ID: 1030008900

View in Genome Browser
Species Human (GRCh38)
Location 7:105146076-105146098
Sequence CAAATCTGTTGATACAACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030008896_1030008900 5 Left 1030008896 7:105146048-105146070 CCACCATCAGGCCTTTTCTAACT 0: 1
1: 0
2: 1
3: 20
4: 234
Right 1030008900 7:105146076-105146098 CAAATCTGTTGATACAACTCAGG No data
1030008895_1030008900 6 Left 1030008895 7:105146047-105146069 CCCACCATCAGGCCTTTTCTAAC 0: 1
1: 0
2: 1
3: 11
4: 129
Right 1030008900 7:105146076-105146098 CAAATCTGTTGATACAACTCAGG No data
1030008893_1030008900 8 Left 1030008893 7:105146045-105146067 CCCCCACCATCAGGCCTTTTCTA 0: 1
1: 0
2: 2
3: 19
4: 270
Right 1030008900 7:105146076-105146098 CAAATCTGTTGATACAACTCAGG No data
1030008894_1030008900 7 Left 1030008894 7:105146046-105146068 CCCCACCATCAGGCCTTTTCTAA 0: 1
1: 0
2: 2
3: 16
4: 199
Right 1030008900 7:105146076-105146098 CAAATCTGTTGATACAACTCAGG No data
1030008898_1030008900 -6 Left 1030008898 7:105146059-105146081 CCTTTTCTAACTAACTCCAAATC 0: 1
1: 0
2: 5
3: 22
4: 264
Right 1030008900 7:105146076-105146098 CAAATCTGTTGATACAACTCAGG No data
1030008897_1030008900 2 Left 1030008897 7:105146051-105146073 CCATCAGGCCTTTTCTAACTAAC 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1030008900 7:105146076-105146098 CAAATCTGTTGATACAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030008900 Original CRISPR CAAATCTGTTGATACAACTC AGG Intronic
No off target data available for this crispr