic
Too many off-targets to display for this crispr