ID: 1030008512

View in Genome Browser
Species Human (GRCh38)
Location 7:105142007-105142029
Sequence AGTACTGGGGATTTGCCAAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1088
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 1055}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030008512_1030008518 8 Left 1030008512 7:105142007-105142029 CCTTTTGGCAAATCCCCAGTACT 0: 1
1: 0
2: 1
3: 31
4: 1055
Right 1030008518 7:105142038-105142060 AAACCGTTCTGCTTCTGTCATGG 0: 1
1: 0
2: 0
3: 10
4: 99
1030008512_1030008521 13 Left 1030008512 7:105142007-105142029 CCTTTTGGCAAATCCCCAGTACT 0: 1
1: 0
2: 1
3: 31
4: 1055
Right 1030008521 7:105142043-105142065 GTTCTGCTTCTGTCATGGGATGG 0: 1
1: 0
2: 1
3: 31
4: 339
1030008512_1030008519 9 Left 1030008512 7:105142007-105142029 CCTTTTGGCAAATCCCCAGTACT 0: 1
1: 0
2: 1
3: 31
4: 1055
Right 1030008519 7:105142039-105142061 AACCGTTCTGCTTCTGTCATGGG 0: 1
1: 0
2: 0
3: 4
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030008512 Original CRISPR AGTACTGGGGATTTGCCAAA AGG (reversed) Exonic
901041645 1:6367827-6367849 AGAACTCGGGACCTGCCAAATGG - Intronic
901233058 1:7651941-7651963 AGTGGTGGGGCTTTCCCAAAGGG - Intronic
902557215 1:17254069-17254091 AATACGGGGGATTTGGAAAAAGG + Intronic
904331976 1:29765502-29765524 ATTACTGGGTATATACCAAAAGG + Intergenic
904878691 1:33677600-33677622 ATTACTGGGTATATGCCCAAAGG + Intronic
906913595 1:49983094-49983116 AGAACTTGGGACCTGCCAAATGG + Intronic
906957700 1:50389245-50389267 ATTACTGGGTATTTACCCAAAGG - Intergenic
906971873 1:50523891-50523913 ATTACTGGGTATTTACCCAAAGG - Intronic
907153023 1:52306524-52306546 AGAACTCGGGACCTGCCAAATGG + Intronic
908435832 1:64104960-64104982 ATTACTGGGTATATGCCCAAAGG - Intronic
908631876 1:66118213-66118235 ATTACTGGGTATATGCCCAAAGG + Intronic
908819014 1:68063866-68063888 ATTACTGGGTATATGCCCAAAGG + Intergenic
908893441 1:68871509-68871531 ATTACTGGGTATGTGCCCAAAGG + Intergenic
909175590 1:72353823-72353845 ATTACTGGGTATTTACCCAAAGG - Intergenic
909197839 1:72649291-72649313 AGAACTTGGGACCTGCCAAATGG + Intergenic
909241960 1:73224528-73224550 AGTTCTGGCAATTTACCAAATGG - Intergenic
909688819 1:78381667-78381689 ATTACTTTGGATTTGGCAAATGG - Intronic
909749825 1:79144966-79144988 AGTACTGGGTATATACCCAAAGG + Intergenic
909897400 1:81089660-81089682 ATTACTGGGTATATGCCCAAAGG - Intergenic
910084086 1:83377608-83377630 ATTACTGGGTATTTACCCAAAGG - Intergenic
910263638 1:85315298-85315320 AGAAATGGGGAGATGCCAAAGGG + Intergenic
910393987 1:86773584-86773606 TGTACTGAGGTATTGCCAAATGG - Intergenic
910602077 1:89043099-89043121 AAAACTAGGGACTTGCCAAATGG - Intergenic
910605341 1:89077470-89077492 ATTACTGGGTATATACCAAAAGG + Intergenic
911516683 1:98876101-98876123 ATTACTGGGTATTTACCCAAAGG - Intergenic
911772679 1:101766899-101766921 ATTACTGGGCATATGCCCAAAGG + Intergenic
911946267 1:104113477-104113499 ATCACTGTGGATTTGTCAAAGGG - Intergenic
912008658 1:104933341-104933363 AGAACTCGGGACCTGCCAAACGG + Intergenic
912205482 1:107503799-107503821 ATTACTGGGTATATGCCCAAAGG - Intergenic
912255705 1:108055832-108055854 AGTACTGGGTATATACCCAAAGG + Intergenic
913020491 1:114784514-114784536 ATTACTGGGTATATACCAAAAGG - Intergenic
913409379 1:118534337-118534359 ATTACTTGGGTTTTCCCAAAGGG - Intergenic
913464171 1:119122534-119122556 ACTACTGGGTATTTGCCCAGAGG + Intronic
913592712 1:120343566-120343588 ATTACTGGGTATTTACCCAAAGG + Intergenic
913962341 1:143350060-143350082 ATTACTGGGTATATGCCCAAAGG + Intergenic
914056696 1:144175636-144175658 ATTACTGGGTATATGCCCAAAGG + Intergenic
914122450 1:144790726-144790748 ATTACTGGGTATATGCCCAAAGG - Intergenic
915750954 1:158210339-158210361 ACTACTGGGTATCTGCCCAAAGG - Intergenic
915816214 1:158968586-158968608 AGTACTGGGCATATGCCCAAAGG + Intronic
915829802 1:159116325-159116347 ATTACTGGGTATATGCCCAAAGG + Intronic
916333121 1:163640517-163640539 ATTACTGGGTATATGCCCAAAGG - Intergenic
916358293 1:163937753-163937775 ATTACTGGGTATATGCCCAAAGG - Intergenic
916372715 1:164117508-164117530 ATTACTGGGTATTTACCCAAAGG - Intergenic
916381948 1:164221666-164221688 ATTACTGGGTATTTACCCAAAGG + Intergenic
916395831 1:164386368-164386390 ATTACTGGGCATTTACCCAAAGG - Intergenic
916851262 1:168706554-168706576 AGAGCTGGGGATTGGCCAAGCGG + Intronic
916868235 1:168884508-168884530 ATTACTGGGTATATGCCCAAAGG - Intergenic
917012505 1:170489881-170489903 ATTACTGGGTATATGCCCAAAGG + Intergenic
917394674 1:174580273-174580295 ATTACTGGGTATATGCCCAAAGG + Intronic
917606893 1:176640688-176640710 ATTACTGGGTATATGCCCAAAGG - Intronic
918344431 1:183593811-183593833 AGAACTGGGGTTCTACCAAAAGG - Intronic
918616085 1:186545796-186545818 ATTACTGGGTATTTACCCAAAGG - Intergenic
918773170 1:188590678-188590700 ACTACTGGGCATTTACCCAAAGG - Intergenic
918947264 1:191083459-191083481 ACTACTGGGTATATGCCCAAAGG - Intergenic
919112651 1:193240361-193240383 ACTACTGGGTATTTTTCAAAAGG - Intronic
919163650 1:193864152-193864174 AGGACTGGGGATTGGAAAAAGGG + Intergenic
919168738 1:193927709-193927731 AGAACTGGGGACCTGCCAAATGG - Intergenic
919172151 1:193968421-193968443 ATTACTGGGTATATACCAAAGGG + Intergenic
919173336 1:193986768-193986790 ATTACTGGGTATATGCCCAAAGG - Intergenic
919306258 1:195842821-195842843 AGTACTGGGTATTTACCCAGAGG - Intergenic
919307375 1:195859395-195859417 AGTACTGGGTATCTACCAAGAGG + Intergenic
919322618 1:196062235-196062257 ATTACTGGGTATATACCAAAAGG + Intergenic
919332314 1:196187779-196187801 ATTACTGGGTATATACCAAAAGG - Intergenic
919437109 1:197575574-197575596 ATTACTGGGTATTTACCCAAAGG + Intronic
919607972 1:199709603-199709625 ACTACTGGGTATTTACCCAAAGG + Intergenic
920753852 1:208708510-208708532 AGTACTGGGTATATACCCAAAGG + Intergenic
921008980 1:211122468-211122490 ATTACTGGGTATATGCCCAAAGG + Intronic
921279674 1:213553507-213553529 ATTACTGGGCATATACCAAAAGG - Intergenic
921760109 1:218903349-218903371 ATTACTGGGTATATACCAAAAGG + Intergenic
921961294 1:221037201-221037223 ATTACTGGGTATTTACCGAAAGG - Intergenic
922138184 1:222853389-222853411 ACTACTGGGGATTTATCCAAAGG + Intergenic
922982596 1:229840254-229840276 ACTACTGGGTATCTGCCCAAAGG + Intergenic
923151637 1:231238733-231238755 AGGCCTGCAGATTTGCCAAAAGG - Intronic
923912953 1:238470219-238470241 AGTAATGTGGATTTCACAAAAGG + Intergenic
924456181 1:244220453-244220475 ATTACTGGGTATTTACCCAAAGG + Intergenic
924605422 1:245530323-245530345 AGTACTGGGTATTTATCCAAAGG + Intronic
924630133 1:245729948-245729970 AATACTGGGTATATGCCCAAAGG + Intergenic
924649682 1:245914262-245914284 AGTACTGGGTATTTATCCAAAGG + Intronic
1063007150 10:1984018-1984040 ATTACTGGGTATATGCCCAAAGG - Intergenic
1063793565 10:9483875-9483897 ATTACTGGGTATATGCCCAAAGG + Intergenic
1063850448 10:10183383-10183405 ATTACTGGGTATATGCCCAAAGG + Intergenic
1064820191 10:19320569-19320591 ATTACTGGGTATTTACCCAAAGG - Intronic
1065392903 10:25202753-25202775 ATTACTGGGTATATGCCCAAAGG - Intronic
1065760488 10:28977524-28977546 ATTACTGGGTATATACCAAAAGG + Intergenic
1066490972 10:35894375-35894397 ATTACTGGGTATATACCAAAAGG + Intergenic
1066512817 10:36120614-36120636 AGTACTGGGGTTTTGGCTAGAGG + Intergenic
1066594127 10:37030245-37030267 ATTACTGGGTATTTACCCAAAGG + Intergenic
1066687552 10:37995123-37995145 AGTACTGGGTATCTACCTAAAGG + Intergenic
1066817971 10:39446990-39447012 ATTACTGGGTATATGCCCAAAGG - Intergenic
1066992249 10:42526709-42526731 ATTACTGGGTATATACCAAAAGG - Intergenic
1067784363 10:49232897-49232919 ACTACTGGGTATTTACCCAAAGG + Intergenic
1067840276 10:49670410-49670432 ACTACTGGGCATCTGTCAAAAGG - Intergenic
1068099731 10:52537137-52537159 ATTACTGGGTATATGCCCAAAGG - Intergenic
1068157628 10:53222328-53222350 AGAACTTGGGACCTGCCAAATGG - Intergenic
1068348520 10:55814141-55814163 AGAACTTGGGACATGCCAAATGG + Intergenic
1068442579 10:57077738-57077760 ATTACTGGGTATTTACCCAAAGG - Intergenic
1069044709 10:63730641-63730663 ATTACTGGGTATATGCCCAAAGG + Intergenic
1069122046 10:64578765-64578787 ATTACTGGGTATATACCAAAAGG + Intergenic
1069593017 10:69653494-69653516 AGAACTGAGGACTTCCCAAATGG + Intergenic
1070077402 10:73151018-73151040 ATTACTGGGTATATGCCCAAAGG + Intronic
1070663194 10:78322810-78322832 AGTACTGAGCATTTGTCCAAAGG - Intergenic
1070952146 10:80439960-80439982 ACTACTGGGTATTTACCCAAAGG + Intergenic
1071000219 10:80823292-80823314 ATTACTGGGAATTTACCCAAAGG + Intergenic
1071042844 10:81335407-81335429 ATTACTGGGTATATGCCCAAAGG - Intergenic
1071052986 10:81473728-81473750 AGAACTCGGGACGTGCCAAATGG + Intergenic
1071166736 10:82816229-82816251 AGAACTCGGGATACGCCAAATGG - Intronic
1071249127 10:83798188-83798210 ACTACTGGGTATATGCCCAAAGG - Intergenic
1071842527 10:89487483-89487505 ACTACTGGGTATTTACCCAAAGG + Intronic
1071994537 10:91134992-91135014 AGCACTGGGTATGTGCCAATTGG - Intergenic
1072262737 10:93696596-93696618 ATTACTGGGTATATACCAAAAGG + Intronic
1072359984 10:94650053-94650075 AGTACTGAGTATTTACCCAAAGG - Intergenic
1072387472 10:94946006-94946028 ATTACTGGGTATATGCCCAAAGG + Intronic
1072963014 10:99947209-99947231 AGTATTGGGTATATGCCCAAAGG + Intronic
1073074810 10:100817216-100817238 AGGACTGGGAAGTTGCCAACTGG + Intronic
1073500365 10:103931623-103931645 AGTTCTGGGGATGTGTCAACTGG - Intergenic
1073763576 10:106657096-106657118 ACTACTGGGCATCTACCAAAAGG + Intronic
1073823762 10:107295845-107295867 ATTACTGGGTATTTGCCCAAAGG + Intergenic
1073966626 10:108997853-108997875 ATTACTGGGTATATGCCCAAAGG + Intergenic
1073980160 10:109145068-109145090 AGTAGTGGGGTCTTTCCAAAAGG - Intergenic
1073987805 10:109229114-109229136 ATTACTGGGTATTTACCCAAAGG + Intergenic
1074090400 10:110247837-110247859 ATTACTGGGTATATACCAAAAGG + Intronic
1074266849 10:111913002-111913024 GGTACTGGGGATCTGTCTAAAGG + Intergenic
1075040961 10:119106279-119106301 ATTACTGGGTATCTGCCGAAAGG - Intronic
1075229665 10:120664663-120664685 ATTACTGGGTATATGCCCAAAGG + Intergenic
1075491307 10:122872428-122872450 ATTACTGGGTATATGCCCAAAGG + Intronic
1076611420 10:131728219-131728241 ATTACTGGGTATGTGCCCAAAGG + Intergenic
1077381311 11:2240047-2240069 AATTATGGGGATATGCCAAAGGG + Intergenic
1077737526 11:4807174-4807196 ATTACTGGGTATTTACCCAAAGG - Intronic
1077813118 11:5658748-5658770 ATTACTGGGTATGTGCCCAAAGG - Intergenic
1077841107 11:5975706-5975728 ATTACTGGGTATATGCCCAAAGG - Intergenic
1077955131 11:7010059-7010081 ATTACTGGGTATATGCCCAAAGG + Intronic
1078819800 11:14866753-14866775 AGTACTGAGCATTCTCCAAATGG - Intronic
1079257361 11:18843483-18843505 ATTACTGGGTATATGCCCAAAGG + Intergenic
1079286735 11:19140558-19140580 ATTACTGGGTATATGCCCAAAGG + Intronic
1079593052 11:22204838-22204860 ATTACTGGGTATATGCCCAAAGG + Intronic
1079594754 11:22228979-22229001 ATTACTGGGTATATGCCTAAAGG - Intronic
1079865868 11:25733119-25733141 ATTACTGGGTATATACCAAAAGG + Intergenic
1079911205 11:26312343-26312365 ATTACTGGGTATATGCCCAAAGG - Intronic
1079919035 11:26408617-26408639 ATTACTGGGTATATGCCCAAAGG + Intronic
1079966499 11:26986794-26986816 AGAACTGGGGAAATGACAAAAGG - Intergenic
1080714127 11:34781722-34781744 ACTACTGGGTATTTACCCAAAGG - Intergenic
1081237226 11:40659889-40659911 AGTACTCAGGATGTACCAAATGG + Intronic
1081364849 11:42222141-42222163 ATTACTGGGTATTTACCCAAAGG + Intergenic
1081520095 11:43873255-43873277 GGTACTGGGAAGTTGCCAAGGGG + Intergenic
1081547017 11:44078763-44078785 AGTACCTGGTATTTGCCAAGAGG + Exonic
1081718384 11:45267743-45267765 ATAACTGTGGATTTGCCTAAGGG - Intronic
1081880437 11:46445967-46445989 AGTACTGTGGATCTGCAAATGGG + Intronic
1082136004 11:48549991-48550013 ATTACTGGGTATATACCAAAAGG - Intergenic
1082297479 11:50459832-50459854 ATTACTGGGTATATGCCCAAAGG - Intergenic
1082600073 11:55138328-55138350 AGTACTGGGTATATACCCAAAGG + Intergenic
1082921285 11:58497360-58497382 ATTACTGGGGATATGCCAGGAGG + Intergenic
1083383825 11:62292316-62292338 AATACTGGGTATATGCCCAAAGG + Intergenic
1083533000 11:63441977-63441999 ATTACTGGGTATATGCCCAAAGG + Intergenic
1084600029 11:70139751-70139773 ATTACTGGGTATATGCCCAAAGG - Intronic
1084838924 11:71829265-71829287 ATTACTGGGTATATACCAAAAGG + Intergenic
1085403994 11:76250941-76250963 AGAACTTGGGACCTGCCAAATGG + Intergenic
1085496941 11:76978593-76978615 AGAACTTAGGACTTGCCAAATGG + Intronic
1085770532 11:79321672-79321694 AGAACTTGGGACATGCCAAAGGG + Intronic
1086069504 11:82785153-82785175 ACTACTGGGTATTTACCCAAGGG + Intergenic
1086111298 11:83201493-83201515 ATTACTGGGTATATGCCCAAAGG - Intronic
1087071033 11:94080933-94080955 ATTACTGGGCATATACCAAAAGG + Intronic
1087404253 11:97710603-97710625 ACTACTGGGTATATTCCAAAAGG - Intergenic
1087569327 11:99904640-99904662 ATTACTGGGTATATACCAAAAGG - Intronic
1087697320 11:101394609-101394631 ATTACTGGGTATTTACCCAAAGG - Intergenic
1087739882 11:101874963-101874985 ATTACTGGGCATATGCCCAAAGG - Intergenic
1088155705 11:106800380-106800402 ATTACTGGGTATATGCCCAAAGG + Intronic
1088307787 11:108428303-108428325 ATTACTGGGTATATACCAAAAGG + Intronic
1088328771 11:108628846-108628868 AGAACTTGGGATGTGCCAAATGG - Intergenic
1088702766 11:112428298-112428320 AGTACTGGGTATATACCCAAAGG + Intergenic
1088959068 11:114642762-114642784 AGTACTGGGTATATACCCAAAGG - Intergenic
1089404849 11:118189102-118189124 ACTACTGGGTATTTGCCCAGAGG - Intergenic
1089430145 11:118416726-118416748 AGTACTGGGTATATACCCAAAGG + Intronic
1089857873 11:121562687-121562709 AGTAATTTGGATATGCCAAAGGG + Intronic
1090108258 11:123875026-123875048 ATTACTGGGTATATACCAAAAGG - Intergenic
1090195525 11:124813157-124813179 AGGATTGTGGTTTTGCCAAATGG - Intergenic
1090583637 11:128186633-128186655 ATTACTGGGTATATACCAAAAGG + Intergenic
1091479017 12:807590-807612 GGTAATGAGGGTTTGCCAAAGGG - Intronic
1091589860 12:1836604-1836626 AGATCTGGGGATTTTCTAAAGGG + Exonic
1092328045 12:7554821-7554843 ATTACTGGGTATATGCCCAAAGG + Intergenic
1092532381 12:9355301-9355323 ATTACTGGGTATATGCCCAAAGG - Intergenic
1092558380 12:9581932-9581954 ATTACTGGGTATATGCCCAAAGG + Intergenic
1092661533 12:10743785-10743807 ATTACTGGGTATATACCAAAAGG - Intergenic
1093506425 12:19871894-19871916 ACTACTGGGGATTTACCCAGAGG + Intergenic
1093535752 12:20220460-20220482 AGAACTGGGGAGGTCCCAAAGGG - Intergenic
1093948938 12:25141991-25142013 AGTACTGGGTATCTGCCCAGAGG + Intronic
1094055195 12:26262104-26262126 ATTACTGGGGATATACCCAAAGG + Intronic
1094055340 12:26263634-26263656 ATTACTGGGGATATACCCAAAGG + Intronic
1094097981 12:26729445-26729467 ATTACTGGGTATATGCCCAAAGG + Intronic
1094624497 12:32110399-32110421 AGTACTAAGGATTTGAAAAAAGG + Intronic
1095230985 12:39739697-39739719 AGTACTGTAGATTTCCAAAATGG + Intronic
1095302992 12:40608938-40608960 ATTACTGGGTATTTACCCAAAGG - Intergenic
1095340349 12:41081953-41081975 ATTACTGGGTATATACCAAAAGG - Intergenic
1095341398 12:41093297-41093319 ATTACTGGGTATATACCAAAAGG - Intergenic
1095554718 12:43487065-43487087 ACTACTGGGTATTTACCCAAAGG + Intronic
1096958802 12:55555978-55556000 ACTACTGGGTATTTACCCAAAGG - Intergenic
1097091604 12:56509864-56509886 ACTACTGGGGGTATGTCAAAAGG - Intergenic
1097306573 12:58075512-58075534 ATTACTGGGTATATGCCCAAAGG - Intergenic
1097319997 12:58214792-58214814 ATTACTGGGGATATACCCAAAGG - Intergenic
1097458904 12:59835402-59835424 AATGTTGGGGATTTTCCAAAAGG - Intergenic
1097514506 12:60587687-60587709 ATTACTGGGTATATACCAAAAGG + Intergenic
1097536116 12:60872747-60872769 AGAACTTGGGAACTGCCAAATGG - Intergenic
1097736813 12:63191601-63191623 ATTACTGGGGATATACCCAAAGG + Intergenic
1097916650 12:65027559-65027581 ATTACTGGGTATATGCCCAAAGG - Intergenic
1097996853 12:65897520-65897542 AATACTGGGGCTTAGGCAAAAGG + Intronic
1098671686 12:73237988-73238010 AGTACTGGGGATTTGTCCAAGGG + Intergenic
1098785542 12:74749380-74749402 ATTACTGGGTATATACCAAAAGG + Intergenic
1099011101 12:77292186-77292208 ATTACTGGGTATATGCCCAATGG + Intergenic
1099238444 12:80110751-80110773 ATTACTGGGGATATACCCAAAGG - Intergenic
1099295462 12:80823174-80823196 AGAACTTGGGACCTGCCAAATGG + Intronic
1099423487 12:82493904-82493926 ATTACTGGGTATATACCAAAAGG + Intergenic
1099426729 12:82532658-82532680 ATTACTGGGTATATACCAAAAGG + Intergenic
1099574640 12:84363270-84363292 AGAACTGGGGACCTGCCAAAGGG + Intergenic
1100078527 12:90819680-90819702 AGTAATGGGGATTTAGCAGAGGG - Intergenic
1100737072 12:97547392-97547414 ACTACTGGGTATTTGTCCAAAGG - Intergenic
1101600736 12:106207295-106207317 ATTACTGGGCATTTACCCAAAGG - Intergenic
1102322661 12:111951308-111951330 ATTACTGGGTATGTGCCCAAAGG + Intronic
1104195868 12:126537441-126537463 ATTACTGGGTATATGCCCAAAGG + Intergenic
1104383858 12:128331770-128331792 ACTACTGGGTATCTGCCCAAAGG - Intronic
1104608895 12:130211790-130211812 ATTACTGGGTATATGCCCAAAGG + Intergenic
1105384393 13:19916354-19916376 ATTACTGGGTATATGCCCAAAGG + Intergenic
1105425300 13:20289287-20289309 AGTACTGGGTATATACCCAAAGG - Intergenic
1105545799 13:21350082-21350104 ACTACTGGGGATATGTCCAAAGG - Intergenic
1106346215 13:28881476-28881498 ACTACTGGGCATTTACCCAAAGG - Intronic
1106866539 13:33970433-33970455 ATTACTGGGTATATGCCCAAAGG - Intergenic
1107171022 13:37342003-37342025 AGAACTGGGGACCTGTCAAATGG + Intergenic
1107235029 13:38157945-38157967 ACTACTGGGTATCTACCAAAAGG - Intergenic
1107476682 13:40743842-40743864 ATTACTGGGTATATGCCCAAAGG + Intronic
1107567925 13:41625724-41625746 ATTACTGGGTATATGCCCAAAGG + Intronic
1107585663 13:41845457-41845479 ATTACTGGGTATATGCCCAAAGG + Intronic
1107624764 13:42271684-42271706 AGGCCTGGGGACTTGCCAGAGGG + Intergenic
1107774002 13:43818522-43818544 ATTACTGGGTATATGCCCAAAGG + Intergenic
1107811318 13:44202467-44202489 ATTACTGGGTATATGCCCAAAGG + Intergenic
1107842028 13:44467883-44467905 ACTACTGGGTATTTACCAAAAGG + Intronic
1108456846 13:50624383-50624405 ACTACTGGGTATCTGCCCAAAGG - Intronic
1109015188 13:57000953-57000975 ATTACTGGGTATATGCCCAAAGG - Intergenic
1109114158 13:58360119-58360141 ATTACTGGGTATATGCCCAAAGG + Intergenic
1109429776 13:62216637-62216659 ATTACTGGGTATTTACCCAAAGG - Intergenic
1109483661 13:62990616-62990638 ACTACTGGGTATCTACCAAAAGG - Intergenic
1109662651 13:65484625-65484647 ATTACTGGGTATATGCCCAAAGG - Intergenic
1109904922 13:68828193-68828215 ATTACTGGGTATATGCCCAAAGG + Intergenic
1110570418 13:76996800-76996822 AGTACTGGGTATCTACCCAAAGG - Intronic
1110727155 13:78838861-78838883 ATTACTGGGGATATACCCAAAGG - Intergenic
1110913499 13:80992520-80992542 AGTACTGGGTACTTGCCCAGAGG + Intergenic
1110952274 13:81511083-81511105 AGTACTGGGGATTATTGAAAGGG + Intergenic
1110987137 13:81985142-81985164 ATTACTGGGGATATACCCAAAGG - Intergenic
1111023510 13:82486630-82486652 ATTACTGGGTATATGCCCAAAGG + Intergenic
1111039960 13:82734916-82734938 ATTACTGGGGATATACCCAAAGG - Intergenic
1111257913 13:85696881-85696903 AGTACTGGGTATATACCCAAAGG - Intergenic
1111528985 13:89511593-89511615 AGTACTGGGTATATACCCAAAGG + Intergenic
1111540923 13:89666365-89666387 ATTACTGGGGATATACCCAAAGG + Intergenic
1111796302 13:92924578-92924600 ATTAGTGGGGATATACCAAAAGG - Intergenic
1111909714 13:94297240-94297262 AGTGCTGGGGATATGCCAATTGG - Intronic
1111943415 13:94638061-94638083 ATTACTGGGTATATGCCCAAAGG - Intergenic
1112825838 13:103391711-103391733 AATACAGGAGATTTCCCAAAAGG + Intergenic
1112876879 13:104052834-104052856 ATTACTGGGTATATACCAAAAGG - Intergenic
1112965534 13:105187457-105187479 ATTACTGGGTATATGCCCAAAGG - Intergenic
1113234450 13:108254668-108254690 AGTACTGGGTATATACCCAAAGG - Intronic
1113307370 13:109093344-109093366 AGTACTGAGCATTTGGGAAATGG - Intronic
1113342668 13:109441991-109442013 ATTACTGGGCATTTACCCAAAGG - Intergenic
1113712098 13:112472993-112473015 ACTACTGGGTATATGCCCAAAGG + Intergenic
1113720839 13:112554778-112554800 GGTACTGGGGTTTTGCGAATCGG - Intronic
1114188982 14:20426674-20426696 ATTACTGGGTATATGCCCAAAGG + Intergenic
1114760237 14:25306202-25306224 ATTACTGGGTATATGCCCAAAGG + Intergenic
1115133058 14:30076312-30076334 ATTACTGGGTATATGCCCAAAGG + Intronic
1115195020 14:30788277-30788299 ACTACTGGGTATTTACCCAAAGG + Intergenic
1115525259 14:34273720-34273742 ATTACTGGGTATATGCCCAAAGG + Intronic
1115538578 14:34397140-34397162 ATTACTGGGTATATGCCCAAAGG + Intronic
1115800202 14:36984818-36984840 ATTACTGGGTATATGCCCAAAGG + Intronic
1116031975 14:39584765-39584787 ATTACTGGGGATATACCCAAAGG - Intergenic
1116052364 14:39820531-39820553 AGTACTGGGTATATACCCAAAGG - Intergenic
1116130657 14:40852711-40852733 ATTACTGGGTATTTACCCAAAGG - Intergenic
1116254324 14:42531815-42531837 ATTACTGGGTATATGCCCAAAGG + Intergenic
1116416705 14:44686166-44686188 ATTACTGGGTATATGCCCAAAGG - Intergenic
1116510022 14:45733521-45733543 ATTACTGGGTATATACCAAAAGG + Intergenic
1116635650 14:47391255-47391277 TGTACTGTAGATTTGCCGAAGGG + Intronic
1116710847 14:48366761-48366783 ATTACTGGGTATATGCCGAAAGG - Intergenic
1116784594 14:49273397-49273419 ATTACTGGGTATATGCCCAAAGG - Intergenic
1117187025 14:53250180-53250202 AGCACTGGAGAGTTACCAAAAGG - Intergenic
1117215068 14:53542928-53542950 CAGACTGGAGATTTGCCAAAGGG - Intergenic
1117285244 14:54280529-54280551 ATTACTGGGTATATGCCCAAAGG - Intergenic
1117720833 14:58627378-58627400 AGGAGTGGGGATATTCCAAAGGG + Intergenic
1117932506 14:60858073-60858095 ATTACTGGGTATATACCAAAAGG - Intronic
1118433519 14:65747331-65747353 ACTACTGGGTATCTGCCCAAAGG + Intergenic
1118929976 14:70232739-70232761 TGTACACGGGATTTGCCACAGGG - Intergenic
1119061329 14:71477856-71477878 AGTCCTGGGAATTTACCCAAGGG - Intronic
1119948937 14:78724698-78724720 ATTACTGGAGATTTACCAAATGG - Intronic
1120995190 14:90412184-90412206 AATAATGGGAATGTGCCAAATGG - Intergenic
1121234345 14:92381073-92381095 ATTACTAGGTATATGCCAAAAGG + Intronic
1121784203 14:96642917-96642939 ACTACTGGGTATTTACCCAAAGG - Intergenic
1121835577 14:97089070-97089092 GCTGCTGGGGATTTGTCAAAAGG - Intergenic
1121997453 14:98614587-98614609 ATTACTGGGTATTTACCCAAAGG - Intergenic
1123214753 14:106797318-106797340 ATTACTGGGTATATACCAAAAGG - Intergenic
1202931736 14_KI270725v1_random:43749-43771 AGTACTGGGCATATACCCAAAGG - Intergenic
1124820932 15:33044907-33044929 AGAACTTGGGACCTGCCAAATGG + Intronic
1125237750 15:37535655-37535677 ATTACTGGGTATATGCCCAAAGG + Intergenic
1125241611 15:37582758-37582780 AGAACTTGGGAGCTGCCAAATGG + Intergenic
1125269681 15:37924358-37924380 ATTACTGGGTATATGCCCAAAGG + Intronic
1125354031 15:38797980-38798002 ATTACTGGGTATTTACCCAAAGG - Intergenic
1125355579 15:38814261-38814283 ATTACTGGGTATTTACCCAAAGG + Intergenic
1126243571 15:46474879-46474901 ATTACTGGGTATATGCCCAAAGG + Intergenic
1127070137 15:55281006-55281028 ATTACTGGGTATATGCCCAAAGG - Intronic
1127610716 15:60633624-60633646 AGAGTTGGGTATTTGCCAAAAGG + Intronic
1127707533 15:61562104-61562126 ATTACTGGGTATATGCCCAAAGG - Intergenic
1128158344 15:65406469-65406491 AGTACCGGGGATTTGCCTTGGGG + Intronic
1128912984 15:71533147-71533169 ATTACCGGGGATTTGCCCCACGG - Intronic
1129045898 15:72733772-72733794 ATTACTGGGTATATGCCCAAAGG - Intronic
1129582616 15:76828945-76828967 ACTACTGGGTATTTACCCAAAGG + Intronic
1129957015 15:79647770-79647792 ATTACTGGGTATATGCCCAAAGG - Intergenic
1129963047 15:79706215-79706237 ACTACTGGGTATTTATCAAAAGG - Intergenic
1129994797 15:79995215-79995237 AGTACCGAAGATTTTCCAAAGGG + Intergenic
1130111013 15:80965445-80965467 ATTACTGGGTATATGCCCAAAGG + Intronic
1130185977 15:81682822-81682844 ATTACTGGGTATATGCCCAAAGG + Intergenic
1130722351 15:86400960-86400982 ACTACTGGGGATCTACCCAAAGG - Intronic
1130811438 15:87382861-87382883 ATTACTGGGTATTTACCCAAAGG + Intergenic
1131933899 15:97479795-97479817 ATTACTGGGTATATGCCCAAAGG + Intergenic
1132337635 15:101058636-101058658 AGAGTTGGGGTTTTGCCAAAGGG + Intronic
1133474260 16:6104917-6104939 AGTTCTAGGTATTTGCCTAATGG - Intronic
1133489949 16:6257923-6257945 ATTACTGGGGATATACCGAAAGG - Intronic
1133587569 16:7210864-7210886 AATACTGGTAATTTGCCAAAAGG + Intronic
1133959124 16:10477000-10477022 ATTACTGGGTATTTACCCAAAGG - Intronic
1134124115 16:11604789-11604811 ACTTCTGGGAATTTGCCCAAAGG - Intronic
1134254637 16:12601147-12601169 AGTACTTGGGACCCGCCAAATGG + Intergenic
1134380883 16:13724753-13724775 ACTACTGGGTATTTACCCAAAGG + Intergenic
1135013665 16:18906006-18906028 AGGACTGGGGTTTTACCAGATGG - Intronic
1135320606 16:21493575-21493597 AGGATTGGGGTTTTGCCAGATGG - Intergenic
1135373441 16:21925065-21925087 AGGATTGGGGTTTTGCCAGATGG - Intergenic
1135438348 16:22445637-22445659 AGGATTGGGGTTTTGCCAGATGG + Intergenic
1135880850 16:26254672-26254694 ATTACTGGGTATATGCCCAAAGG + Intergenic
1136330820 16:29575274-29575296 AGGATTGGGGTTTTGCCAGATGG - Intergenic
1136445455 16:30315002-30315024 AGGATTGGGGTTTTGCCAGATGG - Intergenic
1136915899 16:34196834-34196856 ATTACTGGGTATATACCAAAAGG - Intergenic
1137025907 16:35474172-35474194 ATTACTGGGTATATGCCCAAAGG + Intergenic
1137877213 16:52008095-52008117 ATTACTGGGTATATGCCCAAAGG - Intronic
1138637606 16:58353787-58353809 ACTACTGGGCATTTACCCAAAGG - Intronic
1138752724 16:59443447-59443469 AGTACTGGGTATGTACCCAAAGG - Intergenic
1138974507 16:62187501-62187523 ATTACTGGGTATATACCAAAAGG - Intergenic
1140019892 16:71228798-71228820 ATTACTGGGTATATGCCCAAAGG + Intronic
1140027626 16:71304980-71305002 ATTACTGGGTATATGCCCAAAGG - Intergenic
1140538730 16:75735331-75735353 ATTACTGGGTATATGCCCAAAGG - Intronic
1140940033 16:79712920-79712942 AGTAATGGGGAATGGGCAAAAGG - Intergenic
1141276165 16:82590200-82590222 AGTACTGGGTATATACCCAAAGG - Intergenic
1141733512 16:85837666-85837688 ACTACTGGGCATATGCCCAAAGG + Intergenic
1143890082 17:10096299-10096321 AGTACAGGGGATTTGGGAAGTGG - Intronic
1143997737 17:11022486-11022508 ACTACTGGGTATTTACCCAAAGG + Intergenic
1144183780 17:12776943-12776965 AGTACTGGGGAGGTGGCACACGG - Intergenic
1144599941 17:16602932-16602954 ACTACTGGGTATCTGCCCAAAGG + Intergenic
1144695548 17:17301728-17301750 AGAACTCGGGACCTGCCAAATGG + Intergenic
1145192787 17:20860582-20860604 ATTACTGGGTATTTACCCAAAGG + Intronic
1145741800 17:27281040-27281062 AGTGCTGGGGATTTGGCATTAGG + Intergenic
1146271140 17:31486803-31486825 ACTGCTGGGGACTTTCCAAATGG - Intronic
1146433522 17:32822016-32822038 ATTACTGGGTATATACCAAAAGG + Intronic
1148523056 17:48300366-48300388 AGTTCTGGGGATTTTGAAAAAGG + Intronic
1148980366 17:51568791-51568813 ATTACTGGGTATATGCCCAAAGG - Intergenic
1149044908 17:52233758-52233780 AGTTTTGGGGCTCTGCCAAAGGG + Intergenic
1149054897 17:52351764-52351786 ATTACTGGGTATATGCCCAAAGG - Intergenic
1149352413 17:55804356-55804378 ATTACTGGGTATATGCCCAAAGG + Intronic
1149959501 17:61092373-61092395 AGTACTAGGGATATGCCCAAAGG - Intronic
1152042405 17:77912957-77912979 ATTACTGGGTATATGCCCAAAGG + Intergenic
1153068698 18:1079217-1079239 ATTACTGGGTATATGCCCAAAGG + Intergenic
1153280977 18:3413883-3413905 AGTATTGAGCAGTTGCCAAATGG + Intronic
1153428755 18:4992729-4992751 AGAACTCTGGACTTGCCAAATGG - Intergenic
1153703371 18:7719038-7719060 ACTACTGGGTATTTACCTAATGG + Intronic
1153816139 18:8791937-8791959 AGTACTGGGGATATGAGAAAGGG - Intronic
1153889658 18:9501162-9501184 AGGACTGGTGATTTGCTAGAAGG - Intronic
1154006964 18:10539142-10539164 ATTACTGGGCATATGCCCAAAGG + Intronic
1155567260 18:27148756-27148778 ATTACTGGGTATATACCAAAAGG - Intronic
1155718659 18:28981648-28981670 ATTACTGGGCATTTACCCAAAGG + Intergenic
1156124553 18:33887918-33887940 ATTACTGGGGATATACCCAAAGG - Intronic
1156143256 18:34142323-34142345 ATTACTGGGGATATACCCAAAGG + Intronic
1157073783 18:44441595-44441617 AGTACTGGGTATCTACCCAAAGG + Intergenic
1157618064 18:48999204-48999226 AGTTCTGGAGATTTGTCACATGG - Intergenic
1157668435 18:49508130-49508152 ACTACTGGGCATTTACCCAAAGG + Intergenic
1157736235 18:50052197-50052219 ATTACTGGGTATATACCAAAAGG + Intronic
1158070115 18:53460779-53460801 ATTACTGGGGATATACCCAAAGG - Intronic
1158122594 18:54065903-54065925 ATTACTGGGGATATACCCAAAGG + Intergenic
1158480705 18:57819119-57819141 ATTACTGGGTATATACCAAAAGG - Intergenic
1158554321 18:58462736-58462758 AGTACTGGGTATCTACCCAAAGG - Intergenic
1158702126 18:59757727-59757749 ACTACTGGGTATATGCCCAAAGG - Intergenic
1158921125 18:62191894-62191916 ATTACTGGGTATATGCCCAAAGG - Intronic
1159225861 18:65535133-65535155 AGAAATGGGGCTTTGGCAAATGG + Intergenic
1159252790 18:65903179-65903201 ACTACTGGGTATCTACCAAAAGG + Intergenic
1159548330 18:69869146-69869168 ATTACTGGGTATATGCCCAAAGG + Intronic
1161091479 19:2361782-2361804 GGTTTTGGGGACTTGCCAAAGGG + Intergenic
1163809019 19:19418856-19418878 AGCCCTGGGGATTTGCCACTTGG + Intronic
1163962893 19:20713808-20713830 ATTACTGGGTATATACCAAAAGG + Intronic
1164166280 19:22678490-22678512 ATTACTGGGTATATGCCCAAAGG + Intergenic
1164329295 19:24236868-24236890 ATTACTGGGTATATGCCCAAAGG + Intergenic
1164600291 19:29558352-29558374 ATTACTGGGTATTTACCCAAAGG + Intronic
1164996651 19:32724721-32724743 ATTACTGGGTATATACCAAAAGG - Intronic
1166142001 19:40810275-40810297 TGTACTCGGGATTTGGCATAAGG + Intronic
1166185524 19:41136518-41136540 TGTACTCGGGATTTGGCATAAGG - Intergenic
1166430254 19:42719790-42719812 ATTACTGGGTATATACCAAAAGG + Intronic
1167202304 19:48074483-48074505 ATTACTGGGTATATGCCCAAAGG - Intronic
1167813587 19:51857526-51857548 AGAATTGGGGATATGCCGAAGGG + Intronic
1168188602 19:54720581-54720603 ACTACTGGGTATATACCAAAAGG + Intergenic
1168379562 19:55908413-55908435 ATTACTGGGTATATGCCCAAAGG + Intronic
1202696178 1_KI270712v1_random:128319-128341 ATTACTGGGTATATGCCCAAAGG + Intergenic
925515385 2:4675196-4675218 AGAACTTGGGACCTGCCAAATGG + Intergenic
925679983 2:6410299-6410321 AGTTCTGAGGCTTTGCCAAACGG - Intergenic
926532202 2:14062471-14062493 AGTTCTGGGGAGTTGACTAAAGG + Intergenic
926786759 2:16525624-16525646 ATCACTGGGGATCTGCCACAGGG - Intergenic
926928484 2:18012516-18012538 ATTACTGGGTATATGCCCAAAGG - Intronic
927259888 2:21077633-21077655 AGTCCAGGGGATTTGCTGAAGGG + Intergenic
927727919 2:25442176-25442198 AGTACTGGTCCTTTGCCAAGAGG + Intronic
928184146 2:29094449-29094471 AGTACTGGGTATATACCCAAAGG + Intergenic
928484736 2:31718372-31718394 TGGACTGGGGACTTGCCTAAAGG - Intergenic
928720391 2:34114352-34114374 ATTACTGGGTATATACCAAAAGG - Intergenic
928724166 2:34151544-34151566 ACTACTGGGTATATACCAAAAGG + Intergenic
928726824 2:34183967-34183989 ATTACTGGGTATTTACCAAAAGG + Intergenic
929163179 2:38853935-38853957 AGTAATGGTAATTTGCCACAAGG - Intronic
930332847 2:50007731-50007753 ATTACTGGGCATTTACCCAAAGG - Intronic
930551978 2:52847376-52847398 ATTACTGGGTATATACCAAAAGG - Intergenic
930583760 2:53245714-53245736 ATTACTGGGTATATGCCCAAAGG + Intergenic
931184779 2:59939466-59939488 AGCACTAAGGACTTGCCAAAGGG + Intergenic
931478625 2:62616909-62616931 ATTACTGGGTATTTACCCAAAGG - Intergenic
932269247 2:70394822-70394844 ATTACTGGGTATATGCCCAAAGG - Intergenic
932857719 2:75255018-75255040 AGAACTGATGATTTGCCCAAAGG - Intergenic
933002392 2:76941811-76941833 ATTACTGGGTATATGCCCAAAGG - Intronic
933132162 2:78685096-78685118 ACTACTGGGTATCTACCAAAAGG + Intergenic
933530017 2:83496840-83496862 ATTACTGGGGATATACCTAAAGG - Intergenic
933545991 2:83713155-83713177 ACTACTGGGTATTTTCCCAAAGG - Intergenic
934277347 2:91585350-91585372 ATTACTGGGTATATGCCCAAAGG + Intergenic
935326603 2:101943379-101943401 AGTCCTGAAGATTTGCCAGAAGG + Intergenic
935449770 2:103195880-103195902 ATTACTGGGTATTTACCCAAAGG + Intergenic
935916040 2:107950869-107950891 ACTACTGGGTATTTACCAAAAGG + Intergenic
936758847 2:115749053-115749075 AGTTCTGGGGATATTCAAAAAGG - Intronic
936808254 2:116363474-116363496 ATTACTGGGGATATACCCAAAGG + Intergenic
936850142 2:116886292-116886314 ATTACTGGGTATATGCCCAAAGG + Intergenic
936880384 2:117243335-117243357 ATTACTGGGTATATGCCCAAAGG - Intergenic
937019462 2:118636991-118637013 ATTACTGGGTATATGCCCAAAGG - Intergenic
937164957 2:119804778-119804800 ATTACTGGGTATATGCCCAAAGG - Intronic
937445417 2:121953415-121953437 ATTACTGGGTATATACCAAAAGG - Intergenic
937567366 2:123311053-123311075 ATTACTGGGTATATGCCCAAAGG + Intergenic
937624969 2:124033945-124033967 AGTACTGGGTATCTGGAAAAGGG + Intronic
937780502 2:125831157-125831179 ATTACTGGGTATATGCCCAAAGG + Intergenic
937878682 2:126848776-126848798 ACTCCTGGGCATTTGCCAAAGGG + Intergenic
939245390 2:139617008-139617030 AGTACTGGGTATCTACCCAAAGG - Intergenic
939347183 2:140980733-140980755 AGTACTGGGTATCTACCCAAAGG + Intronic
939602052 2:144204635-144204657 ATTACTGGGTATATGCCCAAAGG + Intronic
939667356 2:144967964-144967986 AAAACTGAGGATTTTCCAAATGG - Intergenic
940684728 2:156832823-156832845 ACTACTGGGTATTTACCCAAAGG + Intergenic
940694624 2:156962837-156962859 AGTACTGGGTATATACCCAAAGG - Intergenic
940760278 2:157731273-157731295 ATTACTGGGTATATACCAAAAGG + Intergenic
941569623 2:167153907-167153929 ATTACTGGGTATATGCCCAAAGG - Intronic
941607922 2:167623260-167623282 ATTACTGGGTATATGCCCAAAGG + Intergenic
941859058 2:170260206-170260228 ATTACTGGGTATATGCCCAAAGG + Intronic
941896577 2:170635104-170635126 ATTACTGGGTATATACCAAAAGG + Intronic
941997557 2:171615002-171615024 ACTACTGGGTATTTACCCAAAGG + Intergenic
942391133 2:175494219-175494241 ATTACTGGGTATATACCAAAAGG - Intergenic
942793147 2:179783964-179783986 ATTACTGGGTATATACCAAAAGG + Intronic
942796889 2:179831726-179831748 AGTACTGGGTATTTGGGCAAAGG + Intronic
942927299 2:181449234-181449256 ATTACTGGGTATATGCCCAAAGG - Intergenic
943095380 2:183422063-183422085 ATTACTGGGGATATACCCAAAGG + Intergenic
943224033 2:185145282-185145304 AGAACTTGGGACCTGCCAAATGG + Intergenic
943305246 2:186253327-186253349 ATTACTGGGTATATGCCCAAAGG + Intergenic
943310477 2:186318430-186318452 ATTACTGGGTATATGCCCAAAGG + Intergenic
943395960 2:187334717-187334739 AGTACTGGGTATCTACCCAAAGG + Intergenic
943431840 2:187812621-187812643 ACTACTGGGTATTTACCCAAAGG + Intergenic
943500850 2:188687788-188687810 ATTACTGGGTATATGCCCAAAGG - Intergenic
943928445 2:193819282-193819304 AGAACTTGGGACCTGCCAAATGG - Intergenic
943998695 2:194804895-194804917 AGTACTGGGTATATACCCAAAGG - Intergenic
944051739 2:195477590-195477612 ATTACTGGGTATTTACCCAAAGG - Intergenic
944926026 2:204465540-204465562 ATTACTGGGTATTTACCCAAAGG + Intergenic
945711937 2:213307684-213307706 ATTACTGGGTATATACCAAAAGG - Intronic
945753456 2:213817472-213817494 ACTACTGGGTATATGCCCAAAGG + Intronic
945786962 2:214252794-214252816 ATTACTGGGTATATGCCCAAAGG - Intronic
945893326 2:215454397-215454419 AGTCCTGGGGAGTTCCCAAGTGG + Intergenic
946308976 2:218872409-218872431 AATTCTGGGCATTTGCCAACTGG + Intronic
946641748 2:221791199-221791221 ACTACTGGGTATTGGTCAAAAGG + Intergenic
946894390 2:224308566-224308588 AATTCTGGTGATTTCCCAAAAGG + Intergenic
947132711 2:226945656-226945678 AGTACTGGGTATATACCCAAAGG - Intronic
947890317 2:233612552-233612574 ATTACTGGGTATATACCAAAGGG - Intergenic
948015955 2:234690722-234690744 AGCACTGGTGAATGGCCAAATGG - Intergenic
1168744408 20:225887-225909 ATTACTGGGTATATGCCCAAAGG + Intergenic
1169013332 20:2270091-2270113 AGTACTGGGTATATACCCAAAGG + Intergenic
1169828555 20:9796888-9796910 ATTACTGGGTATATGCCCAAAGG - Intronic
1171051043 20:21859399-21859421 ATTACTGGGTATATGCCCAAAGG + Intergenic
1171149790 20:22817475-22817497 ATTACTGGGTATATACCAAAAGG - Intergenic
1171267863 20:23787319-23787341 ATTACTGGGTATATGCCCAAAGG - Intergenic
1172455773 20:35071783-35071805 ATTACTGGGTATTTACCCAAAGG - Intronic
1173385036 20:42579407-42579429 ATTACTGGGTATTTACCCAAAGG - Intronic
1173715156 20:45197847-45197869 ACTACTGGGTATATCCCAAAAGG - Intergenic
1173770061 20:45648497-45648519 AATACTGGGGATTTGTAATAAGG + Intergenic
1174696356 20:52563538-52563560 ACTACTGGGCATTTATCAAAAGG - Intergenic
1175716967 20:61261573-61261595 AGTTCTGGAGATTGGCCTAAGGG + Intronic
1176593765 21:8671895-8671917 AGTACTGGGTATATACCCAAAGG - Intergenic
1176814828 21:13589198-13589220 ACTACTGGGTATTTGCTCAAAGG - Intergenic
1176923849 21:14722580-14722602 ATTACTGGGTATATGCCCAAAGG - Intergenic
1177008077 21:15698633-15698655 ATTACTGGGTATATGCCCAAAGG + Intergenic
1177048394 21:16200741-16200763 AGTACTGGGTATATACCCAAAGG - Intergenic
1177088050 21:16731571-16731593 ATTACTGGGTATATGCCCAAAGG - Intergenic
1177099652 21:16884425-16884447 ATTACTGGGAATATGCCCAAAGG + Intergenic
1177196466 21:17908591-17908613 ATTACTGGGTATGTGCCCAAAGG - Intronic
1177367838 21:20160590-20160612 AGTACTGGGCATCTACCCAAAGG + Intergenic
1177428710 21:20960527-20960549 ATTACTGGGTATATGCCCAAAGG + Intergenic
1177883879 21:26725352-26725374 AGTGCTGGGTATTTACCCAAAGG - Intergenic
1178118313 21:29440429-29440451 ATTACTGGGTATATACCAAAAGG - Intronic
1178338885 21:31768526-31768548 ATTACTGGGTATATGCCCAAAGG - Intergenic
1180276615 22:10649023-10649045 AGTACTGGGTATATACCCAAAGG - Intergenic
1180586255 22:16894622-16894644 ACTACTGGGAATTTGTCCAAAGG + Intergenic
1180981629 22:19880811-19880833 AGTGTTGGGGATTTTCTAAAGGG - Intronic
1182974695 22:34612107-34612129 ATTACTGGGTATTTACCCAAAGG - Intergenic
1184988183 22:48149968-48149990 ATTACTGGGTATATGCCCAAAGG + Intergenic
1185121159 22:48971899-48971921 ACTACTGGGCATTTACCCAAAGG + Intergenic
949263232 3:2126808-2126830 ACTACTGGGGGTTTATCAAAAGG + Intronic
949367235 3:3295983-3296005 ATTACTGGGTATATGCCCAAAGG + Intergenic
949631671 3:5934885-5934907 ACTACTGGGTATGTACCAAAGGG - Intergenic
950207666 3:11093023-11093045 AGAACTTGGGACCTGCCAAATGG + Intergenic
950278423 3:11683424-11683446 ACTACTGGGTATCTACCAAAAGG + Intronic
950608146 3:14103005-14103027 ATTACTGGGGGTATGCCCAAAGG + Intergenic
950914427 3:16629318-16629340 AGAACTGGGGAATTTCCAGATGG - Intronic
950977972 3:17269994-17270016 ATTACTGGGTATATGCCCAAAGG - Intronic
950994543 3:17480899-17480921 AGAACTTGGGACCTGCCAAATGG + Intronic
951012699 3:17699035-17699057 ATTACTGGGTATATGCCCAAAGG + Intronic
951260962 3:20507918-20507940 ATTACTGGGTATATACCAAAAGG - Intergenic
951298151 3:20964688-20964710 ACTACTGGGTATCTGCCCAAAGG - Intergenic
951975207 3:28499146-28499168 AGTACTGGGTATATACCCAAAGG - Intronic
952336173 3:32404921-32404943 AGTACTGGGTCCTTCCCAAAGGG + Intronic
952396794 3:32928240-32928262 AGTACTGGGGATCTACCCAAAGG - Intergenic
952517130 3:34116578-34116600 ATTACTGGGTATATGCCCAAAGG - Intergenic
953195427 3:40727862-40727884 ACTACTGGGTATTTACCCAAAGG - Intergenic
953506724 3:43492929-43492951 ATTACTGGGCATATGCCCAAAGG + Intronic
954371416 3:50171290-50171312 AGTGCTGGGGCTTTGCAAGAGGG + Intronic
954477941 3:50766621-50766643 ATTACTGGGTATATGCCCAAAGG - Intronic
954947720 3:54440985-54441007 ATTACTGGGTATTTACCCAAAGG - Intronic
954970370 3:54646756-54646778 ATTACTGGGTATATGCCCAAAGG - Intronic
955629792 3:60960931-60960953 ATTACTGGGTGTTTACCAAAAGG - Intronic
955762830 3:62306514-62306536 ATTACTGGGTATATGCCCAAAGG + Intergenic
955881705 3:63553439-63553461 AGTACTGGGTATATACCCAAAGG - Intronic
955969536 3:64424196-64424218 AGTACTGTGCACTTCCCAAAGGG + Intronic
956014964 3:64872890-64872912 AGTACTGGGGATGTGGCCGAGGG - Intergenic
956211040 3:66801899-66801921 ATTACTGGGTATATGCCCAAAGG + Intergenic
956426739 3:69144191-69144213 AGGTCTGAGGATTTGCCATAGGG - Intergenic
956880405 3:73505272-73505294 AGGACTGGGGTTTTCTCAAAGGG - Intronic
957454970 3:80429706-80429728 ATTACTGGGTATATGCCCAAAGG - Intergenic
957489664 3:80907253-80907275 ATTACTGGGTATATGCCCAAAGG + Intergenic
957766731 3:84634813-84634835 AGTACTGGGTATATACCCAAAGG - Intergenic
957769753 3:84675522-84675544 ATTACTGGGTATATGCCCAAAGG + Intergenic
957786971 3:84895748-84895770 AGTACTGGGTATTTCTCCAAAGG - Intergenic
958152545 3:89709315-89709337 ACTACTGGGTATCTACCAAAAGG + Intergenic
958677516 3:97285719-97285741 ACTACTGGGTATTTATCAAAAGG - Intronic
958694065 3:97505687-97505709 ATTACTGGGTATATGCCCAACGG - Intronic
958706581 3:97663833-97663855 ATTACTGGGGATATACCAAAAGG - Intronic
958975891 3:100667675-100667697 ATTACTGGGCATATGCCCAAAGG - Intronic
959045900 3:101473233-101473255 ATTACTGGGTATTTACCCAAAGG - Intronic
959170349 3:102836750-102836772 ATTACTGGGTATATGCCTAAAGG - Intergenic
959378655 3:105615603-105615625 AGTACTGTTTATTTGCAAAATGG - Intergenic
959726264 3:109545448-109545470 AGTACTGGGTATATACCCAAAGG - Intergenic
959897578 3:111621816-111621838 AGTACTGAGGATTTTCCCATTGG - Intronic
960013118 3:112855115-112855137 ATTACTGGGTATATACCAAAAGG + Intergenic
960070203 3:113421482-113421504 ATTACTGGGGATATACCCAAAGG + Intronic
960081935 3:113551263-113551285 ATTACTGGGTATATGCCCAAAGG - Intronic
960360055 3:116700019-116700041 ATTACTGGGTATATGCCCAAAGG + Intronic
960368723 3:116808115-116808137 ATTACTGGGTATATGCCCAAAGG + Intronic
960400773 3:117195023-117195045 ATTGCTAGGGTTTTGCCAAAAGG - Intergenic
960476629 3:118138410-118138432 ATTACTGGGTATATGCCCAAAGG - Intergenic
960749579 3:120932689-120932711 ATTACTGGGTATATGCCCAAAGG + Intronic
961238361 3:125388397-125388419 ATTACTGGGCATATGCCCAAAGG + Intergenic
961937451 3:130600357-130600379 ATTACTGGGCATATACCAAAAGG + Intronic
962305909 3:134285859-134285881 ACTACTGGGTATTTGCCCAGAGG + Intergenic
962439195 3:135396364-135396386 ATTACTGGGTATATGCCCAAAGG - Intergenic
962772495 3:138625807-138625829 AGTGGTGGTGACTTGCCAAAGGG + Intronic
962836226 3:139191137-139191159 ATTACTGGGTATATGCCCAAAGG - Intronic
962870497 3:139486657-139486679 ACTACTGGGTATTTCCCCAAAGG - Intergenic
963346330 3:144099707-144099729 AGAACTTGGGACTCGCCAAATGG + Intergenic
963639270 3:147838476-147838498 ATTACTGGGCATATACCAAAAGG - Intergenic
963913372 3:150834619-150834641 AGTACTGGGTATATACCTAAAGG - Intergenic
963977819 3:151502230-151502252 AGAACTGATGATTTGCCAGAAGG + Intergenic
964179727 3:153868375-153868397 ATTACTGGGTATTTACCCAAAGG - Intergenic
964327322 3:155561632-155561654 ATTACTGGGTATATGCCCAAAGG - Intronic
964498739 3:157324836-157324858 ATTACTGGGTATATGCCCAAAGG - Intronic
964557071 3:157951534-157951556 ATTACTGGGTATATGCCCAAAGG + Intergenic
964927782 3:161978609-161978631 AGAACTTGGGACCTGCCAAATGG - Intergenic
965000229 3:162943701-162943723 ATTACTGGGTATATACCAAAAGG - Intergenic
965126739 3:164640055-164640077 AGTACTGGGTATATACCCAAAGG - Intergenic
965178032 3:165361399-165361421 AGTACTGGGTATATACCCAAAGG + Intergenic
965241179 3:166200548-166200570 ATTACTGGGTATATGCCCAATGG + Intergenic
965991941 3:174829614-174829636 ATTACTGGGTATATGCCCAAAGG - Intronic
966134067 3:176678462-176678484 ATTACTGGGTATATACCAAAAGG + Intergenic
966651910 3:182310796-182310818 ATTACTGGGCATATGCCCAAAGG - Intergenic
966948120 3:184791882-184791904 ACAAGTAGGGATTTGCCAAAGGG + Intergenic
968072290 3:195792623-195792645 ATTACTGGGTATATGCCCAAAGG + Intronic
968142893 3:196273389-196273411 AGAACTCGGGATCTGCCAAATGG - Intronic
969106775 4:4812259-4812281 AAGACTGGGGATTTGCTGAAAGG + Intergenic
969126676 4:4954389-4954411 ATTACTGGGTATATACCAAAAGG - Intergenic
970238104 4:13979457-13979479 ATTACTGGGTATATGCCCAAAGG + Intergenic
970277832 4:14421051-14421073 ATTACTGGGTATATGCCCAAAGG - Intergenic
970680339 4:18499826-18499848 ATTACTGGGTATATGCCCAAAGG + Intergenic
970791224 4:19860259-19860281 AGTACTGGGTATTTACCCAAAGG - Intergenic
970920587 4:21389800-21389822 ATTACTGGGTATATGCCCAAAGG - Intronic
971100465 4:23460776-23460798 ACTACTGGGCATCTGCCCAAAGG + Intergenic
971826486 4:31630300-31630322 ATTACTGGGTATATACCAAAAGG - Intergenic
971838578 4:31802166-31802188 ATTACTGGGTATATGCCCAAAGG + Intergenic
971847338 4:31936525-31936547 ATTACTGGGTATTTACCCAAAGG - Intergenic
972179990 4:36452207-36452229 ACTACTGGGTATTTACCCAAAGG + Intergenic
972190908 4:36589183-36589205 ATTACTGGGTATATGCCAAAAGG - Intergenic
972955698 4:44388346-44388368 ATTACTGGGTATATGCCCAAAGG + Intronic
973669496 4:53201523-53201545 ATTACTGGGTATTTACCCAAAGG - Intronic
973743392 4:53939925-53939947 ATTACTGGGTATATGCCCAAAGG + Intronic
973757179 4:54086859-54086881 ACTCCTAGGGATTTCCCAAAAGG - Intronic
973879042 4:55250197-55250219 ATTACTGGGTATATGCCCAAAGG + Intergenic
974066746 4:57085773-57085795 AGTTCTGAGGAGTTGCAAAAAGG - Intronic
974150869 4:58007761-58007783 ATTACTGGGGATATACCCAAAGG - Intergenic
974288302 4:59897603-59897625 ATTACTGGGGATATACCCAAAGG + Intergenic
974357466 4:60831771-60831793 ATTACTGGGTATATGCCCAAAGG - Intergenic
974511267 4:62844930-62844952 ATTACTGGGTATATACCAAAAGG - Intergenic
974518267 4:62944780-62944802 ATTACTGGGTATTTACCCAAAGG + Intergenic
974571430 4:63654289-63654311 ATTACTGGGTATATACCAAAAGG + Intergenic
974739894 4:65993799-65993821 ATTACTGGGGATATACCCAAAGG - Intergenic
974758404 4:66243182-66243204 ATTACTGGGTATATGCCCAAAGG - Intergenic
974840604 4:67295348-67295370 ATTACTGGGGATATACCCAAAGG - Intergenic
974844050 4:67329906-67329928 ATTACTGGGGATATACCCAAAGG + Intergenic
974940116 4:68457539-68457561 ATTACTGGGTATATACCAAAAGG + Intronic
974966605 4:68768708-68768730 ATTACTGGGTATATGCCCAAAGG - Intergenic
975002224 4:69238608-69238630 ATTACTGGGTATATGCCCAAAGG + Intergenic
975010326 4:69342649-69342671 ATTACTGGGTATATGCCCAAAGG + Intronic
975249688 4:72164274-72164296 ATTACTGGGTATATACCAAAAGG - Intergenic
975428268 4:74255995-74256017 ATTACTGGGTATTATCCAAAAGG - Intronic
975912836 4:79289109-79289131 ATTTCTAGGGATGTGCCAAAGGG - Intronic
976023824 4:80663634-80663656 ATTACTGGGTATATGCCCAAAGG - Intronic
976163207 4:82226038-82226060 ATTACTGGGTATATGCCCAAAGG + Intergenic
976178963 4:82381241-82381263 AGAACTTGGGACCTGCCAAATGG - Intergenic
976351292 4:84062651-84062673 ACTACTGGGTATCTGCCCAAAGG + Intergenic
976529955 4:86140175-86140197 ATTACTGGGTATATGCCCAAAGG + Intronic
976567968 4:86574404-86574426 ATTACTGGGTATATGCCCAAAGG - Intronic
976877070 4:89866331-89866353 ATTACTGGGTATATACCAAAAGG - Intergenic
977047395 4:92084605-92084627 ATTACTGGGTATTTACCCAAAGG + Intergenic
977205614 4:94162032-94162054 ATTACTGGGTATTTACCCAAAGG - Intergenic
977363335 4:96034424-96034446 ATTACTGGGTATATGCCCAAAGG + Intergenic
977469746 4:97428065-97428087 ATTACTGGGTATTTACCCAAAGG - Intronic
977509565 4:97945559-97945581 ACTACTGGGTATTTACCCAATGG - Intronic
977662372 4:99605415-99605437 AGTACTAGGCAGTTGTCAAAAGG - Intronic
977752334 4:100624318-100624340 ATTACTGGGTATATGCCCAAAGG - Intronic
977875701 4:102147505-102147527 AGTACTGGGTATATACCCAAAGG + Intergenic
977991974 4:103454744-103454766 AATACTGGGGATATACCTAAAGG - Intergenic
978142441 4:105332936-105332958 ACTACTGGGGATTTAACCAAAGG + Intergenic
978929417 4:114292651-114292673 ATTACTGGGTATGTGCCCAAAGG + Intergenic
979037778 4:115747467-115747489 ATTACTGGGTATATGCCCAAAGG + Intergenic
979141197 4:117176915-117176937 ATTACTGGGTATATACCAAAAGG - Intergenic
979197360 4:117936329-117936351 ATTACTGGGTATATGCCCAAAGG - Intergenic
979225573 4:118280496-118280518 AGAAATGGGGATTTGTGAAAAGG + Exonic
979394219 4:120166579-120166601 ACTACTGGGTATTTGCCCAAAGG + Intergenic
979489087 4:121304431-121304453 AGTACTGGGTATTTATCCAAAGG - Intergenic
979827377 4:125256157-125256179 ATTACTGGGTATATGCCCAAAGG - Intergenic
980018692 4:127682246-127682268 ATTACTGGGTATATGCCCAAAGG + Intronic
980233152 4:130069824-130069846 ATTACTGGGCATATGCCCAAAGG - Intergenic
980332202 4:131424587-131424609 ATTACTGGGTATATGCCCAAAGG + Intergenic
980390155 4:132134369-132134391 AGTACTGGGTATATACCCAAAGG + Intergenic
980580553 4:134744651-134744673 AATACTGGGTATTTACCAAGAGG + Intergenic
980585872 4:134815899-134815921 ATTACTGGGTATTTACCCAAAGG - Intergenic
980610384 4:135152714-135152736 ACTACTGGGTATTTACCCAAAGG - Intergenic
981151422 4:141383406-141383428 ATTACTGGGTATTTACCCAAAGG + Intergenic
981408306 4:144397170-144397192 ATTACTGGGTATGTGCCCAAAGG + Intergenic
981865092 4:149407850-149407872 ACTACTGGGGATCTACCCAAAGG - Intergenic
981980631 4:150786815-150786837 AATACTGGGGAATTGCAATAGGG - Intronic
982611985 4:157586330-157586352 AATACTGGGGAATTCCAAAAAGG - Intergenic
982626349 4:157771460-157771482 ATTACTGGGTATATGCCCAAAGG + Intergenic
982825035 4:159993590-159993612 ATTACTGGGTATATACCAAAAGG - Intergenic
983653120 4:170053249-170053271 AGTTCTAGGGATTTGCCTTAAGG - Intergenic
984373351 4:178894705-178894727 AGAACCTGGGATCTGCCAAATGG - Intergenic
984605409 4:181780135-181780157 ATTACTGGGGATATACCCAAAGG - Intergenic
985232557 4:187836726-187836748 ATTACTGGGTATATACCAAAAGG - Intergenic
985442189 4:189990317-189990339 ATTACTGGGTATATGCCCAAAGG - Intergenic
985835076 5:2264547-2264569 ATTACTGGGTATATACCAAAAGG + Intergenic
986252488 5:6073017-6073039 ATTACTGGGTATATGCCCAAAGG + Intergenic
986294916 5:6430023-6430045 ACTAGTGGGCATTTGCCCAAAGG - Intergenic
986670939 5:10141943-10141965 ACTACTGGGGATTTATCCAAAGG + Intergenic
986790857 5:11158397-11158419 AGTACTGTATATTTGCCATATGG + Intronic
986902261 5:12450974-12450996 ATTACTGGGTATATGCCCAAAGG + Intergenic
986904190 5:12473472-12473494 ATTACTGGGTATATGCCTAAAGG + Intergenic
987013921 5:13797696-13797718 ATTACTGGGCATATACCAAAAGG + Intronic
987490507 5:18575142-18575164 ATTACTGGGTATGTGCCCAAAGG + Intergenic
987514817 5:18891834-18891856 ATTACTGGGTATTTACCCAAAGG + Intergenic
987615643 5:20270625-20270647 ATTACTGGGTATATACCAAAAGG + Intronic
987784163 5:22477584-22477606 ATTACTGAGTATATGCCAAAAGG - Intronic
987893258 5:23911444-23911466 AGTACTGGGTATATACCCAAAGG + Intergenic
987977320 5:25031213-25031235 ATTACTGGGCATATACCAAAAGG - Intergenic
987999650 5:25331525-25331547 ATAACTGGGGACCTGCCAAATGG + Intergenic
989083552 5:37651463-37651485 ATTACTGGGTATTTACCCAAAGG - Intronic
989085650 5:37673401-37673423 ATTACTGGGTATATGCCCAAAGG - Intronic
989282791 5:39664936-39664958 AGAACTTGGGACTCGCCAAACGG + Intergenic
989607220 5:43256078-43256100 GGAACTGGGGATTTCACAAAGGG + Intronic
989623500 5:43408131-43408153 ATTACTGGGCATTTACCCAAAGG + Intronic
989680767 5:44027317-44027339 ATTACTGGGTATATGCCCAAAGG - Intergenic
989845590 5:46136498-46136520 ATTACTGGGTATATGCCCAAGGG + Intergenic
989948397 5:50267834-50267856 ATTACTGGGTATATGCCCAAAGG - Intergenic
990317792 5:54600470-54600492 ATTACTGGGTATATACCAAAGGG + Intergenic
990619478 5:57544166-57544188 ATTACTGGGTATATGCCCAAAGG - Intergenic
990835752 5:60017795-60017817 ATTACTGGGTATATGCCCAAAGG - Intronic
990885083 5:60582142-60582164 ATTACTGGGTATATGCCCAAAGG - Intergenic
990923408 5:60993431-60993453 AGAACTTGGGACCTGCCAAATGG - Intronic
991078227 5:62566127-62566149 ATTACTGGGTATATACCAAAAGG - Intronic
991110226 5:62891372-62891394 ATTACTGGGTATATGCCCAAAGG - Intergenic
991652588 5:68870925-68870947 ATTACTGGGTATTTTCCCAAAGG + Intergenic
992274112 5:75097158-75097180 ATTACTGGGTATATGCCCAAAGG - Intronic
992277640 5:75136656-75136678 ATTACTGGGTATATGCCCAAAGG + Intronic
993139915 5:84019037-84019059 ATTACTGGGTATATGCCCAAAGG + Intronic
993144333 5:84074841-84074863 ATTACTGGGTATATGCCCAAAGG + Intronic
993265983 5:85726941-85726963 ATTACTGGGTATATACCAAAAGG + Intergenic
993270828 5:85793655-85793677 ATTACTGGGTATATGCCCAAAGG - Intergenic
993322777 5:86494656-86494678 ACTACTGGACATTTGCCCAAAGG - Intergenic
993429319 5:87812588-87812610 ACTCCTAGGTATTTGCCAAAGGG - Intergenic
993821107 5:92617976-92617998 ATTACTGGGTATATACCAAAAGG - Intergenic
993878724 5:93339000-93339022 ATTACTGGGGATATACCCAAAGG - Intergenic
993895479 5:93528541-93528563 ATTACTGGGGATATACCCAAAGG + Intergenic
993918062 5:93766681-93766703 ATTACTGGGGATATACCCAAAGG + Intronic
993918575 5:93771948-93771970 ATTACTGGGTATATACCAAAAGG + Intronic
993922676 5:93827094-93827116 ATTACTGGGGATATACCCAAAGG - Intronic
994143031 5:96362332-96362354 ATTACTGGGGATATACCCAAAGG - Intergenic
994177890 5:96732001-96732023 ATTACTGGGTATATACCAAAAGG - Intronic
994256081 5:97597751-97597773 AGTACTGGGTATATACCCAAAGG + Intergenic
994266055 5:97718284-97718306 ATTACTGGGGATATACCCAAAGG - Intergenic
994468506 5:100170858-100170880 ATTACTGGGTATATGCCCAAAGG + Intergenic
994990822 5:106994786-106994808 ATTACTGGGTATATGCCCAAAGG - Intergenic
995113086 5:108449143-108449165 ATTACTGTGTATTTGCCTAATGG + Intergenic
995332129 5:110957280-110957302 AGAACTCGGGACCTGCCAAATGG + Intergenic
995677712 5:114681845-114681867 ATTACTGGGTATATGCCCAAAGG + Intergenic
995750361 5:115447695-115447717 ATTACTGGGTATATGCCCAACGG + Intergenic
995895174 5:117003133-117003155 ATTACTGGGTATATACCAAAAGG - Intergenic
995919377 5:117293158-117293180 ATTACTGGGTATATACCAAAAGG - Intergenic
996050396 5:118925894-118925916 ACTACTGGGTATTTACCCAAAGG + Intronic
996213305 5:120837617-120837639 ATTACTGGGTATATGCCCAAAGG + Intergenic
996271330 5:121608083-121608105 ATTACTGGGGATATACCCAAAGG + Intergenic
996660743 5:125999293-125999315 ATTACTGGGGATATACCTAAAGG + Intergenic
996696072 5:126396677-126396699 ATTACTGGGTATATACCAAAAGG - Intronic
996854440 5:127989276-127989298 ATTACTGGGTATTTACCCAAAGG - Intergenic
997102542 5:130984893-130984915 AGTTCTGGGCATTTACCCAAAGG - Intergenic
997117829 5:131145074-131145096 ATTACTGGGTATATGCCCAAAGG + Intergenic
997237219 5:132279815-132279837 TGTTCTGGGGACTTGCCAAGTGG - Intronic
997793384 5:136783300-136783322 ATTACTGGGGATATACCCAAAGG - Intergenic
997805467 5:136913063-136913085 ATTACTGGGGATATACCCAAAGG - Intergenic
998289286 5:140897687-140897709 ATTACTGGGTATATGCCCAAAGG - Intronic
998542966 5:143000513-143000535 ATTACTGGGTATATACCAAAAGG + Intronic
998667140 5:144310399-144310421 ACTACTGGGTATTTGTCCAAAGG - Intronic
998731895 5:145087495-145087517 ACTACTGGGTATATGCCCAAAGG - Intergenic
998739866 5:145188344-145188366 ATTACTGGGTATATACCAAAAGG - Intergenic
998926875 5:147136196-147136218 ATTACTGGGTATTTACCCAAAGG - Intergenic
999087850 5:148909169-148909191 ACTACTAGGTATTTGCCCAAAGG + Intergenic
999321329 5:150616982-150617004 AGTACTGGGGATATAGCAGAGGG - Intronic
999558531 5:152773271-152773293 ATTACTGGGGATATACCCAAAGG + Intergenic
999581357 5:153041907-153041929 ATTACTGGGGATATACCCAAAGG - Intergenic
999963983 5:156788439-156788461 ATTACTGGGTATTTACCCAAAGG + Intergenic
1000293509 5:159892833-159892855 ATTACTGGGTATCTGCCCAAAGG - Intergenic
1000387718 5:160690848-160690870 ATTACTGGGGATATACCCAAAGG + Intronic
1000612631 5:163391432-163391454 ATTACTGGGTATTTACCCAAAGG - Intergenic
1001161965 5:169327235-169327257 ATTACTGGGGATATACCCAAAGG + Intergenic
1001630553 5:173171932-173171954 ATTACTGGGTATATGCCCAAAGG - Intergenic
1003080873 6:3020285-3020307 ATTACTGGGTATCTACCAAAAGG - Intergenic
1003296190 6:4831102-4831124 ATTACTGGGGATATACCCAAAGG - Intronic
1003405814 6:5826382-5826404 ACTACTGGGGATATGTCCAAAGG + Intergenic
1003430655 6:6034231-6034253 AGTACTGAGCATTTGCTCAAAGG + Intergenic
1003472101 6:6446301-6446323 ATTACTGGGTATATACCAAAAGG - Intergenic
1003730159 6:8812737-8812759 ATTACTGGGGATATACCCAAAGG + Intergenic
1003818889 6:9872896-9872918 AGTACTGGGTATATACCCAAAGG + Intronic
1003930692 6:10921379-10921401 ATTACTGGGTATATGCCTAAAGG - Intronic
1003988062 6:11457437-11457459 ATTACTGGGTATATGCCCAAAGG + Intergenic
1004030570 6:11864662-11864684 ATTACTGGGTATATGCCCAAAGG + Intergenic
1004549946 6:16636988-16637010 ATTACTGGGGATATACCCAAAGG + Intronic
1004556420 6:16702973-16702995 ATTACTGGGTATATACCAAAAGG + Intronic
1004593774 6:17079394-17079416 AGTACTGGGTATATACCCAAAGG + Intergenic
1004717666 6:18233838-18233860 ATTACTGGGGATATACCCAAAGG + Intronic
1004844512 6:19624844-19624866 AGTACTGGGTATCTACCCAAGGG + Intergenic
1005441228 6:25871131-25871153 ATTACTGGGGATATACCCAAAGG + Intronic
1005846626 6:29785320-29785342 ATTACTGGGTATATGCCCAACGG + Intergenic
1006222928 6:32509765-32509787 ATTACTGGGTATATGCCCAAAGG + Intergenic
1006551455 6:34826786-34826808 ATTACTGGGGTCTTGTCAAAAGG - Intronic
1006893084 6:37446583-37446605 AGTACTGGGGATATCCAGAATGG + Intronic
1007314283 6:40972559-40972581 ATTACTGGGGATATACCCAAAGG - Intergenic
1007948459 6:45847618-45847640 ATTACTGGGTATATGCCCAAAGG - Intergenic
1008084299 6:47228094-47228116 ATTACTGGGTATATGCCCAAAGG + Intergenic
1008201067 6:48591525-48591547 AGTACTGGTTATTTACCCAAAGG - Intergenic
1008451451 6:51655980-51656002 ACTACTGGGGATATACCCAAAGG + Intronic
1008712916 6:54250351-54250373 ATTACTGGGTATTTACCCAAAGG + Intronic
1009527746 6:64767783-64767805 ACTATTGGGCATTTACCAAAAGG - Intronic
1009547364 6:65036951-65036973 AGTACTGGGTATATACCCAAAGG + Intronic
1009634706 6:66250488-66250510 ATTACTGGGTATTTACCGAAAGG + Intergenic
1009656100 6:66546563-66546585 ATTACTGGGGATATACCCAAAGG + Intergenic
1009771391 6:68146601-68146623 ATTACTGGGTATATGCCAAAAGG - Intergenic
1009779479 6:68251355-68251377 ACTACTGGGTATTTACCTAAAGG - Intergenic
1010291605 6:74143948-74143970 ACTACTGGGTATATACCAAAAGG - Intergenic
1010319588 6:74490316-74490338 ATTACTGGGTATATGCCCAAAGG + Intergenic
1010338945 6:74724668-74724690 ATTACTGGGTATATGCCCAAAGG - Intergenic
1010513495 6:76746148-76746170 ATTACTGGGTATATGCCCAAAGG - Intergenic
1010582225 6:77614005-77614027 ATTACTGGGTATATACCAAAAGG - Intergenic
1010759071 6:79701223-79701245 AGTCCCTGGGATTTGTCAAATGG - Exonic
1011008139 6:82671415-82671437 AGTGCTGGGGATTTACAGAATGG + Intergenic
1011036345 6:82980094-82980116 ACTACTGGGTATTTACCTAAAGG - Intronic
1011105327 6:83773278-83773300 ATTACTGGGTATATGCCCAAAGG - Intergenic
1011160354 6:84382390-84382412 ACTACTGGGTATCTGCCCAAAGG - Intergenic
1011626304 6:89286376-89286398 AGTAGTTGGGATTTGCTAAGAGG + Intronic
1011803725 6:91047644-91047666 ATTACTGGGTATATGCCCAAAGG - Intergenic
1011858433 6:91724488-91724510 ATTACTGGGTATATGCCCAAAGG - Intergenic
1011866926 6:91840760-91840782 ACTACTGGGTATCTACCAAAAGG - Intergenic
1012082560 6:94779952-94779974 ATTACTGGGTATATACCAAAAGG - Intergenic
1012117062 6:95314310-95314332 ACTACTGGGTATTTACCCAAAGG + Intergenic
1012231121 6:96762290-96762312 AGAACTTGGGAACTGCCAAATGG - Intergenic
1012525424 6:100171170-100171192 AATTCTGGGGATATGCTAAATGG - Intergenic
1012653616 6:101788709-101788731 ATTACTGGGTATATGCCCAAAGG - Intronic
1012868150 6:104642391-104642413 ATTACTGGGTATATGCCCAAAGG + Intergenic
1013038512 6:106410516-106410538 ATTACTGGGTATATACCAAAAGG + Intergenic
1013091976 6:106908316-106908338 AGTAATCTGGTTTTGCCAAAAGG - Intergenic
1013471111 6:110466766-110466788 ACTACTGGGTATTTACCCAAAGG + Intronic
1013902136 6:115169565-115169587 ATTACTGGGTATATGCCCAAAGG - Intergenic
1014061917 6:117081667-117081689 ATTACTGGGTATATGCCCAAAGG + Intergenic
1014310636 6:119796704-119796726 ATTACTGGGTATGTGCCCAAAGG + Intergenic
1014330776 6:120060814-120060836 ACTACTGGGTATTTACCCAAAGG + Intergenic
1014376627 6:120683477-120683499 AGTACTGGGTATCTACCCAAAGG + Intergenic
1014480894 6:121935389-121935411 AGTACTGGGTATATACCCAAAGG - Intergenic
1014515862 6:122377724-122377746 ATTACTGGGTATATGCCCAAAGG - Intergenic
1014985511 6:128002003-128002025 TGAACTGGGGATTTGCCCCAGGG - Intronic
1015463171 6:133517016-133517038 AGTACTGGGTATATACCCAAAGG - Intronic
1016076698 6:139804715-139804737 AGAACTCGGGACTTGCCAAATGG - Intergenic
1016487753 6:144561873-144561895 AGTACTGTGCATTTGACTAAAGG - Intronic
1016758804 6:147715643-147715665 AGAACTTGGGACCTGCCAAATGG - Intronic
1017323169 6:153116566-153116588 ATTACTGGGTATATACCAAAAGG + Intronic
1017640241 6:156486242-156486264 ATTACTGGGTATATGCCCAAAGG + Intergenic
1018250104 6:161861072-161861094 ATTACTGGGTATATGCCCAAAGG + Intronic
1018660655 6:166083669-166083691 ACTACTGGGCATTTACCCAAAGG + Intergenic
1018672068 6:166187453-166187475 ATTACTGGGTATATGCCCAATGG + Intergenic
1020555038 7:9660174-9660196 AGTACTGGGTATATACCCAAAGG + Intergenic
1020573923 7:9901631-9901653 ATTACTGGGCATTTACCCAAAGG - Intergenic
1020645147 7:10806397-10806419 ATTACTGGGTATATACCAAAAGG - Intergenic
1020833547 7:13121319-13121341 ATTACTGGGTATGTACCAAAAGG - Intergenic
1021240021 7:18188985-18189007 ATTACTGGGTATATGCCCAAAGG + Intronic
1021605383 7:22404387-22404409 AATATTGGGTATTTTCCAAATGG - Intergenic
1022229654 7:28401910-28401932 ATTACTGGGTATATACCAAAAGG - Intronic
1022441503 7:30436866-30436888 ATTACTGGGTATTTACCCAAAGG + Intronic
1022616178 7:31932707-31932729 ATTACTGGGTATATGCCCAAAGG + Intronic
1022762921 7:33376542-33376564 ATTACTGGGTATATACCAAAAGG - Intronic
1022869645 7:34462824-34462846 ATTACTGGGTATATACCAAAAGG + Intergenic
1022899170 7:34785023-34785045 ATTACTGGGTATTTACCCAAAGG + Intronic
1022900404 7:34803209-34803231 ATTACTGGGTATTTACCCAAAGG + Intronic
1023467960 7:40478699-40478721 TGTACTTGAAATTTGCCAAAAGG - Intronic
1023510107 7:40943778-40943800 ATTACTGGGTATTTACCCAAAGG - Intergenic
1024135391 7:46402155-46402177 ATTACTGGGGATATACCCAAAGG + Intergenic
1024310077 7:47961074-47961096 ACTACTGGGTATTTACCCAAAGG + Intronic
1024496024 7:50046787-50046809 ATTACTGGGTATATGCCCAAAGG + Intronic
1024514605 7:50235057-50235079 ATTACTGGGTATATGCCCAAAGG - Intergenic
1024590560 7:50879075-50879097 ATTACTGGGTATATGCCCAAAGG + Intergenic
1024845184 7:53634189-53634211 ATTACTGGGTATATGCCAAAAGG + Intergenic
1026116501 7:67500098-67500120 ATTACTGGGCATATGCCCAAAGG + Intergenic
1026515137 7:71063034-71063056 ATTACTGGGTATATGCCCAAAGG + Intergenic
1027190966 7:75995219-75995241 AGGAGTGGGGTTTTGCCAGAGGG - Intergenic
1027300915 7:76833743-76833765 ATTACTGGGTATTTACCCAAAGG - Intergenic
1027449088 7:78309179-78309201 ATTACTGGGTATATGCCCAAAGG + Intronic
1027963507 7:84977037-84977059 AGTACTGGGTATATACCCAAAGG + Intergenic
1028056886 7:86256271-86256293 ATTACTGGGTATATACCAAAAGG + Intergenic
1028077388 7:86533649-86533671 ATTACTGGGTATATACCAAAAGG - Intergenic
1028139555 7:87258356-87258378 ATTACTGGGTATTTACCCAAAGG - Intergenic
1028140286 7:87265989-87266011 ATTACTGGGTATTTACCCAAAGG + Intergenic
1028146437 7:87325114-87325136 GGTACATGGGATTGGCCAAATGG - Intergenic
1028279443 7:88903453-88903475 AGTACTGGGTATATACCCAAAGG - Intronic
1028315964 7:89403704-89403726 ATTACTGGGTATATGCCCAAAGG - Intergenic
1028321199 7:89462263-89462285 ATTACTGGGTATATGCCCAAAGG - Intergenic
1028378857 7:90176247-90176269 AGAACTCAGGACTTGCCAAATGG - Intronic
1028513391 7:91649858-91649880 ATTACTGGGTATATACCAAAAGG + Intergenic
1028521420 7:91735397-91735419 ATTACTGGGTATATACCAAAAGG + Intronic
1028699953 7:93765913-93765935 ATTACTGGGTATATGCCCAAAGG + Intronic
1028720642 7:94026996-94027018 ATTACTGGGTATATACCAAAAGG - Intergenic
1028787482 7:94812294-94812316 ACTACTGGGTATTTACCCAAAGG + Intergenic
1029833283 7:103282351-103282373 ATTACTGGGTATATGCCCAAAGG - Intergenic
1030008512 7:105142007-105142029 AGTACTGGGGATTTGCCAAAAGG - Exonic
1030374570 7:108740120-108740142 ATTACTGGGAATATACCAAAAGG - Intergenic
1030647050 7:112073281-112073303 ACTACTGGGTATTTACCCAATGG + Intronic
1031035670 7:116785301-116785323 AGTGCTGGGGCTTTGCCAGGTGG - Intronic
1031285423 7:119860433-119860455 ATTACTGGGTATATGCCCAAAGG + Intergenic
1031715467 7:125103855-125103877 AGTACTGGGTATATACCCAAAGG + Intergenic
1032660795 7:133981741-133981763 ATTACTGGGTATATGCCCAAAGG + Intronic
1032966871 7:137107810-137107832 ATTACTGGGTATATGCCCAAAGG + Intergenic
1033586376 7:142777680-142777702 ATTACTGGGCATTTACCCAAAGG - Intergenic
1034039606 7:147863428-147863450 ATTACTGGGTATATACCAAAAGG - Intronic
1034698894 7:153079681-153079703 ACTACTGGGTATCTGCCCAAAGG - Intergenic
1034708091 7:153164569-153164591 AGTACTGGGCATCTACCCAAAGG - Intergenic
1035136907 7:156712504-156712526 AGTACTGGGTATCTACCCAAAGG + Intronic
1035763757 8:2088762-2088784 ATTACTGGGTATATGCCCAAAGG - Intronic
1035827224 8:2657581-2657603 ACTACTGGGTATTTACCCAAAGG - Intergenic
1035959240 8:4118734-4118756 ATTACTGGGTATATGCCCAAAGG + Intronic
1036063425 8:5351822-5351844 ATTACTGGGTATATACCAAAAGG + Intergenic
1036718493 8:11149738-11149760 ATTACTGGGCATTTGTCCAAAGG + Intronic
1036929492 8:12941007-12941029 ATTACTGGGTATATACCAAAAGG + Intergenic
1037028621 8:14072615-14072637 ATTACTGGGTATATACCAAAAGG - Intergenic
1037051345 8:14378028-14378050 ATTACTGGGTATATGCCCAAAGG - Intronic
1037150305 8:15627455-15627477 AGAACTTGGGACCTGCCAAATGG + Intronic
1037166317 8:15833350-15833372 ATTACTGGGTATATACCAAAAGG + Intergenic
1037215815 8:16449665-16449687 ATTACTGGGTATATACCAAAAGG + Intronic
1037755894 8:21709915-21709937 AATATTTGGGATTTCCCAAAGGG - Intronic
1038100648 8:24370501-24370523 ACTACTTAGGATTTACCAAAAGG - Intergenic
1038831431 8:31065740-31065762 ATTACTGGGTATATACCAAAAGG - Intronic
1038855261 8:31324157-31324179 AGTACTGGGTATATACCCAAAGG - Intergenic
1039005418 8:33031240-33031262 ATTACTGGGTATATGCCCAAAGG + Intergenic
1039031329 8:33312738-33312760 CGTTCTGGGGATTTGATAAAAGG - Intergenic
1039212073 8:35228628-35228650 ATTACTGGGTATATGCCCAAAGG - Intergenic
1039783256 8:40808945-40808967 AGTACTGGGTATATACCCAAAGG - Intronic
1040126926 8:43748164-43748186 AGTACTGGGTATATACCCAAAGG - Intergenic
1040364349 8:46699716-46699738 ATTACTGGGGATATACCCAAAGG - Intergenic
1040426902 8:47297956-47297978 ATTACTGGGTATATACCAAAAGG - Intronic
1040608042 8:48954401-48954423 ATTACTGGGTATATGCCCAAAGG - Intergenic
1040747935 8:50668979-50669001 ATTACTGGGTATATGCCCAAAGG - Intronic
1040802008 8:51352232-51352254 ACTACTGGGTATTTACCAAAAGG + Intronic
1040827681 8:51641848-51641870 ATTACTGGGTATATACCAAAAGG + Intronic
1040842426 8:51798894-51798916 ATTACTGGGTATATGCCCAAAGG + Intronic
1041295180 8:56349505-56349527 ATTACTGGGTATATACCAAAAGG - Intergenic
1041387692 8:57321448-57321470 AGTACTGGGTATATACCCAAAGG - Intergenic
1041580787 8:59457330-59457352 ATTACTGGGTATATGCCCAAAGG - Intergenic
1041728431 8:61040334-61040356 ATTACTGGGTATATGCCCAAAGG - Intergenic
1041946036 8:63444001-63444023 ATTACTGGGTATATACCAAAAGG - Intergenic
1042016319 8:64317217-64317239 AGTACTGGGTATATACCCAAAGG - Intergenic
1042523113 8:69735312-69735334 ATTACTGGGGATATACCCAAAGG + Intronic
1043041782 8:75272981-75273003 ATTACTGGGCATATGCCCAAAGG + Intergenic
1043067224 8:75590291-75590313 AATATTGGGTATATGCCAAAAGG - Intergenic
1043128362 8:76429138-76429160 ATTACTGGGTATTTACCCAAAGG - Intergenic
1043145117 8:76643406-76643428 ATTACTGGGTATATGCCCAAAGG - Intergenic
1043339900 8:79225222-79225244 ATTACTGGGTATATGCCCAAAGG + Intergenic
1043628843 8:82300675-82300697 ATTACTGGGTATATACCAAAAGG - Intergenic
1043707991 8:83377783-83377805 AGAACTTGGGACTTGCCAAATGG - Intergenic
1043814663 8:84787520-84787542 ATTACTGGGGATATACCCAAAGG - Intronic
1043828599 8:84960516-84960538 ACTACTTGGTATTTACCAAAAGG + Intergenic
1043884297 8:85580862-85580884 ATTACTGGGTATATACCAAAAGG - Intergenic
1043981757 8:86650377-86650399 ACTACTGGGTATCTACCAAAAGG + Intronic
1043985448 8:86690061-86690083 ATTACTGGGTATATGCCCAAAGG - Intronic
1044318747 8:90778617-90778639 ATTACTGGGTATATGCCCAAAGG - Intronic
1044366695 8:91356227-91356249 ATTACTGGGTATATACCAAAAGG - Intronic
1044381365 8:91537843-91537865 ATTACTGGGGATATACCCAAAGG + Intergenic
1044501988 8:92968300-92968322 ATTACTGGGTATATGCCCAAAGG - Intronic
1044516457 8:93144413-93144435 ACTACTGGGTATTTACCCAAAGG + Intronic
1044600919 8:94004130-94004152 ATTACTGGGTATATGCCCAAAGG - Intergenic
1044745898 8:95370580-95370602 ATTACTGGGTATATGCCCAAAGG - Intergenic
1044809981 8:96050159-96050181 ATTACTGGGTATTTACCCAAAGG + Intergenic
1044864513 8:96557267-96557289 ATTACTGGGTATATGCCCAAAGG + Intronic
1045159277 8:99519444-99519466 ATTACTGGGGATGTACCCAAAGG + Intronic
1045165623 8:99601498-99601520 ATTACTGGGGATATACCCAAAGG - Intronic
1045200240 8:99973156-99973178 ATTACTGGGGATATACCCAAAGG + Intronic
1045527959 8:102957558-102957580 ATTACTGGGGATATACCCAAAGG - Intronic
1045854166 8:106743741-106743763 ATTACTGGGTATTTACCCAAAGG + Intronic
1045979844 8:108171892-108171914 ATTACTGGGGATATACCCAAAGG + Intergenic
1046054878 8:109067410-109067432 ATTACTGGGTATATGCCCAAAGG - Intergenic
1046147679 8:110182542-110182564 AGTACTGGGTATTTATCCAAAGG - Intergenic
1046234714 8:111407856-111407878 ACTACTGGGTATATGCCCAAAGG - Intergenic
1046338424 8:112821151-112821173 ATTACTGGGTATATGCCCAAAGG - Intronic
1046398930 8:113677880-113677902 ATTACTGGGTATATGCCTAAAGG + Intergenic
1046674602 8:117094244-117094266 AGAACTCGGGACCTGCCAAATGG - Intronic
1046903709 8:119549800-119549822 ATTACTGGGTATATGCCCAAAGG - Intergenic
1047104621 8:121719568-121719590 AGAACTTGGGACCTGCCAAATGG - Intergenic
1048120502 8:131575696-131575718 ATTACTGGGCATATACCAAAAGG + Intergenic
1048421638 8:134283633-134283655 AGAACTTGGGATTCACCAAATGG - Intergenic
1048629136 8:136221655-136221677 ATTACTGGGTATATGCCAAAGGG + Intergenic
1048714313 8:137250805-137250827 AGTACTGGGTATCTACCCAAAGG + Intergenic
1048729966 8:137427472-137427494 ATTACTGGGTATATGCCCAAAGG - Intergenic
1048830473 8:138472022-138472044 AAGACTGGTGATTTGCAAAAGGG + Intronic
1050351854 9:4747737-4747759 AGTAATGGGGACATGCCAAAAGG - Intergenic
1050404998 9:5298652-5298674 ATTACTGGGCATATGCCCAAAGG + Intergenic
1050589647 9:7148625-7148647 AGAACTTGGGACCTGCCAAATGG - Intergenic
1050674993 9:8042118-8042140 ATTACTGGGTATATGCCCAAAGG - Intergenic
1050885859 9:10763941-10763963 AGTACTGGGTATATACCCAAAGG - Intergenic
1050946663 9:11529870-11529892 ATTACTGGGTATATGCCCAAAGG - Intergenic
1050948001 9:11550228-11550250 AGAACTTGGGACCTGCCAAATGG + Intergenic
1050972690 9:11897064-11897086 ATTACTGGGTATATGCCCAAAGG + Intergenic
1050979148 9:11987028-11987050 ATTACTGGGTATTTACCCAAAGG - Intergenic
1051141540 9:13984682-13984704 ATTACTGGGGATATACCCAAAGG - Intergenic
1051688420 9:19683083-19683105 AGTGCAGGGCATTTGCCAAAGGG + Intronic
1051862860 9:21646300-21646322 ATTACTGGGTATATGCCCAAAGG - Intergenic
1052623574 9:30944723-30944745 AGAACTTGGGACCTGCCAAATGG + Intergenic
1053765352 9:41388791-41388813 ATTACTGGGTATATGCCCAAAGG - Intergenic
1054883249 9:70167901-70167923 AGTCCTGGTGATTTGCCATCTGG - Intronic
1054992474 9:71345232-71345254 ATTACTGGGTATATGCCCAAAGG + Intronic
1055966677 9:81872440-81872462 ACGACTGGGCATTTTCCAAAGGG + Intergenic
1056098676 9:83279447-83279469 ATTACTGGGTATATGCCCAAAGG + Intronic
1056239348 9:84628778-84628800 ATTACTGGGTATATGCCCAAAGG + Intergenic
1056669631 9:88615380-88615402 ATTACTGGGTATATACCAAAAGG - Intergenic
1057902923 9:98963520-98963542 AGCACTGGGGAATTTCAAAATGG - Intronic
1058016284 9:100036036-100036058 ATTACTGGGGATATACCCAAAGG + Intronic
1058226115 9:102365810-102365832 ATTACTGGGTATTTACCCAAAGG + Intergenic
1058227639 9:102385262-102385284 ATTACTGGGTATATACCAAAAGG + Intergenic
1058422701 9:104847788-104847810 TTTACTGAGCATTTGCCAAACGG + Intronic
1058449777 9:105085202-105085224 ATTACTGGGGATATACCCAAAGG - Intergenic
1058516713 9:105783567-105783589 ATTACTGGGTATGTGCCCAAAGG - Intergenic
1058549353 9:106097353-106097375 ATTACTGGGTATTTACCCAAAGG + Intergenic
1058568423 9:106312556-106312578 AGTACTTGGGATTAGACAACAGG + Intergenic
1059028127 9:110659193-110659215 ATTACTGGGTATATGCCCAAAGG + Intergenic
1059070057 9:111125911-111125933 ATTACTGGGTATATACCAAAAGG - Intergenic
1059589332 9:115640876-115640898 AGTACTGGGTATATGACTAAAGG - Intergenic
1059681585 9:116591040-116591062 AGAACTCGAGACTTGCCAAATGG + Intronic
1059829484 9:118078267-118078289 ATTACTGGGCATATGCCCAAAGG - Intergenic
1059830264 9:118087221-118087243 ATTACTGGGGATATACCCAAAGG - Intergenic
1060092357 9:120754466-120754488 ACTACTGGGTATATGCCCAAAGG - Intronic
1060885200 9:127146878-127146900 ATTACTGGGTATATGCCTAAAGG - Intronic
1062329180 9:136029453-136029475 AGAACTCGGGACCTGCCAAATGG + Intronic
1203532531 Un_GL000213v1:160237-160259 ACTACTGGGTATTTGCTCAAAGG + Intergenic
1203623898 Un_KI270749v1:152125-152147 AGTACTGGGCATATACCCAAAGG - Intergenic
1185821873 X:3213046-3213068 AGTACTGGGTATTTTCCCAAAGG + Intergenic
1185988159 X:4859945-4859967 ATTACTGGGTATATACCAAAAGG + Intergenic
1186030533 X:5364602-5364624 ACTACTGGGTATCTACCAAAGGG + Intergenic
1186224010 X:7377871-7377893 ACTACTGGGTATCTGCCCAAAGG - Intergenic
1186592049 X:10941111-10941133 ATTACTGGGTATATGCCCAAAGG - Intergenic
1187054321 X:15727690-15727712 ATTACTGGGTATATGCCCAAAGG - Intronic
1187071221 X:15890535-15890557 TGTACTGGAAATTTGCCAAAAGG + Intergenic
1187080251 X:15978693-15978715 AGTACTGGGTATCTACCCAAAGG + Intergenic
1187591729 X:20724242-20724264 ATTACTGGGTATATGCCCAAAGG + Intergenic
1187622104 X:21068117-21068139 ATTACTGGGTATATGCCCAAAGG - Intergenic
1187831553 X:23387932-23387954 AGGACTGAGGAGTTGCCAACGGG - Intronic
1188058222 X:25566312-25566334 ACTACTGGGTATCTGCCCAAAGG - Intergenic
1188093290 X:25989870-25989892 ATTACTGGGTATATACCAAAAGG + Intergenic
1188134412 X:26476968-26476990 ATTACTGGGTATATGCCCAAAGG + Intergenic
1188336386 X:28939174-28939196 ATTACTGGGTATATGCCCAAAGG + Intronic
1188406267 X:29814090-29814112 ATTACTGGGTATATGCCCAAAGG - Intronic
1188750990 X:33905644-33905666 AGAACTGGGGAGTTCCAAAAAGG + Intergenic
1189133837 X:38528813-38528835 ATTACTGGGTATTTACCCAAAGG + Intronic
1189385431 X:40533157-40533179 AGTACTGGGTATCTACCCAAAGG + Intergenic
1189735495 X:44065931-44065953 ATTACTGGGTATTTACCCAAAGG - Intergenic
1190603496 X:52116749-52116771 ACTACTGGGTATATACCAAAAGG + Intergenic
1190625632 X:52335997-52336019 ATTACTGGGTATATACCAAAAGG + Intergenic
1190805353 X:53830608-53830630 ACTACTGGGTATATGCCCAAAGG - Intergenic
1191203087 X:57805534-57805556 ATTACTGGGTATATACCAAAAGG - Intergenic
1191220230 X:57980125-57980147 ATTACTGGGTATATGCCCAAAGG - Intergenic
1191735148 X:64381093-64381115 ATTACTGGGTATATGCCCAAAGG - Intronic
1191796934 X:65031364-65031386 ATGAGTGGGAATTTGCCAAAAGG - Intronic
1191883982 X:65870949-65870971 ATTACTGGGTATATACCAAAAGG - Intergenic
1192628340 X:72753733-72753755 ATTACTGGGTATATACCAAAAGG - Intergenic
1192653368 X:72967077-72967099 ATTACTGGGTATATACCAAAAGG + Intergenic
1192762804 X:74112178-74112200 AGTACTGGGTATTTATCCAAAGG + Intergenic
1192977097 X:76298349-76298371 ATTACTGGGTATATGCCCAAAGG - Intergenic
1193046145 X:77056666-77056688 ACTACTGGGTATCTACCAAAAGG + Intergenic
1193063766 X:77235093-77235115 ATTACTGGGTATGTACCAAAAGG + Intergenic
1193074339 X:77339593-77339615 ATTACTGGGTATATGCCCAAAGG + Intergenic
1193162948 X:78248615-78248637 ACTACTGGGCATTTACCCAAAGG - Intergenic
1193178194 X:78420362-78420384 ATTACTGGGTATATGCCCAAAGG - Intergenic
1193209794 X:78793234-78793256 AGTACTGGGCATATACCCAAAGG + Intergenic
1193215925 X:78864408-78864430 ACTACTGGATATTTACCAAAAGG + Intergenic
1193263949 X:79445417-79445439 ATTACTGGGTATATGCCCAATGG + Intergenic
1193424135 X:81320175-81320197 AGTACTGGGTATATACCCAAAGG - Intergenic
1193470976 X:81902923-81902945 ACTACTGGGTATCTGCCCAAAGG - Intergenic
1193501960 X:82287806-82287828 ATTACTGGGTATATACCAAAAGG - Intergenic
1193574969 X:83185562-83185584 AGTACTTGGGACCTTCCAAATGG - Intergenic
1193857074 X:86616271-86616293 AGTACTGGGTACATGCCCAAAGG - Intronic
1193929151 X:87530769-87530791 ATTACTGGGTATATACCAAAAGG - Intronic
1193968167 X:88015878-88015900 AGCACTGAGCATTTCCCAAATGG + Intergenic
1194029623 X:88795858-88795880 ATTACTGGGTATGTGCCCAAAGG - Intergenic
1194327278 X:92535164-92535186 AGTACTGGGTATATACCCAAAGG + Intronic
1194563354 X:95449915-95449937 AATACTGGGTATATGCCCAAAGG + Intergenic
1194583103 X:95700350-95700372 AGTACTGGGTATCTACCCAAAGG - Intergenic
1194880096 X:99240244-99240266 ATTACTGGGTATATGCCCAAAGG + Intergenic
1194927456 X:99842524-99842546 ATTACTGGGTATATGCCCAAAGG + Intergenic
1195098529 X:101529976-101529998 ATTACTGGGTATATACCAAAAGG + Intronic
1195769320 X:108332347-108332369 ACTACTGGGTATCTACCAAAAGG - Intronic
1195847456 X:109243489-109243511 ATTACTGAGTATTTACCAAAAGG - Intergenic
1195951022 X:110273011-110273033 ACTACTGGGTATCTACCAAAAGG - Intronic
1196261735 X:113590905-113590927 AAAAATGGGGATTTGTCAAAAGG - Intergenic
1196392103 X:115218439-115218461 AATAGTGGGGGTTTGCCAAGGGG - Intronic
1196530276 X:116778438-116778460 AGTACTGGGTGTATGCCCAAAGG + Intergenic
1196571019 X:117266300-117266322 ATTACTGGGTATTTACCCAAAGG + Intergenic
1196584532 X:117414656-117414678 ATTACTGGGTATATGCCCAAGGG + Intergenic
1196995803 X:121382254-121382276 ATTACTGGGTATTTACCCAAAGG - Intergenic
1197045927 X:121998543-121998565 ATTACTGGGTATATGCCCAAAGG - Intergenic
1197093332 X:122564933-122564955 ACTACTGGGTATATGCCCAAAGG + Intergenic
1197127760 X:122967892-122967914 ACTACTGGGTATCTGCCCAAAGG + Intergenic
1197139599 X:123102207-123102229 AGTACTGGGCATATACCCAAAGG - Intergenic
1197480525 X:126979440-126979462 ACTACTGGGTATCTACCAAAAGG + Intergenic
1197566958 X:128099932-128099954 ATTACTGGGTATATACCAAAAGG - Intergenic
1197613783 X:128669535-128669557 ATTACTGGGTATATGCCTAAAGG - Intergenic
1197682299 X:129399035-129399057 AGTGTTGAGGATGTGCCAAAAGG + Intergenic
1197987633 X:132283948-132283970 ACTACTGGGTATTTACCCAAAGG - Intergenic
1198571798 X:137965313-137965335 ATTACTGGGTATATGCCCAAAGG + Intergenic
1198627649 X:138596502-138596524 ATTACTGGGCATATACCAAAAGG + Intergenic
1198699019 X:139376591-139376613 ACTACTGGGGATATACCCAAAGG + Intergenic
1198824606 X:140686207-140686229 ATTACTGGGTATTTACCCAAAGG + Intergenic
1198989647 X:142497059-142497081 ATTACTGGGTATATGCCCAAAGG - Intergenic
1199166130 X:144677968-144677990 TTTACTGGGTATATGCCAAAAGG - Intergenic
1199171218 X:144736176-144736198 ACTACTGGGTATGTACCAAAAGG + Intergenic
1199256359 X:145722811-145722833 ACTACTGGGTATATACCAAAAGG + Intergenic
1199478053 X:148267981-148268003 ATTACTGGGTATATGCCCAAAGG + Intergenic
1199640154 X:149852204-149852226 ATTACTGGGTATTTACCCAAAGG - Intergenic
1199705064 X:150417508-150417530 ATTACTGGGTATATGCCCAAAGG - Intronic
1199786104 X:151106433-151106455 ATTACTGGGTATATACCAAAAGG - Intergenic
1199790416 X:151149463-151149485 ACTACTGGGTATTTACCCAAAGG - Intergenic
1199888992 X:152056134-152056156 ATTACTGGGTATATGCCCAAAGG - Intergenic
1200340029 X:155386562-155386584 ACTACTGGGTATCTGCCCAAAGG - Intergenic
1200341019 X:155395646-155395668 AGTACTGGGTATATACCCAAAGG + Intergenic
1200346441 X:155454126-155454148 ACTACTGGGTATCTGCCCAAAGG + Intergenic
1200359510 X:155588974-155588996 AGTACTGGGTATTTATCTAAAGG + Intronic
1200386384 X:155895007-155895029 CGAAATGGAGATTTGCCAAAGGG - Intronic
1200635994 Y:5654372-5654394 AGTACTGGGTATATACCCAAAGG + Intronic
1200650770 Y:5837841-5837863 ATTACTGGGTATATGCCCAAAGG + Intergenic
1201234811 Y:11899118-11899140 ATTACTGGGTATATACCAAAAGG + Intergenic
1201252230 Y:12070893-12070915 ATTACTGGGTATATGCCTAAAGG - Intergenic
1201254896 Y:12097625-12097647 ATTACTGGGTATATACCAAAAGG + Intergenic
1201257064 Y:12118597-12118619 AGTACTGGGTGTTTTCCCAAAGG - Intergenic
1201405643 Y:13646961-13646983 ATTACTGGGTATATGCCCAAAGG - Intergenic
1201610940 Y:15842106-15842128 ATTACTGGGTATATGCCCAAAGG - Intergenic