ID: 1030009392

View in Genome Browser
Species Human (GRCh38)
Location 7:105151316-105151338
Sequence CAGCTTAAACAGCTTGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 803
Summary {0: 1, 1: 0, 2: 8, 3: 103, 4: 691}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030009392_1030009395 3 Left 1030009392 7:105151316-105151338 CCCTGGGCAAGCTGTTTAAGCTG 0: 1
1: 0
2: 8
3: 103
4: 691
Right 1030009395 7:105151342-105151364 GAGCTTTCATTCTCATCTATGGG 0: 1
1: 0
2: 1
3: 15
4: 173
1030009392_1030009398 8 Left 1030009392 7:105151316-105151338 CCCTGGGCAAGCTGTTTAAGCTG 0: 1
1: 0
2: 8
3: 103
4: 691
Right 1030009398 7:105151347-105151369 TTCATTCTCATCTATGGGAGGGG 0: 1
1: 0
2: 2
3: 13
4: 217
1030009392_1030009396 6 Left 1030009392 7:105151316-105151338 CCCTGGGCAAGCTGTTTAAGCTG 0: 1
1: 0
2: 8
3: 103
4: 691
Right 1030009396 7:105151345-105151367 CTTTCATTCTCATCTATGGGAGG No data
1030009392_1030009394 2 Left 1030009392 7:105151316-105151338 CCCTGGGCAAGCTGTTTAAGCTG 0: 1
1: 0
2: 8
3: 103
4: 691
Right 1030009394 7:105151341-105151363 TGAGCTTTCATTCTCATCTATGG No data
1030009392_1030009397 7 Left 1030009392 7:105151316-105151338 CCCTGGGCAAGCTGTTTAAGCTG 0: 1
1: 0
2: 8
3: 103
4: 691
Right 1030009397 7:105151346-105151368 TTTCATTCTCATCTATGGGAGGG No data
1030009392_1030009399 9 Left 1030009392 7:105151316-105151338 CCCTGGGCAAGCTGTTTAAGCTG 0: 1
1: 0
2: 8
3: 103
4: 691
Right 1030009399 7:105151348-105151370 TCATTCTCATCTATGGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030009392 Original CRISPR CAGCTTAAACAGCTTGCCCA GGG (reversed) Intronic
902140577 1:14350291-14350313 GAATTTAAACAGCTTTCCCAAGG - Intergenic
902203361 1:14850498-14850520 GAGGTTAAGCAACTTGCCCACGG + Intronic
902207800 1:14882399-14882421 GAGATTAAACAACTTGCCCCAGG - Intronic
902556802 1:17251611-17251633 GAGGTTAAACAACTTGTCCAAGG + Intronic
902649648 1:17828352-17828374 GAGGTTAAATAACTTGCCCAAGG - Intergenic
902668479 1:17955530-17955552 GAGGTTAAGCAACTTGCCCAAGG - Intergenic
902741446 1:18441337-18441359 GAGGTTAAACAACTGGCCCAGGG - Intergenic
902835203 1:19042958-19042980 GAGGTTAAATAACTTGCCCAAGG + Intergenic
903065241 1:20696076-20696098 GAGCTCAAACAACCTGCCCAAGG + Intronic
903372713 1:22847256-22847278 CAGTTTGAGGAGCTTGCCCAAGG + Intronic
903451236 1:23455146-23455168 AAGGTTAAGCAGCTTGCCCGAGG - Intronic
903548144 1:24139993-24140015 TTGCTTAAACAACTTTCCCAAGG - Intronic
904268139 1:29329765-29329787 GAGCTTAAGCAACTTGCCCCAGG + Intergenic
904429099 1:30450498-30450520 GAGCTTAAACAACTTGCCCCAGG - Intergenic
904917359 1:33979844-33979866 GAGGTTAAAGAACTTGCCCAAGG - Intronic
904918987 1:33991717-33991739 TAGCTTAAATGACTTGCCCAAGG - Intronic
905107320 1:35572122-35572144 GAGGTTAAATGGCTTGCCCAAGG - Intergenic
905264222 1:36739975-36739997 CAGGTTAAGCAGCCTGCCCAGGG - Intergenic
905399126 1:37689161-37689183 AAGCTTAAGCAGATTGCCCATGG - Intronic
905466883 1:38161395-38161417 AAGCTTAAATAACTTTCCCAAGG - Intergenic
905514091 1:38548802-38548824 GAGGTTAAATAGCTTGCTCAAGG - Intergenic
906343077 1:44997774-44997796 AAGGTTAAGCAACTTGCCCATGG + Intergenic
906662990 1:47595591-47595613 CAGGTTAAGGAACTTGCCCAAGG - Intergenic
906704805 1:47887256-47887278 GAGGTTAAGTAGCTTGCCCAAGG + Intronic
906730250 1:48074711-48074733 GAGGTTAAACAACTTGTCCATGG - Intergenic
906892741 1:49735713-49735735 CAGCTAAAACACTTTGCCCAAGG - Intronic
906964760 1:50445354-50445376 CAGATTAAGTAACTTGCCCAAGG + Intronic
907125825 1:52050010-52050032 GAACTGAAACAGCTTGCCCAAGG + Intronic
908273489 1:62444348-62444370 CAGGTTAAATAACTTGCCCAAGG - Intronic
908311198 1:62886199-62886221 CAGATTAAATAACTTGCACAAGG - Intergenic
908335937 1:63123343-63123365 CTGGTTAAATAACTTGCCCAAGG - Intergenic
908411930 1:63875124-63875146 GAGGTTAAACAACTTGCCTAGGG - Intronic
908554589 1:65245202-65245224 GAGATTAAATAACTTGCCCAAGG + Intergenic
908740207 1:67319662-67319684 CAGGTTAAGCAACTTGCACATGG + Intronic
908804567 1:67916786-67916808 GAGGTTAAACAACTTGCCCAAGG - Intergenic
908834137 1:68211567-68211589 AAGTTTAAACAAGTTGCCCAAGG + Intronic
908845567 1:68321151-68321173 GAGCTTAAGCAACTTGCCCAAGG + Intergenic
909526935 1:76635495-76635517 GAGATTAAATAGCTTACCCATGG + Intergenic
909901764 1:81146331-81146353 AGGATTAAATAGCTTGCCCAAGG + Intergenic
910041254 1:82854155-82854177 GAGATTAAACAACTTGCTCAAGG + Intergenic
910072302 1:83231780-83231802 AAGATTAAACAGTTTGCCCAAGG - Intergenic
910474524 1:87592396-87592418 AAGGTTAAGCAACTTGCCCAAGG - Intergenic
910769615 1:90817706-90817728 GAGGTTAAGCAGCTTGCCCAGGG - Intergenic
910814261 1:91273299-91273321 GAGATTAAATAACTTGCCCAAGG + Intronic
911716376 1:101138240-101138262 AAAGTTAAACAACTTGCCCATGG - Intergenic
912134434 1:106642746-106642768 CAGGTTAAACAACTTGCCCAAGG - Intergenic
912211840 1:107564923-107564945 CAGTGTAAGCATCTTGCCCAAGG + Intergenic
912596204 1:110879324-110879346 CAGGTTAAGCAAGTTGCCCAAGG + Intronic
912954799 1:114147707-114147729 CAGGTTAAATAACTTGCTCAAGG - Intronic
913271519 1:117098404-117098426 GAGGTTAAATAACTTGCCCAAGG + Intronic
915371817 1:155357650-155357672 CAGCAAAAACAGCCAGCCCATGG - Exonic
915938092 1:160100647-160100669 CAGGTTAAGTACCTTGCCCAAGG + Intergenic
916384568 1:164252928-164252950 CAGCACAAGCAGCTTCCCCAGGG + Intergenic
916759352 1:167802567-167802589 CAGGTTAAATAACTTACCCAAGG + Intergenic
916780358 1:168020260-168020282 CAAGTTAAATAACTTGCCCAGGG + Intronic
916925205 1:169512222-169512244 AAGATTAAACAACTTGCCCAAGG - Intergenic
917023819 1:170619609-170619631 CAGCTTAAAGAGCCTGCAGATGG + Intergenic
917188669 1:172390328-172390350 GAGGTTAAACAGCTTGCCCAAGG + Intronic
917428672 1:174942549-174942571 AAGGTTAAATAGCTTGCCCAAGG - Intronic
917637023 1:176947146-176947168 GAGGTTAATCAGCTGGCCCAAGG - Intronic
918040265 1:180909862-180909884 GAGGTTAAGTAGCTTGCCCAAGG - Intergenic
918321554 1:183369913-183369935 CAGTTTAAATAAATTGCCCAAGG + Intronic
918785708 1:188760229-188760251 TAACTTGAACAGCTAGCCCACGG + Intergenic
919844669 1:201634351-201634373 CAGGTTAAGTGGCTTGCCCAAGG + Intronic
919970838 1:202576846-202576868 CAGATTAAATAACTTGCCCAAGG + Intronic
920066202 1:203271804-203271826 GAAGTTAAGCAGCTTGCCCAAGG + Intronic
920650897 1:207836674-207836696 CAGCTTTATCATCTTGGCCAAGG - Intergenic
920671716 1:208008748-208008770 CAGCTTAGGCAGCTTACCCCAGG - Intergenic
921117677 1:212109519-212109541 CAAGTTAAATAACTTGCCCAAGG + Intergenic
921123931 1:212160291-212160313 GAGGATAAATAGCTTGCCCAAGG + Intergenic
921274494 1:213505450-213505472 GAGATTAAGCAGCTTGCCCAAGG - Intergenic
921781951 1:219175131-219175153 CAGGTTCAGCAGCTTGGCCAAGG + Intronic
921890836 1:220352370-220352392 GAGACTAAACAGCTTGCCTAAGG + Intergenic
922055887 1:222042080-222042102 AAGCTTAAGTAACTTGCCCAAGG - Intergenic
922609450 1:226913726-226913748 GAGGTTAAGCAGCTTGCCCGAGG - Intronic
923680958 1:236118278-236118300 AAGCTTCAAAAGCTTACCCACGG - Intergenic
924697210 1:246413004-246413026 GAGGTTAAACAGTTTGCTCAAGG + Intronic
1062809870 10:455187-455209 TAGGTTAAGCAACTTGCCCAAGG - Intronic
1063934953 10:11067809-11067831 AAGGTTAAATAACTTGCCCAGGG - Intronic
1063954271 10:11251638-11251660 AAGGTTAAATAACTTGCCCAAGG - Intronic
1065708061 10:28489368-28489390 CAGCTGAAAAACCTTACCCACGG + Intergenic
1065740086 10:28789721-28789743 CAGCTAAAATATCTTGCCCTTGG - Intergenic
1066399003 10:35056478-35056500 GAGGTTAAAGAGCTTGCCAAAGG + Intronic
1066523538 10:36249952-36249974 CAGCTTAAGTAAATTGCCCATGG + Intergenic
1066532372 10:36354786-36354808 AAGGTTAACCAACTTGCCCAAGG + Intergenic
1067320868 10:45219618-45219640 GAGGTTAAGCAACTTGCCCAAGG + Intergenic
1067801084 10:49360262-49360284 GAGGTTAAATGGCTTGCCCACGG + Intergenic
1067991531 10:51218957-51218979 GAGGTTAAATAACTTGCCCAAGG - Intronic
1068501313 10:57842254-57842276 AAGGTTAAGCAACTTGCCCAAGG + Intergenic
1068758562 10:60682208-60682230 CAGCTTAAATAACTTGTCCAAGG + Intronic
1068918717 10:62461227-62461249 CAGTTTAATCAGCTTTCGCAGGG + Intronic
1068983888 10:63089354-63089376 AAGATTAAACTCCTTGCCCAAGG + Intergenic
1069616957 10:69812338-69812360 GAGCTTGAATAACTTGCCCAAGG - Intronic
1069624343 10:69858400-69858422 GAGGTTAAGCAGCTTGCCCAAGG + Intronic
1069773268 10:70912610-70912632 CAGCCTAAATAGCCTGCCCTGGG + Intergenic
1069814521 10:71185243-71185265 GAGGTTAAGCAACTTGCCCAAGG - Intergenic
1069899457 10:71698914-71698936 GAGGTTAAGCAACTTGCCCAAGG - Intronic
1069925302 10:71846202-71846224 GAGTTTAAGCAACTTGCCCAAGG + Intronic
1070207136 10:74275096-74275118 CAGCTCCAACAGATTACCCAGGG - Intronic
1070425195 10:76280335-76280357 AAGCTGAACCAGCTTGCTCAAGG - Intronic
1070703618 10:78621331-78621353 GAGATTAAGCAGCTTGCCTAAGG + Intergenic
1071295376 10:84215534-84215556 GACTTTAAACAGCTTTCCCAAGG - Exonic
1071621234 10:87121457-87121479 TAGGTTAAGCAGCTTGCCTAAGG - Intronic
1072538130 10:96378647-96378669 GAGGTTAAATAGCTTGCCCAAGG + Intronic
1072711216 10:97716806-97716828 GAGGTTAAATACCTTGCCCAAGG + Intronic
1072720684 10:97779064-97779086 GAGGTTAAATAACTTGCCCAAGG - Intergenic
1073246813 10:102096636-102096658 GAGGTCAAGCAGCTTGCCCAAGG - Intergenic
1073811442 10:107156327-107156349 AAGCTTAAACAACTTGCTCAAGG - Intronic
1074425007 10:113343026-113343048 CAGGTTAAAGAACTTGCCCAAGG - Intergenic
1074485540 10:113874312-113874334 CAGGTTAAGTAACTTGCCCAAGG + Intronic
1074876204 10:117615334-117615356 GAAGTTAAACAACTTGCCCAGGG - Intergenic
1075069246 10:119309639-119309661 GAGGGTAAGCAGCTTGCCCAGGG + Intronic
1075327529 10:121546343-121546365 GAGCTGAAAAAACTTGCCCATGG + Intronic
1076413673 10:130269858-130269880 CTGCTGGAACAGCTTGTCCAGGG + Intergenic
1077497493 11:2893208-2893230 GAGGTTAAGCAACTTGCCCAAGG - Intronic
1077521225 11:3036157-3036179 AAGCTTCAGCAGCCTGCCCATGG + Intronic
1077988230 11:7376877-7376899 GAGGTTGAACAGCTTGCCCATGG - Intronic
1078362605 11:10680702-10680724 AAGATGAAACAGCTTGCCCAAGG - Intronic
1078409099 11:11096867-11096889 GTGGTTAAACAACTTGCCCAAGG - Intergenic
1078613830 11:12846284-12846306 CAGCTTAAACACCTGCCCAAAGG + Intronic
1078630150 11:12995270-12995292 TAGCTCAAACAACTTGACCAGGG + Intergenic
1078952923 11:16155518-16155540 GAGGTTAAACAACTTGCCCAAGG - Intronic
1079355241 11:19725211-19725233 AAGCATAAGCAACTTGCCCAAGG + Intronic
1079363270 11:19787551-19787573 CAAATTAAACAACTTGCCCAGGG - Intronic
1079382513 11:19950403-19950425 AAGGTTAAATAACTTGCCCAAGG + Intronic
1079508790 11:21185616-21185638 AAGGTTAACTAGCTTGCCCATGG - Intronic
1079568549 11:21914195-21914217 CAGCTTAAACACCATTCCCCCGG + Intergenic
1080029709 11:27647649-27647671 TAGCCTAAATAACTTGCCCAAGG - Intergenic
1080175947 11:29363138-29363160 AAGTTTAAGCAACTTGCCCAAGG + Intergenic
1080209829 11:29772694-29772716 CAGATTAATCAACCTGCCCAAGG - Intergenic
1080574138 11:33583155-33583177 GAGCTTAAGCCACTTGCCCAAGG + Intronic
1080605791 11:33863983-33864005 AAGGTTAAATAACTTGCCCAAGG + Intronic
1080708856 11:34726439-34726461 GAATATAAACAGCTTGCCCAAGG - Intergenic
1080787921 11:35492950-35492972 AAGCTTAAACAATTTGCCCAAGG - Intronic
1080899189 11:36471682-36471704 CAACTTGAACAACTTGCCTAAGG + Intergenic
1081139655 11:39483148-39483170 AAGGTTAAATATCTTGCCCAAGG + Intergenic
1081281717 11:41217407-41217429 CCCCTTAAGCAACTTGCCCAAGG + Intronic
1081592805 11:44436610-44436632 GAGTTTAAGCAACTTGCCCAAGG - Intergenic
1083096571 11:60256943-60256965 CTTCTTAAACAGTTAGCCCAGGG - Intergenic
1083941465 11:65898534-65898556 GAGGTTAAATAACTTGCCCATGG - Intronic
1084077725 11:66794449-66794471 AAGGTTAAACAGCTTGTCCAAGG - Intronic
1084289743 11:68154376-68154398 GAGATTAAGCAGCTTGCTCAGGG + Intergenic
1084456660 11:69271636-69271658 CAGCCTCCACAGCTTGGCCAGGG + Intergenic
1085012928 11:73153819-73153841 AAGGTTAAGCAACTTGCCCAAGG - Intergenic
1085187303 11:74586825-74586847 GAGGTTAAATAACTTGCCCAAGG - Intronic
1085197838 11:74683140-74683162 GAGGTTGAACACCTTGCCCAAGG - Intergenic
1085430241 11:76441832-76441854 GAGGTTAAATAGCTGGCCCAAGG - Intergenic
1085740395 11:79073682-79073704 GAGGTTAAATAACTTGCCCAAGG - Intronic
1085781757 11:79415568-79415590 GAGCTTAAGTAGCTTGCCCAAGG + Intronic
1085836305 11:79960709-79960731 GAGAATAAACACCTTGCCCAGGG - Intergenic
1086494076 11:87384664-87384686 CAGCTTACACTGCTGGCCTAGGG - Intergenic
1086600394 11:88626137-88626159 GAGATTTAACAACTTGCCCAAGG + Intronic
1086643051 11:89183984-89184006 GAGCTTAAGTAACTTGCCCAAGG + Intronic
1086907832 11:92437410-92437432 GAAGTTAAATAGCTTGCCCAAGG - Intronic
1089064043 11:115648880-115648902 CAGCTTAAATAACTTGCTCAGGG + Intergenic
1089206866 11:116771572-116771594 GAGATGAAACACCTTGCCCAAGG + Intronic
1089641793 11:119852714-119852736 CTGATTAAACAGCTAGCCCAAGG - Intergenic
1089691565 11:120189966-120189988 CAGCATAAATGGCTGGCCCAGGG - Intergenic
1089974239 11:122718474-122718496 AAGCTTCAATAACTTGCCCAAGG - Intronic
1090131027 11:124142184-124142206 CAGCTCACACAGCTTGCCTGCGG + Intronic
1090203469 11:124872122-124872144 CAGGTTAAACAGCTTGTTCAGGG + Intronic
1090242471 11:125193857-125193879 AAGCTTACATGGCTTGCCCAAGG - Intronic
1090298962 11:125617338-125617360 GAGGTTAAATAACTTGCCCAAGG + Intronic
1090422032 11:126582007-126582029 GGGCTTAAGCAGCCTGCCCAGGG + Intronic
1090615635 11:128512163-128512185 GAGATTAAACGACTTGCCCAAGG - Intronic
1090694329 11:129222349-129222371 CAGGTTAAGCAACTTTCCCAAGG + Intronic
1090704101 11:129321057-129321079 GAGTTTAACCAACTTGCCCAAGG - Intergenic
1090962701 11:131571428-131571450 AAGTTTAAGCATCTTGCCCAAGG + Intronic
1091284306 11:134399525-134399547 CAGCTTCGACGGCTTGCCCCTGG - Intronic
1091612259 12:2021242-2021264 GAGCTTAAATAACTTGCTCAGGG + Intronic
1091747403 12:3001123-3001145 GAGGTTAAATAACTTGCCCAAGG - Intronic
1092042187 12:5394794-5394816 GAGGCTATACAGCTTGCCCAAGG - Intergenic
1092168230 12:6356135-6356157 GAGCTCAAACAGCTGGCCCAAGG + Intronic
1092190681 12:6517844-6517866 CAGCTTCTACAGCTTCCCCAGGG + Exonic
1092481123 12:8860009-8860031 AAGATTAAATAGCTTGCTCACGG - Intronic
1092844327 12:12569981-12570003 GAGGTTAAACGACTTGCCCAAGG + Intergenic
1092990771 12:13896844-13896866 AAGTTTAAACAGCTTACTCAAGG - Intronic
1093108187 12:15115313-15115335 AAGATTAAATAACTTGCCCAAGG + Intronic
1093112183 12:15165524-15165546 CCACCTAAACAACTTGCCCAAGG - Intronic
1093514483 12:19970034-19970056 CAGCTTAAAAAGTTTACTCATGG + Intergenic
1094489663 12:30951684-30951706 GAGGTTAAATAACTTGCCCAAGG + Intronic
1095631767 12:44385084-44385106 GAGGTTAAACAGGTTACCCAAGG + Intronic
1095970582 12:47899466-47899488 CAGATTAAATAACTTGCCCAAGG + Intronic
1096037492 12:48485485-48485507 CAGCTTCATCTCCTTGCCCAGGG - Intronic
1096070105 12:48770498-48770520 GAGATTAAATAACTTGCCCAAGG - Intronic
1096073098 12:48786856-48786878 GAGGTTAAATAACTTGCCCAAGG - Intronic
1096436546 12:51595571-51595593 TAGATTAAATAACTTGCCCAAGG - Intronic
1096684391 12:53278138-53278160 TAGGTTAAGCAACTTGCCCAAGG - Intronic
1096813191 12:54184564-54184586 AAGATTAAGCAACTTGCCCAAGG + Intronic
1097289043 12:57898408-57898430 CAGAATAAACAACTTGGCCAAGG - Intergenic
1097675636 12:62600081-62600103 CAGGTTAATTAACTTGCCCAAGG - Exonic
1098302109 12:69064805-69064827 AAGCTGAAACAACTTGCCCAAGG - Intergenic
1098600102 12:72320822-72320844 ATGCTTAAACAGCTTGCCTGAGG - Intronic
1098602635 12:72350478-72350500 TAGGTTAAACAGCTTGTCCAAGG + Intronic
1098900173 12:76104179-76104201 GAGGTTAAATTGCTTGCCCAAGG + Intergenic
1098951780 12:76646785-76646807 GAGGTTGAATAGCTTGCCCAAGG + Intergenic
1100012044 12:89965256-89965278 GAGATTAAAAAACTTGCCCAGGG - Intergenic
1100891207 12:99128027-99128049 GAAGTTAAACAACTTGCCCAAGG - Intronic
1100953549 12:99880313-99880335 CAGGTTAAATAACTTGCCCAAGG + Intronic
1101001269 12:100360633-100360655 GAGGTTAAGTAGCTTGCCCAAGG + Intronic
1101037347 12:100717927-100717949 AAGTTTAAATAACTTGCCCAAGG - Intronic
1101280144 12:103245274-103245296 GAGCTTAATAATCTTGCCCACGG - Intronic
1101446374 12:104739489-104739511 CAGATTAAGTAACTTGCCCAAGG + Intronic
1101648491 12:106653487-106653509 GAGCTTAAGTAACTTGCCCAAGG + Intronic
1101854439 12:108430313-108430335 AAGGTTAAAGAACTTGCCCAAGG - Intergenic
1102020771 12:109680782-109680804 CAGATTAAGCAACTTGTCCAAGG + Intergenic
1102708164 12:114900788-114900810 AAGGCTAAACAACTTGCCCAAGG - Intergenic
1103558629 12:121780597-121780619 GAGGTTAAGCAGCTTGCCCAGGG - Exonic
1103915815 12:124375111-124375133 CAGGTTAATCAGCTTGCCCAAGG + Intronic
1104324696 12:127785238-127785260 AAGGTTAAACATCCTGCCCAGGG - Intergenic
1105041975 12:132967778-132967800 CAGCTTCAACAGCTGGCACTGGG - Intergenic
1105531374 13:21223759-21223781 CTGGTTAAACATCTTGCCCAAGG - Intergenic
1106141851 13:27018461-27018483 GAGGTTAAATAACTTGCCCAAGG - Intergenic
1106496098 13:30277379-30277401 GAGGTTAAATAGCTTGCTCAAGG + Intronic
1106814639 13:33393773-33393795 CAGATTAAATAACTTGACCAAGG + Intergenic
1107396125 13:40019563-40019585 CAGCTTAAATAGCATGCCCAAGG - Intergenic
1107552734 13:41492491-41492513 GAGGTTAAAGAGCTTGCTCAAGG - Intergenic
1107675114 13:42787922-42787944 CAAGTTAAATAGCTTGACCAGGG + Intronic
1107846627 13:44521016-44521038 CAGTTTAAATGACTTGCCCAAGG + Intronic
1108322090 13:49299613-49299635 CAGGTTAAACGACTTACCCAAGG + Intergenic
1108375135 13:49807245-49807267 GAGGTTAAACAATTTGCCCAGGG + Intergenic
1108455578 13:50610492-50610514 GAGGTTAGATAGCTTGCCCAGGG + Intronic
1109938246 13:69323269-69323291 CAGGTTAAGTAGCTTGCTCAAGG + Intergenic
1110260580 13:73480385-73480407 AAAATTAAACAACTTGCCCAAGG + Intergenic
1111162377 13:84412475-84412497 CAGGTTAAACCCCATGCCCAAGG - Intergenic
1111657189 13:91168398-91168420 CAGCTTCCATAACTTGCCCAAGG + Intergenic
1111887947 13:94046793-94046815 AATCTTAAGCAACTTGCCCAAGG - Intronic
1112768261 13:102769806-102769828 CAGATTAAGTAACTTGCCCAAGG + Intronic
1113374057 13:109747538-109747560 AAGGTTAAACACCTTGCTCAGGG - Intergenic
1115080082 14:29440062-29440084 AAGTTTAAACAGCTTGCCCAGGG + Intergenic
1115175888 14:30560982-30561004 GAGGTTAAACAGCTTGCCCAGGG - Intronic
1115741962 14:36398148-36398170 CAGCTTAAGGAACTTGTCCAAGG - Intergenic
1116561229 14:46381863-46381885 CAATTTAACTAGCTTGCCCAAGG - Intergenic
1116630587 14:47326392-47326414 AAGGTTAAATAACTTGCCCAGGG + Intronic
1117762967 14:59051701-59051723 GAGGTTAAATACCTTGCCCAAGG - Intergenic
1117991473 14:61438125-61438147 GATGTTAAACAACTTGCCCAGGG + Intronic
1118475003 14:66108596-66108618 GAGATTAAATAACTTGCCCAAGG - Intergenic
1118745805 14:68772263-68772285 CTGGTTAAGAAGCTTGCCCAAGG - Intergenic
1119015776 14:71052795-71052817 CAGATTAAGTAGCTAGCCCAAGG - Intronic
1119058456 14:71448416-71448438 GAGGTTAAGCAACTTGCCCAAGG + Intronic
1119184708 14:72631887-72631909 CAGCTTAAAGATCTTTCTCAGGG - Intronic
1119195583 14:72714780-72714802 GAGGTTAAGTAGCTTGCCCAAGG + Intronic
1119583026 14:75804735-75804757 GAGGTTAAACAACTTGTCCAAGG - Intronic
1119976296 14:79027953-79027975 GAGATTAAATAACTTGCCCAAGG - Intronic
1119996121 14:79255479-79255501 AAGGTAAAACATCTTGCCCAAGG - Intronic
1120510770 14:85411569-85411591 CAGGTTAAGCAACTTGTCCAAGG + Intergenic
1120531796 14:85640936-85640958 CAGTTTAAGCAACTTGCCCAAGG - Exonic
1121331423 14:93052147-93052169 AAGGTTAAATAACTTGCCCATGG - Intronic
1121982843 14:98469610-98469632 AGGCTTAAACACCTTGGCCAAGG + Intergenic
1122138527 14:99648364-99648386 GAGGTTAAGGAGCTTGCCCACGG + Intronic
1126676083 15:51160307-51160329 CAGCTGAGACATCTTACCCAGGG - Intergenic
1126877506 15:53060130-53060152 AACATTAAACAACTTGCCCAGGG - Intergenic
1127557164 15:60099074-60099096 CAGCTGATGTAGCTTGCCCAAGG + Intergenic
1127654320 15:61041952-61041974 GAGGTTAAATAACTTGCCCAAGG + Intronic
1128213747 15:65920082-65920104 CAGGTTAAGTAACTTGCCCAAGG + Intronic
1128462815 15:67884193-67884215 AAGGTTAAACAACTTGCCCAAGG - Intergenic
1128704037 15:69825642-69825664 GAGCTTAAGCCACTTGCCCAGGG + Intergenic
1128723806 15:69973069-69973091 AAGGTTAAAGAGCTTGTCCAAGG - Intergenic
1128818415 15:70630699-70630721 GAGGTTAAGCAGCTTACCCAAGG + Intergenic
1129084911 15:73078777-73078799 GAGGTTAACCAGCTTGCCTAAGG - Intronic
1129188427 15:73924246-73924268 GAGCTTAAAAAGCTTCCCCGGGG + Intergenic
1129525495 15:76211185-76211207 GAGCTTAAAACACTTGCCCAAGG - Intronic
1129567500 15:76638946-76638968 CAGGTTAAGAAGCTTGCTCAAGG + Intronic
1129828942 15:78654519-78654541 GAGGTTAAAGAGTTTGCCCAGGG - Intronic
1130024202 15:80257214-80257236 CAGCTTTAAGAGTTAGCCCATGG - Intergenic
1130440074 15:83944610-83944632 CAGATTAAGTAACTTGCCCAAGG + Intronic
1131042511 15:89284501-89284523 CAGGTTAAATAACTTGCCCAAGG + Intronic
1131077387 15:89503864-89503886 GAAGTTAAGCAGCTTGCCCAAGG - Intergenic
1131613094 15:93985747-93985769 AAGTTTAAGTAGCTTGCCCAGGG + Intergenic
1132934022 16:2472030-2472052 CAGCTCAAAAGCCTTGCCCAGGG - Exonic
1133515256 16:6502421-6502443 GAGATTAAATAACTTGCCCAAGG - Intronic
1134023534 16:10938223-10938245 GAGGTTAAGCAGCATGCCCAAGG + Intronic
1134199767 16:12188314-12188336 GAGGTTAAGCAACTTGCCCAAGG + Intronic
1134421517 16:14095380-14095402 AAGCTTAAGTAACTTGCCCAAGG - Intronic
1134790516 16:16985400-16985422 CAGGTTAAGCAACTTTCCCAAGG + Intergenic
1134820885 16:17246562-17246584 GAGGTTAAGTAGCTTGCCCAGGG - Intronic
1135032053 16:19046252-19046274 GAGCTTAAATAACTTGCCCAAGG - Intronic
1135199508 16:20424710-20424732 GAGATTAAGCAGCTTCCCCAAGG - Intronic
1135232959 16:20726897-20726919 GAGTTTAAAGAACTTGCCCAAGG - Intronic
1135510019 16:23074527-23074549 AAGATTAATCTGCTTGCCCAAGG + Intronic
1135521899 16:23183902-23183924 CAGGTTAAGTAGCTTGCCCAAGG - Intronic
1135538790 16:23314466-23314488 GAGCTTAAGTAACTTGCCCAAGG + Intronic
1136047553 16:27626598-27626620 AAGGTTAAAGAACTTGCCCAAGG - Intronic
1136237362 16:28922965-28922987 GAGGTTAAATAACTTGCCCAAGG - Intronic
1136555927 16:31007913-31007935 GAGGTTAAGCAACTTGCCCAAGG + Intronic
1136589501 16:31209122-31209144 CAGGTTAAGCGACTTGCCCAAGG + Intergenic
1137397654 16:48127592-48127614 AGGGTTAAATAGCTTGCCCAAGG - Intronic
1138223203 16:55270581-55270603 GAGGTTAAGGAGCTTGCCCACGG - Intergenic
1138858701 16:60728258-60728280 GAGGTTAAACAGCTTACCCAAGG - Intergenic
1139244615 16:65429356-65429378 TAGCTTAAGAAACTTGCCCATGG - Intergenic
1139672169 16:68499343-68499365 GAGGTTAAGCAACTTGCCCAGGG - Intergenic
1140325119 16:73993972-73993994 CAGTTTAAATAGCTGGTCCAAGG - Intergenic
1140897355 16:79336347-79336369 AAGTTTAAGCAACTTGCCCAAGG + Intergenic
1141016643 16:80457094-80457116 GAGCTTACACAACGTGCCCAAGG - Intergenic
1141283152 16:82647117-82647139 GAGGTTAAGCAACTTGCCCATGG - Intronic
1141481292 16:84308497-84308519 CAGCTTAAACAGCCTTCTGAGGG - Intronic
1141564962 16:84895195-84895217 GAGGTTAAACGACTTGCCCAAGG + Intronic
1141767919 16:86070840-86070862 GAGGTTCAGCAGCTTGCCCAAGG - Intergenic
1142977451 17:3654264-3654286 GAGCTTGAATAACTTGCCCAAGG + Intronic
1143264514 17:5626045-5626067 CAGGTGAAACAGCTTGGCAAAGG - Intergenic
1143505128 17:7359807-7359829 GAGGTTAAATAACTTGCCCACGG - Intergenic
1144590579 17:16520483-16520505 CAGGTTAAACTACATGCCCAAGG + Intergenic
1145282491 17:21478099-21478121 CAGCCTGGAGAGCTTGCCCAGGG + Intergenic
1145394982 17:22487656-22487678 CAGCCTGGAGAGCTTGCCCAGGG - Intergenic
1145900528 17:28488021-28488043 GAGGGTAAACAGCTTGCTCAGGG - Intronic
1145996739 17:29109261-29109283 GAGGTTAAGTAGCTTGCCCAAGG - Intronic
1146157914 17:30539476-30539498 GAGATTAAATAGCTTGCTCAAGG - Intergenic
1146457885 17:33021368-33021390 CATCTAATACAGCTTTCCCATGG + Intronic
1146489948 17:33273733-33273755 AGGATTAAACAACTTGCCCAAGG + Intronic
1146633522 17:34487601-34487623 GAGGTTAAAGACCTTGCCCAGGG + Intergenic
1147215123 17:38894450-38894472 GAGGTTAAGCAACTTGCCCAAGG - Intronic
1147267820 17:39245394-39245416 GAGGTTAAATAACTTGCCCAAGG + Intergenic
1147906444 17:43826084-43826106 AAGATTAAGCAGCTTGCCTAAGG + Intronic
1148759479 17:49992089-49992111 GAGGTTAAACAACTTGCCCAAGG - Intronic
1148796553 17:50199994-50200016 CAGCTTAACCACCTTTCCCCCGG + Intronic
1149385614 17:56140599-56140621 GAGCTTAAGTAGGTTGCCCAAGG - Intronic
1149455961 17:56788858-56788880 GAGGTTAATCAGCTTGCCCAAGG + Intergenic
1149507618 17:57207948-57207970 GAGTTTAAATAACTTGCCCAAGG - Intergenic
1149559858 17:57600927-57600949 GAGGTTAAGCAGTTTGCCCAAGG + Intronic
1150646682 17:66983004-66983026 GAAGTTAAGCAGCTTGCCCAAGG + Intronic
1151172043 17:72254921-72254943 AAGCTTAAATGGTTTGCCCAAGG - Intergenic
1151204348 17:72494990-72495012 TAGGATAAAGAGCTTGCCCAAGG + Intergenic
1151221685 17:72617548-72617570 GAAATTAAACATCTTGCCCAAGG - Intergenic
1151222354 17:72622512-72622534 GAGGTTGAACAGCTTGCCCTGGG - Intergenic
1153824869 18:8866088-8866110 TAGCTCAAGCAACTTGCCCAGGG - Intergenic
1153996834 18:10450135-10450157 CAGATTAAGTAACTTGCCCAGGG + Intergenic
1155456518 18:26021246-26021268 GAGGTTAAGCAACTTGCCCAAGG - Intronic
1156497975 18:37538302-37538324 GAGGTTGGACAGCTTGCCCAGGG - Intronic
1156503080 18:37572004-37572026 CAAATTAAACAACCTGCCCAAGG - Intergenic
1156692170 18:39721297-39721319 CAGGTGAAATAGCTTGACCAAGG + Intergenic
1157104553 18:44761476-44761498 AAGCTTACAAAGCTTGCCCAGGG + Intronic
1157422423 18:47558096-47558118 CAGGTTAAGTGGCTTGCCCAAGG + Intergenic
1158172142 18:54612202-54612224 CAGATTATTCAACTTGCCCAGGG - Intergenic
1158507535 18:58059993-58060015 GAGGTTAAATAACTTGCCCAGGG + Intronic
1158902193 18:61974379-61974401 CAGCTAAAGCAGCTTGACAAGGG + Intergenic
1158963535 18:62605309-62605331 CAGGTTAAACCCCCTGCCCAAGG + Intergenic
1159480804 18:68988990-68989012 CAGCAAAAACAGCCTGACCAAGG - Intronic
1159518993 18:69495138-69495160 CAGCTTCAACAGCTGCCCCCAGG + Intronic
1160423685 18:78766545-78766567 CAGTTTAAACAGCATGGCCATGG + Intergenic
1160908778 19:1465304-1465326 CAGATTACGCAGCATGCCCACGG - Exonic
1161082330 19:2317495-2317517 GAGGTTAAGCAGCTTGCACAGGG - Intronic
1161602854 19:5195423-5195445 GAGGTTAAATAACTTGCCCAAGG - Intronic
1162600285 19:11663718-11663740 CAGCTGGAACATCTTACCCAAGG - Intergenic
1162864301 19:13532629-13532651 GAGGTTGAGCAGCTTGCCCAAGG - Intronic
1163328428 19:16620187-16620209 CAGCATAAACAGCTGGACCCAGG + Intronic
1164590528 19:29504496-29504518 AAGGTCAAGCAGCTTGCCCAGGG - Intergenic
1165416908 19:35700132-35700154 CAGCTCACACAGCTAGTCCATGG - Intergenic
1167135128 19:47611078-47611100 GAGGTTAAGAAGCTTGCCCAGGG + Intronic
1167783160 19:51613745-51613767 GAGGTTAAGTAGCTTGCCCAGGG + Intronic
1168314515 19:55478673-55478695 CAGCTGCAACAGCCTCCCCACGG - Intronic
925389996 2:3488101-3488123 CAGCTTGAAGAACCTGCCCACGG + Intergenic
925920713 2:8636069-8636091 GAGCAGAAACGGCTTGCCCATGG - Intergenic
926048136 2:9725113-9725135 GAAGTTAAACAGCTTGGCCAAGG - Intergenic
926063580 2:9820150-9820172 CAGGTTAAAGGACTTGCCCAAGG + Intergenic
926863062 2:17329017-17329039 CCTGTTAAGCAGCTTGCCCAAGG + Intergenic
926894875 2:17674823-17674845 CAGCTTAACCAGCTTCCCTTTGG + Intronic
927049519 2:19313326-19313348 CATATTAAATAACTTGCCCAAGG - Intergenic
927849041 2:26487460-26487482 AGGCTTAAACAGCTGGTCCAGGG - Intronic
928256505 2:29727480-29727502 AAGGTTAAGCAGCTTACCCAAGG - Intronic
928394612 2:30933780-30933802 GAGCTTAAGCAGGTTTCCCAAGG - Intronic
929314107 2:40456569-40456591 GAGGTTAAAAAGCTTCCCCAAGG - Intronic
929634674 2:43505876-43505898 GAGGTTAAACCACTTGCCCACGG - Intronic
929797791 2:45073278-45073300 CAGGTTGATCAGTTTGCCCAAGG - Intergenic
929816681 2:45238106-45238128 AGGCTTAAACAGCCTGGCCAAGG + Intergenic
930030930 2:47057556-47057578 CAGCTTAATCAGCTGTGCCAGGG + Intronic
930358967 2:50354384-50354406 GAGCTTAAATAACCTGCCCAAGG - Intronic
930708567 2:54528605-54528627 GAGATTAAGAAGCTTGCCCAAGG + Intronic
931665289 2:64606185-64606207 GAGGTTGAACAACTTGCCCAAGG + Intergenic
931668764 2:64628219-64628241 GAGGTTAAGCAGCTTGCCAAAGG - Intergenic
931874609 2:66498352-66498374 GAGGTTAAATAACTTGCCCAGGG + Intronic
932008183 2:67948573-67948595 AAGGTTAAATAACTTGCCCAAGG + Intergenic
932034907 2:68234356-68234378 AAGCTTAAGCAGCTTGCACAAGG + Intronic
933777163 2:85778162-85778184 CAGGTTAAGCATCTTGCTCAAGG + Intronic
933849400 2:86353380-86353402 AAGGTTAAGTAGCTTGCCCAAGG - Intergenic
933998114 2:87684869-87684891 GAGGTTAAACAACTTTCCCACGG + Intergenic
934233980 2:90213667-90213689 CAGCTTTCCCAGCTTCCCCAGGG + Intergenic
934792200 2:97070781-97070803 GAGGTTAAACAACTTTCCCACGG - Intergenic
934814417 2:97312928-97312950 GAGGTTAAACAACTTTCCCACGG + Intergenic
934823276 2:97395555-97395577 GAGGTTAAACAACTTTCCCACGG - Intergenic
935035265 2:99365314-99365336 GAGTGTAAACAGCTTACCCAAGG + Intronic
935985384 2:108667357-108667379 GAGGTTAAGCAACTTGCCCAAGG + Intronic
936083146 2:109448893-109448915 GAGCTAAAACAGCTTTGCCAAGG - Intronic
936295738 2:111266004-111266026 GAGGTTAAACAACTTTCCCACGG - Intergenic
936918298 2:117662253-117662275 GAGATTAAGCAACTTGCCCAAGG + Intergenic
938956788 2:136306386-136306408 CAGTGTAAGCATCTTGCCCAAGG + Intergenic
939291332 2:140199171-140199193 CAGACCAAACAGCTTGCCCGTGG - Intergenic
939899620 2:147836387-147836409 AAGGTTAAATGGCTTGCCCAGGG - Intergenic
940008156 2:149028692-149028714 GAGGTTAAGTAGCTTGCCCAAGG + Intergenic
940025611 2:149204246-149204268 GAGTTTCAAGAGCTTGCCCAAGG + Intronic
940213678 2:151282533-151282555 TAGCTTAAACCACTTCCCCAAGG - Intronic
940534000 2:154915116-154915138 GAGGTTACAGAGCTTGCCCAAGG - Intergenic
940887410 2:159001734-159001756 CAGATTAGGCAACTTGCCCAAGG + Intronic
941133532 2:161684603-161684625 CAGGTTAAGTACCTTGCCCAAGG - Intronic
941567311 2:167125481-167125503 GAGCTTAAGTAACTTGCCCAAGG - Intronic
942025538 2:171907093-171907115 GAGATTAAGCAGCTTTCCCAAGG + Intronic
942123508 2:172801628-172801650 GATATTCAACAGCTTGCCCAAGG + Intronic
942127035 2:172837339-172837361 GAGATTAAGGAGCTTGCCCAGGG + Intronic
942165836 2:173240170-173240192 CAGGTTAAATAACTTGCCCAAGG + Intronic
942617765 2:177812267-177812289 GAGGTTAAGTAGCTTGCCCAAGG + Intronic
944230454 2:197386905-197386927 AAGGTTAAAAAACTTGCCCAAGG + Intergenic
945079739 2:206076837-206076859 AAGCCTAAATAACTTGCCCAAGG - Intronic
945085140 2:206123554-206123576 TATATTAAATAGCTTGCCCAAGG - Exonic
945214027 2:207414230-207414252 GAGATTAAAAAACTTGCCCAAGG + Intergenic
945234238 2:207619929-207619951 AAGGTTAAGCAACTTGCCCAAGG + Intronic
945286253 2:208085562-208085584 CAATTTAAACAACTTGCTCAAGG + Intergenic
945324170 2:208463501-208463523 GAGTTTAAATAACTTGCCCAAGG - Intronic
945703643 2:213202152-213202174 CAGTTTAACTAACTTGCCCAAGG + Intergenic
946403005 2:219478427-219478449 GAGGTTAAATAACTTGCCCAAGG + Intronic
946440220 2:219688710-219688732 GAGCTTAAGCAACTTGCCCAAGG - Intergenic
946860298 2:223994911-223994933 AAGCTTAAATAACTTGCCCAAGG + Intronic
946960494 2:224979870-224979892 GATGTTAAACAGCATGCCCAAGG + Intronic
947082437 2:226413482-226413504 GAGGTTAAACAACTTGCCCAAGG + Intergenic
947308041 2:228768800-228768822 TAACTTAAGCCGCTTGCCCAAGG + Intergenic
1168840600 20:907663-907685 GAGGTTAAACAACTTGTCCAAGG + Intronic
1168859876 20:1038352-1038374 CAGCCTCTTCAGCTTGCCCATGG + Intergenic
1169158229 20:3352596-3352618 CAGGTTAAGTTGCTTGCCCAGGG - Intronic
1169393122 20:5206191-5206213 AAGGTTAAATAACTTGCCCAAGG - Intergenic
1169470438 20:5880616-5880638 CAGGTTAAATAACATGCCCAAGG - Intergenic
1169519880 20:6359641-6359663 GAGCTTCAGCAACTTGCCCACGG + Intergenic
1170715644 20:18828687-18828709 CAGATTAAACACCTAGCACAGGG + Intronic
1170758476 20:19226747-19226769 CAGTTTAAATAACTTGCTCAAGG + Intronic
1170764358 20:19277203-19277225 GAGGTTAAATATCTTGCCCAAGG - Intronic
1171057020 20:21916880-21916902 AAGCTTAAAAAGCTTCCCCTTGG - Intergenic
1171947759 20:31393393-31393415 TTGGTTAAACAACTTGCCCATGG - Intergenic
1171961725 20:31499485-31499507 CAGGCTAAATAACTTGCCCAAGG - Intergenic
1172425583 20:34853784-34853806 GAGTTTAAACCACTTGCCCAAGG + Intronic
1172474739 20:35227837-35227859 GAGCTTAAGTAACTTGCCCAAGG + Intronic
1172577427 20:36019939-36019961 CAGGTTAAGTAGCTTGCCCAAGG - Intronic
1172749763 20:37242594-37242616 GAGGTTAAACTACTTGCCCAAGG - Intergenic
1172799697 20:37567194-37567216 GAGTTTAAGCAGTTTGCCCAAGG + Intergenic
1173027220 20:39319577-39319599 GAGGTTAAGCAACTTGCCCAGGG + Intergenic
1173161306 20:40654391-40654413 CAGATTGAGCAACTTGCCCAAGG - Intergenic
1173164216 20:40674954-40674976 AAGGTTAAGCAACTTGCCCAAGG - Intergenic
1173539386 20:43840131-43840153 AAGGGTAAGCAGCTTGCCCATGG - Intergenic
1173577244 20:44120558-44120580 CAGGTTAAGCAATTTGCCCAAGG + Intronic
1173685178 20:44918528-44918550 GAGGTTAAGTAGCTTGCCCAGGG + Intronic
1173941365 20:46913935-46913957 GAGGTTAATCAGCATGCCCAAGG + Intronic
1174146117 20:48453799-48453821 CAGGTTAAAAAACTTGCTCAAGG - Intergenic
1174615775 20:51834292-51834314 CAGTTTAAATAATTTGCCCAAGG - Intergenic
1174640720 20:52041645-52041667 CACCTTAAACAGCACGCTCAGGG - Intergenic
1174802669 20:53577577-53577599 AAGGTTAAATAACTTGCCCAAGG + Intronic
1174904121 20:54532245-54532267 GAGGTTAAACAACCTGCCCAAGG + Intronic
1174929933 20:54802424-54802446 CAGCGTAAACAGCATCCCCTGGG - Intergenic
1175137571 20:56836389-56836411 CAGCTGAAACAACAAGCCCATGG + Intergenic
1175205453 20:57307881-57307903 GAACCTAAACAACTTGCCCAAGG + Intergenic
1175419332 20:58821456-58821478 CAGGTCAGATAGCTTGCCCAAGG - Intergenic
1175877077 20:62235421-62235443 GAGCAGAAGCAGCTTGCCCAGGG - Intronic
1178104499 21:29302521-29302543 CAGGTAGAAGAGCTTGCCCAAGG - Intronic
1178159712 21:29897729-29897751 GAGATTAAATAACTTGCCCATGG - Intronic
1179594740 21:42435102-42435124 GAGGTTAAGCAACTTGCCCAAGG + Intronic
1180620349 22:17157866-17157888 GAGGTTAAGCAGCTTACCCAAGG - Intronic
1180985058 22:19899190-19899212 CTGTTCAAACAGCTTGCCCCAGG + Intronic
1181829271 22:25546431-25546453 CAACTTAAACAGTATGGCCAAGG - Intergenic
1181921469 22:26323973-26323995 GAGATGAAACTGCTTGCCCAAGG + Intronic
1181938481 22:26456303-26456325 TAGGATAAGCAGCTTGCCCAGGG - Intronic
1181949472 22:26543697-26543719 GAGATGAAGCAGCTTGCCCAAGG + Intronic
1181983197 22:26781246-26781268 GAGGTTAAGCAACTTGCCCATGG + Intergenic
1182837557 22:33356429-33356451 AAGGTTAAACACCTTGCCTAAGG - Intronic
1183105206 22:35610515-35610537 GAGGTTAAGCAGCTTGTCCACGG - Intronic
1183383390 22:37501688-37501710 GAGGTTAAGCAACTTGCCCAGGG - Intronic
1183788149 22:40043941-40043963 GAGCTTAGAAAACTTGCCCAAGG - Intergenic
1183972909 22:41491823-41491845 GAGCTTAAATAACTTCCCCAGGG + Intronic
1184272870 22:43394797-43394819 GAGGTTAAACAGCATGACCAAGG + Intergenic
1184311198 22:43644208-43644230 CTGCTCAAAGAGCTTGCCTAGGG - Intronic
1184839080 22:47042110-47042132 GAGCATAAGCACCTTGCCCAGGG + Intronic
949434619 3:4015176-4015198 AATCTTAAATAGCTTGACCAAGG - Intronic
949698222 3:6724145-6724167 GATGTTAAATAGCTTGCCCAAGG - Intergenic
949918011 3:8979996-8980018 GAGGCTAAACAGCTTGCCCAAGG - Intergenic
949939922 3:9147137-9147159 GAGATTAAATAACTTGCCCAAGG + Intronic
950358138 3:12428979-12429001 GATCTTAATCAGTTTGCCCAAGG + Intronic
950618442 3:14181463-14181485 AAGGTTAAATAACTTGCCCATGG + Intronic
950673844 3:14542844-14542866 GAGGTTAAGCAACTTGCCCAAGG + Intergenic
950684210 3:14604928-14604950 CAGTTTAAATATCTTGCCCAAGG + Intergenic
950716516 3:14851338-14851360 CAGGTTAAGCAACTTACCCAAGG + Intronic
951007616 3:17636363-17636385 AAGGTTAAATAACTTGCCCATGG + Intronic
951261355 3:20513066-20513088 GAGTTTAAGCATCTTGCCCAAGG - Intergenic
951895347 3:27604772-27604794 GAGCTTTAACAGCTTGCCCAAGG - Intergenic
952979810 3:38725537-38725559 GAGGTTAAACAACTTGCCTAAGG - Intronic
953098698 3:39805096-39805118 CAAGTTAAGCAACTTGCCCAAGG + Intergenic
953156129 3:40375882-40375904 CAGCTTAACCAGACTGCCAAAGG + Intergenic
953381473 3:42475970-42475992 GAAGTTAAACACCTTGCCCAAGG + Intergenic
953398257 3:42590026-42590048 CAGGTTAAGTAACTTGCCCAAGG - Intronic
953414301 3:42706883-42706905 GAGGTTAAATAACTTGCCCAAGG + Intronic
953470729 3:43163845-43163867 GAGCTTAAATAACTTGCCCAAGG + Intergenic
953844002 3:46412566-46412588 CAGCTAAAACGGGATGCCCATGG + Intronic
953929573 3:46999194-46999216 CAGCTTCATCCGCTGGCCCAAGG - Intronic
955111559 3:55955908-55955930 AAGGTTAAGAAGCTTGCCCACGG - Intronic
955399946 3:58584531-58584553 GAGCTTAAGCACCTTGCCCATGG - Intronic
955408552 3:58641347-58641369 GAGGTTAAGCAACTTGCCCAAGG - Intronic
955863435 3:63356520-63356542 CAGATTAAACAATTTGCTCAAGG + Intronic
956156301 3:66301867-66301889 CAGTTTAAATAACTTGCCTAAGG - Intronic
956727328 3:72167210-72167232 GAGGTTAAACTGCTTGCCCAAGG + Intergenic
956737053 3:72246019-72246041 GAGGTTAAACAGCCGGCCCAGGG - Intergenic
956841629 3:73145400-73145422 GAGCTTAAAGAGCTTGTCCAAGG - Intergenic
956892105 3:73623494-73623516 GAGGTTAAGCAGCTTGCTCAAGG + Intronic
959086332 3:101854234-101854256 GAGGTTAAATAACTTGCCCAAGG - Intronic
959554552 3:107701338-107701360 AACCTTAAGCAGCATGCCCAAGG - Intronic
960037437 3:113116017-113116039 CACCTTAAATACCTTGCACAGGG - Intergenic
960172346 3:114476919-114476941 AAGCATCAGCAGCTTGCCCAAGG - Intronic
960913508 3:122673912-122673934 AAGGTTAAATATCTTGCCCAAGG - Intergenic
961567374 3:127773324-127773346 CAGGTTAAGCCGCCTGCCCAAGG - Intronic
962098739 3:132319671-132319693 AAGGTTAAGCATCTTGCCCATGG + Intronic
962145748 3:132837809-132837831 GAGGTTAAGCAACTTGCCCAAGG - Intergenic
962814258 3:138984275-138984297 GAGTGTAAACAACTTGCCCAAGG - Intergenic
962862783 3:139419837-139419859 AAGGTTAAATAACTTGCCCAAGG + Intergenic
963157455 3:142114217-142114239 CAGCTTAAGTAACTTGCCCAAGG + Intronic
964121844 3:153193467-153193489 GAGGTTAAATAACTTGCCCAAGG + Intergenic
964505471 3:157394395-157394417 AAGGTTAAATAACTTGCCCAAGG - Intronic
965328217 3:167334613-167334635 GAGTTTAAACAACTTGCCCTTGG + Intronic
965638491 3:170808697-170808719 GAGGTTAAATAACTTGCCCAAGG - Intronic
965830330 3:172779156-172779178 TAGCTTAAATAACTTGTCCAAGG + Intronic
966033462 3:175379155-175379177 CAGGTTAAGTAACTTGCCCAAGG - Intronic
966307379 3:178551794-178551816 AAGCATGATCAGCTTGCCCAAGG + Intronic
966759995 3:183409399-183409421 CAGGTTAGGAAGCTTGCCCAAGG - Intronic
967541005 3:190667786-190667808 CAGCAGTAACAGCTTGACCATGG - Intergenic
967727988 3:192879845-192879867 CAGCTTCAGCACCTTGCCCAAGG + Intronic
967775085 3:193377911-193377933 GAGGTTAAATAACTTGCCCAAGG - Intronic
967849190 3:194069939-194069961 TAGATTAAGCAACTTGCCCAAGG + Intergenic
968008167 3:195256838-195256860 CAGGCTGAAGAGCTTGCCCAGGG + Intronic
968743467 4:2343712-2343734 CAGGTGGCACAGCTTGCCCAAGG + Intronic
968743475 4:2343759-2343781 CAGGTGGCACAGCTTGCCCAAGG + Intronic
968932147 4:3586838-3586860 GAGGTTAAACAGTTTGCCCCTGG + Intronic
969093100 4:4711171-4711193 CAGGTTAAGTAACTTGCCCACGG - Intergenic
969179980 4:5432937-5432959 GAGGTTAAGCAGCTTCCCCAAGG + Intronic
969256594 4:6006695-6006717 GAGTTTAAGAAGCTTGCCCAAGG + Intergenic
969289101 4:6227323-6227345 AAGGTTAACCAGCTTACCCAAGG - Intergenic
969383920 4:6830238-6830260 GTGGTTAAATAGCTTGCCCAAGG + Intronic
970607728 4:17696209-17696231 GAGGTTAAACGCCTTGCCCAGGG + Intronic
970747948 4:19321994-19322016 CATCTTAAATAGCATGCCCCAGG - Intergenic
970916546 4:21342471-21342493 AAGCTTAAACATCATGCCCAAGG + Intronic
971155414 4:24076272-24076294 TAGATGAAGCAGCTTGCCCAAGG + Intergenic
971340147 4:25760920-25760942 GTGGTTAAACAACTTGCCCAAGG + Intronic
971468784 4:26996070-26996092 CAAGTTAAACATTTTGCCCAAGG + Intronic
972294899 4:37728285-37728307 GAGGTTAAGCAACTTGCCCAAGG - Intergenic
972678047 4:41279087-41279109 AAGCTTAAGCAACTTGCCTAAGG + Intergenic
972823140 4:42725248-42725270 AAGGTTAAACAACTTTCCCAAGG + Intergenic
973252767 4:48077864-48077886 CTGGTTAACTAGCTTGCCCAAGG + Intronic
973319542 4:48795732-48795754 GAGCTTAAGTAACTTGCCCAAGG + Intergenic
973819048 4:54646559-54646581 AAGGTTAAATAACTTGCCCAAGG + Intergenic
973948310 4:55983875-55983897 GAGTTTAAATAACTTGCCCAAGG + Intronic
975434183 4:74332106-74332128 GAGCTTACATAGCTTTCCCAAGG - Intergenic
975468874 4:74741284-74741306 AAGGTTAAATAACTTGCCCAGGG + Intergenic
975647605 4:76560856-76560878 CAGATTAAATTACTTGCCCAAGG - Intronic
975822487 4:78286105-78286127 GAGATTAAACAACTTGCCCATGG - Intronic
976005966 4:80431187-80431209 CAGATAAAACATCCTGCCCAAGG - Intronic
976743642 4:88382264-88382286 CAACCTAAACTGCTTTCCCAAGG - Intronic
976819964 4:89195015-89195037 CAGTTTAAACATCTTGCTCGAGG - Intergenic
977111529 4:92962565-92962587 CAAGTTAAACAGTTTCCCCAGGG + Intronic
977797607 4:101185852-101185874 AGGCTTACAGAGCTTGCCCAGGG - Intronic
978162827 4:105569713-105569735 GAGGTTAAGCAGTTTGCCCAAGG - Intronic
980106113 4:128590149-128590171 GAGATTAAGCAACTTGCCCAAGG + Intergenic
980263856 4:130490708-130490730 AAGCTTAAACAACTTGCCAAAGG - Intergenic
980487073 4:133472486-133472508 CAGCTTAAGTAATTTGCCCAAGG - Intergenic
980989487 4:139726938-139726960 CAGGTTAAACAACATCCCCAAGG - Intronic
981010036 4:139916089-139916111 GAGATTAAACAAATTGCCCAAGG + Intronic
981431517 4:144666825-144666847 GAGGTTAAACAACTTGCCCAAGG - Intronic
981714921 4:147743430-147743452 GAAGTTAAACAACTTGCCCAAGG - Intronic
981722439 4:147815234-147815256 CAGGTTACCCAACTTGCCCAAGG - Intronic
982123047 4:152160610-152160632 AAGGTTAAGCAGCTTGCCCCAGG + Intergenic
982156148 4:152522832-152522854 GAGGTTAAACAACTTGCCAAAGG + Intronic
982364753 4:154565203-154565225 CAGATAAAGCAACTTGCCCAAGG + Intronic
983983335 4:174026402-174026424 GAGATTAAATAACTTGCCCAAGG + Intergenic
984374754 4:178913735-178913757 CAGATTAAACAATTTGCTCAAGG + Intergenic
984382142 4:179008135-179008157 TAGGTTAAGCAGCTTGCCCAGGG + Intergenic
984539055 4:181014300-181014322 GAGTTTAAACAACTTGTCCAAGG - Intergenic
984688048 4:182693739-182693761 CAGGTTAAATGACTTGCCCAAGG - Intronic
987066463 5:14294696-14294718 GAGGTTAAACAGCCTTCCCAAGG - Intronic
987329514 5:16843466-16843488 GAGCTTAAAAATCTTGCCCAGGG + Intronic
987379390 5:17270876-17270898 GAGATTAAATAACTTGCCCAAGG + Intronic
988078234 5:26381460-26381482 CTGCAGAAACAACTTGCCCAAGG + Intergenic
988901153 5:35733859-35733881 GAGGTTAAACAGCTTGTACAAGG - Intronic
988993975 5:36696879-36696901 GAGTTTAAGCAGGTTGCCCAAGG + Intergenic
988997847 5:36731356-36731378 CAGGTTAAATAACTTTCCCAAGG + Intergenic
989114787 5:37942055-37942077 AAGCTTAACAAACTTGCCCAAGG + Intergenic
990253022 5:53936345-53936367 CAGTTTAAACAATTTGCTCAAGG + Intronic
990430637 5:55732177-55732199 AAGATTAAATAACTTGCCCAAGG + Intronic
990653531 5:57929230-57929252 CAGGTTAAGCAATTTGCCCAAGG + Intergenic
991971551 5:72146613-72146635 ATGGTTAAACAGCATGCCCAAGG + Intronic
992014593 5:72563045-72563067 GAGCTCAAAGTGCTTGCCCAAGG - Intergenic
992039936 5:72819804-72819826 GAGATTAAATAACTTGCCCAAGG - Intronic
992103971 5:73435563-73435585 CAGAATCAACAGCTTGCCTAAGG + Intergenic
992193570 5:74317521-74317543 GAGGGCAAACAGCTTGCCCAAGG + Intergenic
992621128 5:78594084-78594106 AAGGTTAAGGAGCTTGCCCAAGG + Intronic
992929088 5:81622487-81622509 CAGTTTAAGCAACTTGCTCAAGG - Intronic
993225125 5:85159966-85159988 GAGGTTTAACAACTTGCCCAAGG + Intergenic
993650925 5:90521158-90521180 GAGGTTAAACAACTTGCCCCAGG - Intronic
993678821 5:90850027-90850049 AATCTTACACAGCTTGCCAAGGG + Intronic
994008160 5:94865787-94865809 AAGGTTAAGTAGCTTGCCCAAGG - Intronic
994759447 5:103834742-103834764 GAGGTTAAACAACTTGTCCATGG + Intergenic
995122037 5:108546577-108546599 CAGGTTAAGCAACTTGCCCAAGG + Intergenic
995390481 5:111635289-111635311 GAGATTAAATAACTTGCCCATGG + Intergenic
995435568 5:112131249-112131271 GAGATTAAGAAGCTTGCCCAAGG - Intergenic
995544081 5:113212868-113212890 CAGCTTAAAGAGCTGGAGCAAGG - Intronic
995805328 5:116045971-116045993 CAGCTGAAACAGCTTGGAGAGGG + Intronic
996436747 5:123441972-123441994 AAGGTTAAATAACTTGCCCAAGG - Intergenic
997202457 5:132019676-132019698 GAGCTGACATAGCTTGCCCAAGG + Intergenic
997645703 5:135480458-135480480 GAGATAAAGCAGCTTGCCCAGGG + Intergenic
997783490 5:136684208-136684230 CAGGTTAAATGACTTGCCCAAGG + Intergenic
997803525 5:136890499-136890521 GAGGTTAAATAACTTGCCCAAGG - Intergenic
997883214 5:137609121-137609143 GAGGTTAAACAGCTTGCACAGGG - Intergenic
998795488 5:145813627-145813649 TAGGTTAAATAACTTGCCCAAGG - Intronic
998818311 5:146035495-146035517 CAGGTTAAATAACTTGCCCAGGG + Intronic
998863047 5:146464242-146464264 CAGGTTAAATTACTTGCCCAAGG + Intronic
998901327 5:146858160-146858182 GAGGTTAAATAACTTGCCCAAGG + Intronic
999101004 5:149026378-149026400 GAAATTAAATAGCTTGCCCAAGG + Intronic
999623447 5:153495378-153495400 CAGATTATATAACTTGCCCAAGG + Intronic
1000126975 5:158255033-158255055 GAGGTTAAGCAACTTGCCCAAGG + Intergenic
1000149800 5:158488506-158488528 CATCTTGGACAGCCTGCCCAAGG - Intergenic
1000179426 5:158793629-158793651 GAGGTTAAAAAGCTTGCCCAAGG - Intronic
1000298886 5:159937339-159937361 GAGTTTAAACAACTTGCCCAGGG + Intronic
1000907107 5:166976849-166976871 AAGATTAAGTAGCTTGCCCAAGG - Intergenic
1001143698 5:169166040-169166062 GAGGTTAAATAACTTGCCCAAGG + Intronic
1001514683 5:172347078-172347100 CAGGTGAAACAGTTTGCCCGCGG - Intronic
1001545171 5:172566476-172566498 GAGCCCAAGCAGCTTGCCCAAGG - Intergenic
1001567910 5:172712534-172712556 GAGCTTAAGCAACTTGCCCAAGG + Intergenic
1001607573 5:172973300-172973322 GAGGTTAAGCAGTTTGCCCAAGG - Intergenic
1001759765 5:174197693-174197715 CAGGTGAAGCACCTTGCCCAGGG - Intronic
1001934610 5:175695264-175695286 AAGGTTAATCAGCGTGCCCAAGG - Intergenic
1001966321 5:175912208-175912230 GAGGTTAGGCAGCTTGCCCAAGG - Intergenic
1002250626 5:177926995-177927017 GAGGTTAGGCAGCTTGCCCAAGG + Intergenic
1003382454 6:5637450-5637472 CAGGTAAAGCAGCTCGCCCAGGG + Intronic
1003391281 6:5715176-5715198 CTGGTTAAATATCTTGCCCAGGG + Intronic
1003555004 6:7131517-7131539 TAGTTTAAATAACTTGCCCAAGG + Intronic
1004114731 6:12755310-12755332 AAGGTTAAATGGCTTGCCCATGG - Intronic
1004691294 6:17994409-17994431 CAATTTAAGCAGCTTGCCCAAGG + Intergenic
1005209072 6:23440117-23440139 CATTTTATACAGGTTGCCCATGG + Intergenic
1005595313 6:27373633-27373655 AAGGTTAAATAACTTGCCCAAGG + Intergenic
1005817881 6:29571214-29571236 GAGGTTAAGTAGCTTGCCCAAGG - Intronic
1005893840 6:30161686-30161708 CAGGTTATTCAGCTTGCCCTAGG + Intergenic
1006643313 6:35499388-35499410 GAGGTTAAGCAACTTGCCCACGG - Intronic
1006901635 6:37506341-37506363 GAGGTTAAATAACTTGCCCAAGG - Intergenic
1006928850 6:37675249-37675271 GAGGTTAAACAACTTTCCCAAGG - Intronic
1007273968 6:40660143-40660165 CAGCTTCAACTCATTGCCCAGGG + Intergenic
1007605065 6:43112022-43112044 AAGGATAAACAGCTTGTCCAAGG + Intronic
1007758748 6:44119060-44119082 GAGGTTAAATAACTTGCCCAAGG + Intronic
1007766458 6:44163195-44163217 GAGGTCAAACAACTTGCCCAAGG + Intronic
1008625874 6:53315972-53315994 TAGTTTTAGCAGCTTGCCCAAGG - Intronic
1008658337 6:53639414-53639436 CAGTTTAAACTGCTTTCCAAAGG + Intergenic
1008800396 6:55362169-55362191 GAGATTAAATAGCTTGCCCAGGG + Intronic
1009636606 6:66273515-66273537 GAGATTAAATAACTTGCCCAAGG - Intergenic
1009715881 6:67394595-67394617 AAGCTTTAGCAGCTTCCCCATGG + Intergenic
1010509560 6:76701925-76701947 TAGCAGAAACAGCTTGCCCCTGG + Intergenic
1011563027 6:88642685-88642707 GAGGTTAAATAACTTGCCCATGG - Intronic
1013545077 6:111148748-111148770 TTGGTTAAACAACTTGCCCAAGG - Intronic
1013594311 6:111647003-111647025 TAGCTTGAACAGCATCCCCAGGG + Intergenic
1013673713 6:112433829-112433851 CAGTTTAAAAATATTGCCCAAGG - Intergenic
1014389630 6:120845307-120845329 AAGTTTAAATAACTTGCCCAAGG - Intergenic
1014855030 6:126389812-126389834 CAGCTTAAATAATGTGCCCAAGG + Intergenic
1015274802 6:131373242-131373264 AAGATTAAACAACTTGCCGAAGG + Intergenic
1015546252 6:134364507-134364529 AAGCTTAAGCAATTTGCCCAAGG - Intergenic
1015681525 6:135813926-135813948 AAACTTAAATAGCTTGTCCAAGG - Intergenic
1015833882 6:137398451-137398473 AAGCTTAAGCAACCTGCCCAGGG - Intergenic
1015891251 6:137971822-137971844 CACCCCAAACTGCTTGCCCATGG + Intergenic
1016309312 6:142716156-142716178 AAGTATAAACAGCTTGCCCAAGG - Intergenic
1016586004 6:145686845-145686867 GAGATTAACTAGCTTGCCCAAGG + Intronic
1016806478 6:148217245-148217267 GAGGTTAAGCAACTTGCCCAAGG - Intergenic
1017422537 6:154287522-154287544 AAGGTTAAGCAGTTTGCCCAAGG + Intronic
1017644270 6:156524669-156524691 GAGCTTGAGTAGCTTGCCCAAGG + Intergenic
1017817461 6:158026341-158026363 GAGGTTAAGCAGCCTGCCCAAGG - Intronic
1017979436 6:159386741-159386763 GAGATTAAATAACTTGCCCAAGG + Intergenic
1018345855 6:162898595-162898617 GAGATTAAGCAACTTGCCCAAGG - Intronic
1021406394 7:20272168-20272190 CAGCTTAGAAATTTTGCCCAAGG + Intergenic
1022109280 7:27218625-27218647 AAGCTTAAGTAACTTGCCCAAGG + Intergenic
1022632903 7:32102416-32102438 GAGGTTAAATAGCTTGCCAAGGG - Intronic
1022756524 7:33298284-33298306 GAACTTAAATAGCTTGCCCAAGG - Intronic
1023246533 7:38210912-38210934 CTTATTAAACAGCTTGCCCAAGG - Intronic
1023281647 7:38576847-38576869 AAGCTTAAATGACTTGCCCAAGG - Intronic
1023343394 7:39246537-39246559 CAGGTTAAATAACTTGCCTAAGG - Intronic
1023682494 7:42701847-42701869 GAGATTAAGCAACTTGCCCAAGG - Intergenic
1024688152 7:51770507-51770529 CAGGTTAAATGGCATGCCCAAGG - Intergenic
1026548616 7:71347301-71347323 CAGGTTAAGCAACTTGCCCAAGG - Intronic
1027290017 7:76696752-76696774 AAGATTAAACAGTTTGCCCAAGG - Intergenic
1027414832 7:77963850-77963872 GAGGTTAAATAACTTGCCCAAGG - Intergenic
1028185271 7:87777306-87777328 GAGCTTAAGTAACTTGCCCAAGG + Intronic
1028210763 7:88071452-88071474 AAGATTAAGCAGCTTGGCCAAGG + Intronic
1028765007 7:94544970-94544992 GAGCTTAAATAATTTGCCCAAGG + Intronic
1028845143 7:95471907-95471929 GAGGTTAAATAACTTGCCCAAGG + Intergenic
1028995817 7:97098759-97098781 GAGGTTAAACAACTAGCCCAAGG + Intergenic
1029802843 7:102967644-102967666 CACCCTAAACATCTTTCCCATGG + Intronic
1030009392 7:105151316-105151338 CAGCTTAAACAGCTTGCCCAGGG - Intronic
1030139589 7:106291245-106291267 CAGCTTTAAGAGCTTGTGCATGG + Intergenic
1030160723 7:106505783-106505805 GAGATAAAATAGCTTGCCCAAGG - Intergenic
1030268440 7:107645227-107645249 AAGCTTAAATAACTTGCTCAAGG + Intergenic
1030274216 7:107702268-107702290 CAGATTAAGCAACTTGCCCAGGG - Intronic
1030822069 7:114106156-114106178 CAGATGAAAGAACTTGCCCAAGG - Intronic
1030893826 7:115031744-115031766 CACCTTAAACACCTTGCTGAAGG + Intergenic
1030916418 7:115319766-115319788 GAGGTTAAATAACTTGCCCAAGG - Intergenic
1031067764 7:117124691-117124713 AAAGTTAAACAACTTGCCCAAGG - Intronic
1031979592 7:128116114-128116136 CAGGTTGAGTAGCTTGCCCAAGG + Intergenic
1032278782 7:130484538-130484560 AAGATTAAGGAGCTTGCCCATGG - Intergenic
1032369385 7:131331222-131331244 CAGGGTAAGTAGCTTGCCCAGGG + Intronic
1032738825 7:134718381-134718403 GAAGTTAAATAGCTTGCCCAAGG + Intergenic
1032884109 7:136119410-136119432 CAGCTTGCACAGCTTGCCTGTGG + Intergenic
1033134991 7:138776783-138776805 GAGGTTAAATAGCTTTCCCAAGG - Intronic
1033334352 7:140439806-140439828 AAGGTTAAATAACTTGCCCAAGG + Intergenic
1034296998 7:149982544-149982566 AAGCTTAAGCAGCTTCCTCAAGG + Intergenic
1034399980 7:150855901-150855923 GAGTTTAAGCAGCGTGCCCAAGG + Intronic
1034497097 7:151429594-151429616 CAGGTTAAGCAACTTGCCCAGGG - Intronic
1034504492 7:151476498-151476520 GACCTAAAGCAGCTTGCCCAGGG - Intronic
1034652792 7:152705320-152705342 GGGGTTAACCAGCTTGCCCATGG + Intergenic
1036166830 8:6443170-6443192 GAGGTCAAACAGCTTGTCCAAGG + Intronic
1037317732 8:17614843-17614865 CAGTTCAAACAACTTTCCCAGGG - Intronic
1037459428 8:19094350-19094372 GAGCTGAAGCAACTTGCCCAAGG + Intergenic
1038183528 8:25250883-25250905 CAGCTGCAATATCTTGCCCAGGG - Intronic
1038628036 8:29213405-29213427 AAGATTAAATAACTTGCCCAAGG + Intronic
1038666949 8:29546036-29546058 GAGCCTAAGCAACTTGCCCAAGG + Intergenic
1038670965 8:29582604-29582626 CAGGATAAGCACCTTGCCCAAGG - Intergenic
1038672026 8:29590380-29590402 GAGCTTAAATAACTTGCTCATGG + Intergenic
1039236108 8:35504252-35504274 GAGCCCAAACAGCTTGCCTAAGG - Intronic
1039417098 8:37404860-37404882 CAACTTAAATATATTGCCCAAGG - Intergenic
1039904949 8:41779763-41779785 GAGGTTAAAAAACTTGCCCAAGG + Intronic
1040823047 8:51586055-51586077 CAGCTTAATCACCTTGCAAAGGG - Intronic
1042223402 8:66495375-66495397 GAGGTTAAGTAGCTTGCCCAAGG - Intronic
1042526192 8:69767448-69767470 GAGCTTAAGCAACTTGCTCAAGG - Intronic
1042580795 8:70277088-70277110 AAAATTAAAGAGCTTGCCCATGG - Intronic
1042739102 8:72023368-72023390 AAGGTTAAGCAGATTGCCCAGGG + Intronic
1042821507 8:72935090-72935112 AAGGTTAAATAACTTGCCCAAGG + Intronic
1042935655 8:74055387-74055409 AAGCTTAAATAACTTGCCCAAGG - Intergenic
1043490725 8:80746514-80746536 AAACTTAAACATCTTGCCCAAGG - Intronic
1044071236 8:87762740-87762762 AAGCTTAATTGGCTTGCCCAGGG - Intergenic
1044193467 8:89346826-89346848 GAGGTTAAACAACTTGTCCAAGG + Intergenic
1044306117 8:90643409-90643431 GAGAATAAACAACTTGCCCAAGG + Intronic
1044532061 8:93318413-93318435 CTGGTTAAACAGCTTTCCTAGGG + Intergenic
1044858932 8:96502721-96502743 AAGGTTAAAAAACTTGCCCAAGG - Intronic
1045169788 8:99652253-99652275 CAGGTTAAATAACTTGCCTAAGG - Intronic
1045394385 8:101746300-101746322 CAGATTAAATGACTTGCCCAGGG - Intronic
1045470959 8:102511699-102511721 CAGGATGAACAGCTTGCTCAGGG - Intergenic
1046054969 8:109068442-109068464 CAGGTTGAGCAACTTGCCCAAGG + Intergenic
1046695537 8:117335273-117335295 GAGTTAAAGCAGCTTGCCCAAGG - Intergenic
1046730695 8:117722808-117722830 CAACTTAAACAACTGGTCCAGGG + Intergenic
1046782456 8:118230274-118230296 CAGGCTAAATGGCTTGCCCAAGG + Intronic
1046886309 8:119371104-119371126 CTGCTTAAACACCCTGGCCATGG + Intergenic
1047073665 8:121376143-121376165 CAGGTTAAATAGCTCGCCCGAGG + Intergenic
1047440124 8:124870438-124870460 AAGGTTAAATAGTTTGCCCAAGG - Intergenic
1047502624 8:125453996-125454018 GAGGTTAAATAACTTGCCCACGG + Intergenic
1047524058 8:125617457-125617479 AAGGTTAAATAGTTTGCCCAAGG + Intergenic
1047616808 8:126569480-126569502 AAGCTTAAGCATCTTGCCCATGG + Intergenic
1048101165 8:131353028-131353050 CAGGATAAATGGCTTGCCCAAGG - Intergenic
1048207765 8:132429251-132429273 CAGGCTTAACAGCTAGCCCATGG + Intronic
1048344351 8:133565789-133565811 GAGGTTAAACAACGTGCCCAAGG + Intronic
1048556849 8:135486536-135486558 GAGGTTAAATAACTTGCCCAGGG + Intronic
1048567602 8:135619514-135619536 CAGGTTAAATAACTTGCCCATGG - Intronic
1048675763 8:136777830-136777852 CAGGTTAATCAACTTGCCTAAGG + Intergenic
1049658972 8:143811310-143811332 CAGCTTAGTCAGCTTTCCCAGGG + Exonic
1050348436 9:4716497-4716519 GAGGTTAAATAGCTTGCCTAGGG + Intronic
1052374610 9:27704661-27704683 CACATTAAACAGCTTGAGCAAGG + Intergenic
1053050371 9:34956987-34957009 GAGGTTAAACAACTCGCCCAAGG - Intergenic
1053452682 9:38206317-38206339 CAGTTTAAGTAACTTGCCCAAGG - Intergenic
1054821652 9:69527530-69527552 CAGCTTAAATAACTTGTCCAAGG + Intronic
1054926477 9:70594163-70594185 AAGATTAAGCAGCTTGCCCGAGG - Intronic
1056222269 9:84461884-84461906 CGGGTTAAGCAGCTTGCCCAAGG - Intergenic
1057452381 9:95176170-95176192 CAGTTTAAGCAGCCTGCCCAAGG + Intronic
1057575259 9:96237379-96237401 GAGCTGCAACAGCTGGCCCATGG - Intronic
1057739292 9:97697657-97697679 CTGGTTAAATAACTTGCCCAAGG - Intergenic
1058312750 9:103525846-103525868 GAGCTTAAGCAGCTTGCTCAAGG + Intergenic
1058418407 9:104811823-104811845 GAGACTAAGCAGCTTGCCCAAGG + Intronic
1058537904 9:105981009-105981031 CAGCTTAAACAAGTACCCCAAGG + Intergenic
1058682925 9:107455771-107455793 CACATTAAATAGCTTGCTCAAGG - Intergenic
1058683205 9:107457867-107457889 CACATTAAATAGCTTGCTCAAGG + Intergenic
1058917099 9:109578163-109578185 GAGATTAAATGGCTTGCCCATGG - Intergenic
1059362452 9:113755614-113755636 CAGATTAAATAAATTGCCCAAGG + Intergenic
1059454524 9:114391148-114391170 GAGCCCAAGCAGCTTGCCCAAGG + Intronic
1059454697 9:114392468-114392490 GAGGTTAAGCAGCTTGCCCAAGG - Intronic
1059522836 9:114959879-114959901 CAGGTTAAACAGCTTGACCAAGG - Intergenic
1059695640 9:116727768-116727790 GAGGTTAAATAACTTGCCCAAGG - Intronic
1060067988 9:120521308-120521330 GAGCTCAAATATCTTGCCCAAGG + Intronic
1060078677 9:120619524-120619546 CAGATTAAGCAACTTGCTCAAGG + Intronic
1060087932 9:120718219-120718241 CAGGTTAAGCAACTTGCCCATGG + Intergenic
1060906278 9:127309268-127309290 GAGTTTAAACATGTTGCCCAAGG - Intronic
1060927297 9:127463924-127463946 CAGTTTAAGAAACTTGCCCAAGG + Intronic
1061674104 9:132206009-132206031 CAGGTTAGACAACTTGCCCAGGG - Intronic
1186716182 X:12254406-12254428 CAGCTGAAACAGCTTGCTTTGGG + Intronic
1186915119 X:14210571-14210593 GAGCTTAAGTAGCTTGCCCAAGG + Intergenic
1187125270 X:16448638-16448660 GAGGTTAACCACCTTGCCCAAGG - Intergenic
1187254372 X:17628755-17628777 GAGGTTAAACAACTTGCCCAAGG - Intronic
1187256616 X:17648842-17648864 CAGGTTAAATAACTTGCCCAAGG - Intronic
1187289919 X:17943146-17943168 GAGGTTAAATAGCTTACCCAAGG + Intergenic
1187829803 X:23369515-23369537 GAGCTTAAATAACTTGTCCATGG - Intronic
1187940583 X:24377002-24377024 CAGATGAAGCAGTTTGCCCAAGG - Intergenic
1188158175 X:26768042-26768064 CATCTTTCCCAGCTTGCCCAAGG + Intergenic
1188847485 X:35091108-35091130 CAGGTTAACAAGCTTGCCCAAGG - Intergenic
1189747939 X:44189335-44189357 GAGCTTTAACAGATTGCCCAAGG + Intronic
1190740653 X:53286602-53286624 CAGCTTCCTCTGCTTGCCCATGG - Intronic
1191733089 X:64358554-64358576 AAAGTTAAACAACTTGCCCAAGG + Intronic
1191914919 X:66191195-66191217 CAGGTTAAATAACTTGCCCAAGG - Intronic
1192185701 X:68945467-68945489 GAGGTTAAGCAACTTGCCCAGGG + Intergenic
1192190148 X:68986055-68986077 GAGGTTAAATAACTTGCCCACGG - Intergenic
1193021089 X:76794245-76794267 GAGTTTAAAAAGTTTGCCCAGGG + Intergenic
1194376891 X:93147587-93147609 AAGTTTAAATAACTTGCCCAGGG + Intergenic
1194773077 X:97928573-97928595 GTGCTTTAACATCTTGCCCAAGG - Intergenic
1195761084 X:108247223-108247245 GAGATAAAGCAGCTTGCCCAAGG - Intronic
1196610563 X:117709792-117709814 AAGGTTAAACAACTTGCCCAAGG + Intergenic
1196677330 X:118433564-118433586 GAGGTTAAATAACTTGCCCAAGG - Intronic
1196905539 X:120429357-120429379 CAGTTTAAATAACTTGCCCAAGG - Intronic
1197884359 X:131202933-131202955 GAGGTTAAACAACTTACCCAAGG + Intergenic
1197976684 X:132173043-132173065 GAGGTTAAATAGCTTGCCTAAGG + Intergenic
1198395241 X:136213082-136213104 CAGGTTAAGAAGCTTGCCTAAGG + Intergenic
1198460882 X:136862072-136862094 GAGGTTAAGCAACTTGCCCAAGG + Intronic
1198762429 X:140046735-140046757 GAGGTTAAGCAACTTGCCCAAGG - Intergenic
1199575428 X:149309042-149309064 GGGCTTAAAGAGCTTGCCCAAGG - Intergenic
1199587793 X:149434583-149434605 AAGGTTAAGCAACTTGCCCAAGG - Intergenic
1199820307 X:151439036-151439058 GGGGTTAAACAGCTTGTCCATGG + Intergenic
1199940972 X:152627587-152627609 CAGTTTAAACACCTTTCCCTTGG + Intergenic