ID: 1030010382

View in Genome Browser
Species Human (GRCh38)
Location 7:105160463-105160485
Sequence CCAATTAGGTACTAGGGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 62}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030010382 Original CRISPR CCAATTAGGTACTAGGGCCT AGG Intronic
902680108 1:18037332-18037354 CCTACTAGGTACTAGGTCCTAGG - Intergenic
903849224 1:26296286-26296308 CCAATTCAGTGCTAGGTCCTGGG + Intronic
904871496 1:33621884-33621906 CCAATTATATACTGGGACCTTGG + Intronic
905971327 1:42144653-42144675 CCACTTAGGCACTGGGGCCCTGG + Intergenic
912441924 1:109705758-109705780 CCCATTTGATACTGGGGCCTGGG - Intronic
912650025 1:111429738-111429760 ACAGTTGGGTCCTAGGGCCTGGG + Intergenic
918463255 1:184797004-184797026 AGAATTAGCTACTAGGACCTTGG + Intronic
924945464 1:248843437-248843459 GCAGCTAGGAACTAGGGCCTTGG + Intronic
1077976107 11:7250989-7251011 CCAATGAGAAACTGGGGCCTGGG - Intronic
1082738635 11:56885381-56885403 CAAATTAGCTACTGGTGCCTTGG - Intergenic
1083478728 11:62930064-62930086 GAAATTTGGGACTAGGGCCTGGG - Intergenic
1084411126 11:69006354-69006376 CCAATTAGGGACTTGGGGCAGGG + Intronic
1085530730 11:77190569-77190591 CCAGTGAGGTACTGGGGCCTGGG + Intronic
1087082228 11:94182680-94182702 CCAACTTGGTACTGGTGCCTGGG - Intergenic
1087680980 11:101218160-101218182 CCCATTTGATACTGGGGCCTGGG + Intergenic
1104381776 12:128313646-128313668 CCAATTAGGATCTAGCCCCTGGG + Intronic
1104518041 12:129445985-129446007 CCAAATTGGTACCAGGGGCTGGG + Intronic
1106859802 13:33893284-33893306 CCAATTATTTACTAGAACCTAGG + Intronic
1110464924 13:75789794-75789816 CCAATTATGTTCTAGGGCTAGGG - Intronic
1113119332 13:106909466-106909488 CCAACTAGGTACCAGGAACTGGG - Intergenic
1120468041 14:84886002-84886024 CCATTCAGGAGCTAGGGCCTGGG - Intergenic
1130006417 15:80103281-80103303 ACTATTATGTACTAGGCCCTGGG - Intronic
1130789976 15:87143694-87143716 CCAAATATTTATTAGGGCCTTGG - Intergenic
1158706393 18:59796102-59796124 TCAATTACGTACTATGGCCAAGG + Intergenic
1159906377 18:74096417-74096439 CCAATTAGTTACTACAGCCAAGG + Intronic
1160068032 18:75595816-75595838 TCAATTAGTTACTAAAGCCTAGG - Intergenic
925251533 2:2443018-2443040 CCAAATACGTACTAGGCACTTGG - Intergenic
926858304 2:17281138-17281160 CCACTTTGGCACTAGGGCCTGGG + Intergenic
927618402 2:24624110-24624132 ACAATTGGGTACTATAGCCTCGG - Intronic
927703866 2:25285328-25285350 GCAATTAGGGACAAGGGCCTTGG + Intronic
930840770 2:55842421-55842443 TCAATTAGTCACCAGGGCCTGGG - Intergenic
940171818 2:150836708-150836730 CCTATTATGGACTAGGTCCTGGG + Intergenic
940328914 2:152453801-152453823 CCAATTAGGCTCTAACGCCTTGG - Intronic
940960829 2:159784129-159784151 CCAATTAAATTCTAGAGCCTAGG - Intronic
943967339 2:194353950-194353972 ACAAGTAGGTACTAGGGCCTTGG + Intergenic
944376087 2:199043646-199043668 CCTGTTAGGGACTAGGGCATAGG - Intergenic
944647651 2:201795630-201795652 CCAACTGGATACTAGGGGCTGGG + Intronic
1172097752 20:32468504-32468526 CCTATTCAGTGCTAGGGCCTGGG + Intronic
950111355 3:10420808-10420830 CAAGTTAGGAACTAGTGCCTTGG - Intronic
952271650 3:31838571-31838593 GCTATTAGGTGGTAGGGCCTTGG + Intronic
956771438 3:72529437-72529459 TCAATTAGGAACTATAGCCTTGG - Intergenic
964743002 3:159987574-159987596 GTTATTAGGTCCTAGGGCCTGGG + Intergenic
970424080 4:15930429-15930451 TCATCTAGGTACTAGGGCCAGGG + Intergenic
988096612 5:26620626-26620648 ACACTTAAGTAATAGGGCCTGGG + Intergenic
1001294173 5:170487370-170487392 ACAACTGGGTACTATGGCCTAGG + Intronic
1003435542 6:6084659-6084681 CCTAGTAGGTACTAGGGACTGGG + Intergenic
1012221599 6:96656211-96656233 CCTATTATGTACTAGTTCCTGGG - Intergenic
1016775591 6:147901216-147901238 CCAAGTAGGTACTGTGGGCTAGG - Intergenic
1021544233 7:21795262-21795284 CCCACTAGGTACTAGGTACTAGG - Intronic
1026421200 7:70239266-70239288 CAGAGTAGGTAGTAGGGCCTGGG - Intronic
1030010382 7:105160463-105160485 CCAATTAGGTACTAGGGCCTAGG + Intronic
1032089505 7:128904216-128904238 CCAAGTAGGTACTGGACCCTTGG + Intronic
1032685135 7:134225084-134225106 GCAATAAGGTACTAAGGGCTGGG + Intronic
1032896530 7:136257071-136257093 CCAATTAGGTAGAAGTGACTGGG - Intergenic
1038230322 8:25693522-25693544 CCAATTGGATACTAGGTTCTCGG - Intergenic
1042012428 8:64262528-64262550 ACAATTAAGGACTAGGGCTTTGG - Intergenic
1045820573 8:106332411-106332433 CCAATAAGTTACTTGGGCATTGG - Intronic
1047654762 8:126964949-126964971 CCAATCAGGTACTAACCCCTCGG + Intergenic
1053488822 9:38484277-38484299 TAAATTAGGTACTAGGGCTGGGG + Intergenic
1057669167 9:97073530-97073552 TAAATTAGGTACTAGGGCTGGGG + Intergenic
1059495228 9:114703631-114703653 GGAATTAGGCACTAGGCCCTTGG + Intergenic
1059654324 9:116343690-116343712 CCAACTAGGTAATAGAGCATAGG + Intronic
1059906255 9:118990149-118990171 CATATTAGATACTAGGGCCAGGG - Intergenic
1061423368 9:130484127-130484149 CCTCTTAGGTACCAGGGCCAAGG - Intronic
1185815447 X:3150973-3150995 CCAAAGAGGTGCTTGGGCCTAGG - Intergenic
1188559913 X:31455918-31455940 CCAATTTGGTAGTAGAGCCCAGG - Intronic
1196160815 X:112480315-112480337 CCAATCATTTTCTAGGGCCTTGG + Intergenic
1198119655 X:133579411-133579433 CCAATTAGGTCCCAGGCACTGGG + Intronic
1201475685 Y:14378365-14378387 CCCATTTGATACTGGGGCCTGGG + Intergenic