ID: 1030002366

View in Genome Browser
Species Human (GRCh38)
Location 7:105079207-105079229
Sequence CTCATGTAACCTCCGTCTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030002365_1030002366 7 Left 1030002365 7:105079177-105079199 CCAGGCTGGAATACAATGGCACG 0: 15
1: 1000
2: 15290
3: 76969
4: 184841
Right 1030002366 7:105079207-105079229 CTCATGTAACCTCCGTCTTCCGG No data
1030002364_1030002366 8 Left 1030002364 7:105079176-105079198 CCCAGGCTGGAATACAATGGCAC 0: 43
1: 2178
2: 28311
3: 113281
4: 200300
Right 1030002366 7:105079207-105079229 CTCATGTAACCTCCGTCTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030002366 Original CRISPR CTCATGTAACCTCCGTCTTC CGG Intronic
No off target data available for this crispr