ID: 1030014621

View in Genome Browser
Species Human (GRCh38)
Location 7:105206236-105206258
Sequence CTAGTGCACTGGTTCTCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 8, 3: 82, 4: 329}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030014621_1030014625 10 Left 1030014621 7:105206236-105206258 CCCATTGAGAACCAGTGCACTAG 0: 1
1: 0
2: 8
3: 82
4: 329
Right 1030014625 7:105206269-105206291 TATATATGGCTTTACCTCAATGG 0: 1
1: 0
2: 0
3: 8
4: 152
1030014621_1030014624 -4 Left 1030014621 7:105206236-105206258 CCCATTGAGAACCAGTGCACTAG 0: 1
1: 0
2: 8
3: 82
4: 329
Right 1030014624 7:105206255-105206277 CTAGTAGCATTTTCTATATATGG 0: 1
1: 0
2: 2
3: 16
4: 253
1030014621_1030014627 27 Left 1030014621 7:105206236-105206258 CCCATTGAGAACCAGTGCACTAG 0: 1
1: 0
2: 8
3: 82
4: 329
Right 1030014627 7:105206286-105206308 CAATGGAGTAGACTGCAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030014621 Original CRISPR CTAGTGCACTGGTTCTCAAT GGG (reversed) Intronic
902173989 1:14635729-14635751 CTAGACCAGTGGTTCTCAACTGG + Intronic
902281848 1:15380418-15380440 CTAGAACAGTGGTTCTCAATTGG - Intronic
902813051 1:18900423-18900445 CTAGAGCACTGGCTCTCAACCGG + Intronic
902852908 1:19175319-19175341 TTAGAGCAATGGTTCTCAATGGG - Intronic
904229114 1:29052352-29052374 TTAGGGCAGTGGTTCTCAACTGG - Intronic
904809398 1:33153384-33153406 CTAGAGCAGTGGTTCTCAACTGG + Intronic
905664137 1:39752150-39752172 TTAGGGCACTGCTTCTCAGTGGG - Intronic
905798420 1:40828469-40828491 GTAGAGCAGTGGTTCTCAACTGG - Intronic
907810893 1:57868635-57868657 CTACTGCAGTGGTTCTCAACTGG - Intronic
908043770 1:60145670-60145692 CTAGAGCAGTGGCTCTCAATGGG + Intergenic
908185005 1:61644055-61644077 CTAGGGCAGTGGTTCTCAACTGG + Intergenic
908456314 1:64308211-64308233 CTATCCCAGTGGTTCTCAATCGG + Intergenic
908661259 1:66437944-66437966 TTAGGGCAGTGGTTCTCAACTGG + Intergenic
913256933 1:116962309-116962331 GTAGAGCACTGGGTCACAATTGG + Intronic
913370020 1:118087991-118088013 CTAGAGCAGTGGTTCTCAACAGG - Intronic
914681754 1:149943852-149943874 CTGGTGCACAGGTTCTGAACGGG - Exonic
915019945 1:152769679-152769701 CTAATTCAGTGGTTCTCAATGGG - Intronic
916000139 1:160607577-160607599 CTAGATCAGTGGTTCTCAACTGG + Intergenic
916038617 1:160943333-160943355 CTAGAGCATTGGTTTTCAAATGG - Intergenic
916583609 1:166130449-166130471 TTAATGCAGTGGTTCTCAACTGG + Intronic
918417510 1:184326871-184326893 TTAGAGCAGTGGTTCACAATCGG - Intergenic
918552991 1:185765706-185765728 GTAGGGCAATGGTTCTCAAAAGG + Intronic
918555158 1:185790599-185790621 CTAGAGCAGTGTTTTTCAATGGG + Intronic
918643921 1:186880432-186880454 TTAGTGCAGTGGTTCTAAACTGG + Intronic
918762636 1:188432898-188432920 CTAGTGAACTGGTAGTCAAAAGG - Intergenic
918815868 1:189182018-189182040 CTAAGGCAGTGGTTCTCCATTGG + Intergenic
920333159 1:205226903-205226925 CTAGGCCAGTGGTTCTCAAAGGG + Intergenic
922234207 1:223711206-223711228 CTACAGCAGTGGTTCTCAACTGG - Intronic
1064159344 10:12930605-12930627 CTAGAGCACTGATTCTCAACCGG + Intronic
1064429787 10:15260898-15260920 ATAGTGCAGTGGTTCAGAATTGG - Intronic
1064665497 10:17646383-17646405 CTAGTGCAGCGGTTCTCAACTGG - Intronic
1068403121 10:56555801-56555823 CTAGAATACTGGTTCTCAATTGG - Intergenic
1068764593 10:60749010-60749032 CTAGCACAATGGTTCTCAACTGG + Intergenic
1069238586 10:66109524-66109546 CTTGAGCAATGGTTCTCAAGTGG - Intronic
1069384958 10:67875816-67875838 CTAGATCAGTGGTTCTCAACTGG - Intergenic
1069652379 10:70059216-70059238 CTGGTGCAATGGTTCTCAGGTGG + Intronic
1069691253 10:70354421-70354443 CCAGTGCAGTGGTTCTCCAAGGG + Intronic
1070158334 10:73850382-73850404 CTAGAGCAGTGGTTTTCAACTGG + Intronic
1070273687 10:74983356-74983378 CTAGCCCACTGGTTCTTACTGGG - Intronic
1071445567 10:85743121-85743143 CTAGATAATTGGTTCTCAATGGG - Intronic
1071599805 10:86953529-86953551 TTAGACCAGTGGTTCTCAATGGG + Intronic
1072566656 10:96621966-96621988 CTAAAGCAGTGGTTCTCAATTGG - Intronic
1073302239 10:102477938-102477960 CTAGAGCAGTGGTTCCCAATTGG - Intergenic
1073415131 10:103374774-103374796 TTATTGCAGTGGTTCTCAACTGG + Intronic
1073604044 10:104875820-104875842 CTAGTGCAAAGCTTCACAATGGG + Intronic
1074851087 10:117440193-117440215 CTAGAGAAGTGGTTCTCAACTGG - Intergenic
1075215488 10:120529096-120529118 CTAGGGCAGTGGTTCTCCACTGG + Intronic
1077294383 11:1818463-1818485 CTAGGGCAGTGGTCCTCAACTGG + Intergenic
1078145625 11:8720159-8720181 CTAAAGCAGTGGTTCTCAGTTGG - Intronic
1078287691 11:9974444-9974466 TTAGAGCAGTGGTTCTCAACAGG - Intronic
1079419344 11:20271434-20271456 CTAGGCTAGTGGTTCTCAATGGG + Intergenic
1079435733 11:20447228-20447250 CTAGAACAGTGGTTTTCAATGGG + Intronic
1080948594 11:37002963-37002985 CCAGAGCAGTGGTTTTCAATTGG + Intergenic
1081102926 11:39027587-39027609 TTAGAGCAATGGTTCTCAATGGG + Intergenic
1081202541 11:40234938-40234960 TTAGTACGGTGGTTCTCAATGGG - Intronic
1081688309 11:45057977-45057999 CTAGAGCAGTGGTTCCCAACTGG - Intergenic
1084603810 11:70161465-70161487 CCAGCTCCCTGGTTCTCAATGGG + Intronic
1086473129 11:87138874-87138896 CTAGAGCAGTGGTTCTTAATTGG + Intronic
1086882214 11:92162054-92162076 CTAGGGCAATGTTTCTCAAAAGG - Intergenic
1086916135 11:92532002-92532024 TTAGTGCAATGGTTCTCAATGGG - Intronic
1086941593 11:92803806-92803828 CTGGGGCAGTGGTTCTCAACTGG - Intronic
1088122839 11:106390067-106390089 CTAAAGCTCTGGTTCTCAATGGG - Intergenic
1088328442 11:108626008-108626030 CTAGAGTGGTGGTTCTCAATTGG + Intergenic
1088349049 11:108864376-108864398 ATAGACCACTGGTTCTTAATGGG - Intronic
1091891210 12:4056062-4056084 CTAGGGAACTGGTTCTGACTTGG + Intergenic
1092468761 12:8759728-8759750 CTAAAGCAGTGGTTCTCAACTGG - Intronic
1092815266 12:12306988-12307010 CTAGAGCAGTGCTTCTCAAATGG - Intergenic
1093146465 12:15572778-15572800 CTAGATCAATGGTTCTCAACTGG + Intronic
1093445296 12:19250123-19250145 CTAGACAAGTGGTTCTCAATTGG - Intronic
1093764638 12:22948888-22948910 CTAGTTAACTGTTTCTCAAGAGG + Intergenic
1094125668 12:27020464-27020486 CTAGACCAGTGGTTCTCAATTGG + Intergenic
1096890544 12:54766451-54766473 CTAGACCAATGGTTCTCAACTGG + Intergenic
1098989869 12:77053564-77053586 CTTGGGCAGTGGTTCTCAAAAGG - Intronic
1099029331 12:77505812-77505834 CTAGTGCAGTGGTTTTCAATTGG + Intergenic
1100001996 12:89848484-89848506 TTAGAGCAGTGATTCTCAATGGG - Intergenic
1100296116 12:93263251-93263273 CTAGGGCAGTGGTTTTCAACTGG + Intergenic
1101339926 12:103834173-103834195 CTGGAGCAGTGGTTCTCAGTGGG - Intronic
1101633420 12:106517308-106517330 CTAGTTCAGTGGTTCTAAACTGG - Intronic
1101930478 12:109009715-109009737 CTAGAGCAGTGGTTTTCAACCGG + Intronic
1102427330 12:112854256-112854278 CTAGAGCAGTGGTTCTCAACAGG - Intronic
1102725403 12:115060072-115060094 CTAGAACAGAGGTTCTCAATGGG + Intergenic
1102897437 12:116609931-116609953 TTAGAGCAGTGGTTCTCAACAGG - Intergenic
1102910919 12:116713213-116713235 CTAGGGCAGTGGTGCTCAACAGG - Exonic
1103129864 12:118458762-118458784 GTAGCCCACTGGTTCTCAACAGG + Intergenic
1103600271 12:122050414-122050436 CTAGGGCACTGGCTCTCAGCAGG - Intronic
1103910892 12:124351529-124351551 ATATGGCAGTGGTTCTCAATTGG - Intronic
1106383267 13:29260758-29260780 CTAGAGCAGTGGTTCTTAATCGG + Intronic
1107674977 13:42786189-42786211 CTAGAATACTGGTTCTCAAACGG - Intronic
1108687879 13:52836540-52836562 ATAGTGCAGTGGTTCTGAAAGGG + Intergenic
1109350737 13:61177972-61177994 TTAGGGCAGTGGTTCTCAACTGG + Intergenic
1109679044 13:65722291-65722313 CTTGTGTAATGGATCTCAATAGG + Intergenic
1110235554 13:73214282-73214304 CACGTGCACTGGCTCTCAAGTGG + Intergenic
1111650203 13:91080945-91080967 TTAGGGCAGTGGTTCTCAATGGG - Intergenic
1111874232 13:93873441-93873463 ATAGAGCAATGGTTCTCAACTGG + Intronic
1112577185 13:100646005-100646027 TTAGGGCAATGGTTCTCAAGTGG - Intronic
1112614581 13:100990322-100990344 CTAGACCAGTGATTCTCAATGGG + Intergenic
1112827725 13:103411352-103411374 CTAGAACAATGGTTCTCAACTGG - Intergenic
1113382250 13:109814429-109814451 TTAGCACAGTGGTTCTCAATTGG + Intergenic
1115030598 14:28788696-28788718 CAATTGCAGTGGTTCTCAACTGG + Intronic
1115053166 14:29089702-29089724 CTGGAGCACTGGTTCTCCACTGG - Intergenic
1115855563 14:37626132-37626154 TTAGGTCAGTGGTTCTCAATTGG - Intronic
1116560310 14:46370282-46370304 TTAGTGCAATGATTCTCAAGGGG + Intergenic
1116749183 14:48861425-48861447 GTAATTCACTGGTGCTCAATGGG - Intergenic
1116971338 14:51069291-51069313 CTAGACCACTGGTTCTCATCTGG + Intronic
1118476613 14:66123328-66123350 CTATTGCCCTGGTTCTTTATGGG - Intergenic
1119268713 14:73281977-73281999 TTAGTGTAGTGGTTCTCAACTGG - Intronic
1120070498 14:80097308-80097330 CTAGTCCAATGGCTCCCAATAGG - Intergenic
1120909574 14:89653810-89653832 CTAGGGCAGTGGTTCTCAAATGG - Intergenic
1122572532 14:102716026-102716048 GTAGAGCAGTGGTTCTCAAATGG - Intronic
1125387139 15:39149868-39149890 CTAGGGCATTGGGTCTAAATTGG + Intergenic
1126204078 15:46022508-46022530 CTAGTGCAATGATTTTCCATAGG + Intergenic
1126417607 15:48434040-48434062 CTAGAGCAGTGGCTCTCAAAGGG - Intronic
1128390435 15:67179241-67179263 CTAGGGCAATGGTTTTCAACTGG + Intronic
1128394889 15:67214568-67214590 CTATGTCAGTGGTTCTCAATTGG - Intronic
1128397531 15:67243432-67243454 CTAAAGCAGTGGTTCTCTATGGG + Intronic
1129042161 15:72697566-72697588 CCAGAGCAGTGGTTCTCAAGTGG - Intronic
1129799567 15:78403815-78403837 ATAATGCAGTGGTTCTCAACTGG + Intergenic
1129817826 15:78570984-78571006 CTAGAGAAGTGGTTCTCAAGGGG - Intronic
1129854908 15:78816621-78816643 CTAGAACAGTGGTTCTCAAGCGG + Intronic
1129945794 15:79538529-79538551 CTAGGGCAGTGGTTCTCAACTGG + Intergenic
1130835865 15:87649447-87649469 CTAGACCAGTGGTTCTCAACTGG + Intergenic
1130870419 15:87967017-87967039 CTCCTGCACTGGTTTTCAATTGG - Intronic
1131305292 15:91237426-91237448 CTAGTGCAGTGGTTGTCAACTGG - Intronic
1131421726 15:92311980-92312002 CTAGTCCAGTGGTTCTTAACTGG + Intergenic
1132075814 15:98818835-98818857 CTGGTCCAGTGGTTCTCAACAGG - Intronic
1133406759 16:5530756-5530778 CTAGAGCAGTGCTTCTCAACTGG - Intergenic
1133474817 16:6110706-6110728 CCAGAGCAGTGGTTCTCAATGGG + Intronic
1133507294 16:6424391-6424413 ATATTGCAGTGGTTATCAATAGG + Intronic
1133661199 16:7919522-7919544 CTAGACCAGTGGTTCTCAACTGG - Intergenic
1133882695 16:9797935-9797957 CTAGGGCAGTGGTTCTCAAAGGG - Intronic
1134135398 16:11673662-11673684 CTTGTTCAGTGGTTCTCAACTGG - Intronic
1134372791 16:13641112-13641134 CTAGACCAATGGTTCTCAACTGG + Intergenic
1134567403 16:15263371-15263393 CTACAACACTGGTTCTCAACTGG - Intergenic
1134735089 16:16493329-16493351 CTACAACACTGGTTCTCAACTGG + Intergenic
1134816739 16:17212047-17212069 CTAGAACAGTGGTTCTCAACTGG - Intronic
1134830865 16:17321674-17321696 TTAGAGCAGTGGTTCTCAATCGG + Intronic
1134932432 16:18218888-18218910 CTACGACACTGGTTCTCAACTGG - Intergenic
1135029305 16:19025234-19025256 CTAGAGCAGTGGTTCTCATCTGG - Intronic
1135080237 16:19427814-19427836 CTAGAGCAGTGGTTCTCAAGTGG - Intronic
1135422388 16:22313934-22313956 CTAAGCCAGTGGTTCTCAATCGG - Intronic
1135464883 16:22676688-22676710 CTAATTCAGTGGTTCTCAGTCGG - Intergenic
1135718672 16:24795391-24795413 TTAGAGCACTGGTTCTTAAGAGG + Intronic
1135885763 16:26305766-26305788 CTAGAGCAGTGGTTCTCAAACGG - Intergenic
1137294050 16:47073333-47073355 CTATAGCAGTGGTTCTCAACTGG + Intergenic
1137763123 16:50956617-50956639 CTACAGCAGTGGTTCTCAACTGG - Intergenic
1137864355 16:51877750-51877772 TTAGGGCAGTGGTTCTCAATTGG + Intergenic
1138090349 16:54168705-54168727 CTAGAGCAGTGGTTCTCAACAGG + Intergenic
1138197178 16:55060330-55060352 CTAGCCCAGTGGTTCTCAACAGG + Intergenic
1139646170 16:68332394-68332416 TTAGAGCAGTGGTTCTCAACAGG - Intronic
1139892885 16:70265403-70265425 CTAGATCAGTGGTTCTCAAGTGG - Intronic
1140226770 16:73083939-73083961 CTAGGGCCATGGTTCTCAACTGG + Intergenic
1140251889 16:73301586-73301608 CTAGGCCAGTGGTTCTCAACTGG - Intergenic
1140930354 16:79622073-79622095 GTAGAGCAGTGGTTCTCAACTGG - Intergenic
1140933495 16:79649894-79649916 CTCCAGCAGTGGTTCTCAATTGG + Intergenic
1141284612 16:82659958-82659980 CTAAAGCAGTGGTTCTCAATGGG - Intronic
1143691029 17:8566171-8566193 CTAGGTCAGTGGTTCTTAATTGG - Intronic
1145103755 17:20097998-20098020 CTAGAACAATGGTTCTCAATGGG - Intronic
1146803880 17:35849692-35849714 CTAAGGCAGTGGTTCTCAACAGG - Intronic
1147558030 17:41491911-41491933 ATAGTCCAATGGTTCTCAACTGG - Intronic
1149174418 17:53852870-53852892 AGAGAACACTGGTTCTCAATAGG - Intergenic
1149607138 17:57933066-57933088 CTAGTGCAGTGGTTCACAAGTGG - Intronic
1149689804 17:58565884-58565906 CTAGAGCAGTGGTTCTCCAAGGG + Intronic
1150360214 17:64525606-64525628 TTGGTGCACTGGGTGTCAATAGG + Intronic
1151075858 17:71271855-71271877 CTAGTGCAGTGGTTCTCAGCTGG + Intergenic
1153873606 18:9344721-9344743 AAAGAGCACTGGTTTTCAATAGG - Intronic
1154240867 18:12653060-12653082 CTAGAGCAGTGGTTCTCAACTGG + Intronic
1156541764 18:37919026-37919048 CTACATCACTAGTTCTCAATGGG - Intergenic
1157532696 18:48435066-48435088 CTAATGCTCTGGTTTTCAGTGGG - Intergenic
1157796269 18:50578477-50578499 CTAGACCAGTGGTTCTCAAATGG - Intronic
1158325742 18:56312421-56312443 CTAGTGCACTCGTTATTACTAGG - Intergenic
1158463187 18:57665117-57665139 CTAGTGCAGTGATTCTCCGTGGG - Intronic
1158728223 18:59994306-59994328 CTCTTGCACAGTTTCTCAATGGG + Intergenic
1159022737 18:63156502-63156524 CTAAGGCAGTGGTTCTCCATGGG - Intronic
1160584868 18:79907671-79907693 CTAGGGCATTGGTTCCCAAATGG + Intronic
1162219255 19:9162100-9162122 CTACAGCACGGGTTCTCAGTCGG + Exonic
1166417185 19:42604401-42604423 CTAGGTCAATGGTTCACAATTGG + Intronic
1166609953 19:44182454-44182476 CTATAACACTGGTTCTCAGTTGG - Intergenic
1167069057 19:47209058-47209080 CTAGGGCAGTGGTTCTTAACTGG - Intronic
1167854657 19:52227770-52227792 CTAGAGCAGTAGTTCTCAACTGG - Exonic
1168358963 19:55722102-55722124 CTAGCTCAGTAGTTCTCAATGGG - Intronic
925568546 2:5283913-5283935 CTAGAGCAGTGGTTCTCAACTGG - Intergenic
925650362 2:6082932-6082954 GCAGTGCACAGGCTCTCAATGGG + Intergenic
926946987 2:18199156-18199178 CTAGTACCGTGGTCCTCAATAGG + Intronic
927757521 2:25721043-25721065 CTAAAGCAGTGGTTCTCAAGAGG + Intergenic
928227474 2:29464634-29464656 GTAGGGCAGTGGTTCTCAACAGG + Intronic
929370557 2:41219235-41219257 TTAATGCAGTGGTTCTCAACTGG - Intergenic
929392060 2:41480921-41480943 TTAGGACAATGGTTCTCAATTGG - Intergenic
929849931 2:45577134-45577156 CTAGAGCAGTGGTTCTCAATGGG + Intronic
930174617 2:48289026-48289048 CTAGGGCATTGTTTCTCAAGCGG + Intergenic
930353475 2:50288202-50288224 CTAAAGCAGTGGTTGTCAATTGG + Intronic
930538447 2:52673395-52673417 CTAAAGCAATGGCTCTCAATAGG - Intergenic
931112068 2:59122052-59122074 CTAGGCCAGTGGTTCTCAACTGG + Intergenic
932189572 2:69729435-69729457 ATAGAGCAGTGGTTCTCAATGGG + Intronic
936937479 2:117852158-117852180 CTAGATCAATGGTTCTCAACTGG + Intergenic
937107955 2:119336509-119336531 CTAGGGCTGTGATTCTCAATGGG + Intronic
939979031 2:148756883-148756905 CTAGGGAAGTGGTTCTCAAATGG - Intronic
940584096 2:155622202-155622224 GTAGTTCAGTGGTTCTCAATAGG + Intergenic
940747597 2:157586210-157586232 CAAGTACACTGGTTTTTAATTGG + Intronic
941358815 2:164525931-164525953 CTATTGCAGTGGTTCTTAACTGG - Intronic
941733550 2:168946813-168946835 CTGGTGCAGTGGTTTTCTATTGG + Intronic
942019870 2:171856432-171856454 CTAGAGCAGTGGTTCTCAATAGG - Intronic
942934148 2:181533628-181533650 CTAGAGCAGTGGTTCTCAGCAGG - Intronic
943008108 2:182411627-182411649 CTAAATCAATGGTTCTCAATTGG + Intronic
943641624 2:190365237-190365259 CTTATGTTCTGGTTCTCAATGGG + Intronic
943737523 2:191373201-191373223 CTATTTCAGTGGTTCTCAAATGG + Intronic
944509064 2:200446424-200446446 CCACAGCAGTGGTTCTCAATGGG + Intronic
944513270 2:200485211-200485233 TTAGAGCAATGGTTCTCAACTGG + Intergenic
944514478 2:200498649-200498671 CTAGTGCAGTGGTTCTCAACTGG - Intronic
944528275 2:200642219-200642241 CTAATGTATTGGTTCTCAATGGG - Intronic
944543697 2:200778564-200778586 CTAGAACAGTGGTTCTCAACTGG + Intergenic
944773823 2:202941279-202941301 CTACTACAGTAGTTCTCAATTGG - Intronic
945005852 2:205405179-205405201 CTAGAACAGTGGTTCTCAATGGG + Intronic
945156235 2:206841916-206841938 GTAGGGCAGTGGTTCTTAATTGG + Intergenic
947755480 2:232560885-232560907 CTTGTGCACTGGTTCATATTTGG + Intronic
948413339 2:237781898-237781920 TTACAGCAGTGGTTCTCAATGGG - Intronic
1169161267 20:3380611-3380633 CTAGTGCAGTAGTTCCCAACTGG - Intronic
1170913322 20:20596953-20596975 TTAGAGCAGTGATTCTCAATTGG - Intronic
1172179448 20:32992284-32992306 CTAAATCAGTGGTTCTCAATTGG - Intronic
1172683395 20:36734835-36734857 TTAGAGCAGTGCTTCTCAATTGG - Intronic
1173080685 20:39864244-39864266 GTAATGCATTGGTTCTCACTTGG - Intergenic
1173554655 20:43957254-43957276 CTAGTTCACTGTTCCTAAATAGG + Intronic
1173865749 20:46311712-46311734 CTAGAGCAGTGGCTCTCAACTGG - Intergenic
1174443011 20:50570891-50570913 CTAGAGCGGTGGTTCTCAACCGG - Intronic
1174647768 20:52100972-52100994 CTAGTCCAGTGGCTCTCAACTGG + Intronic
1174668895 20:52287113-52287135 CTATAGCAGTGGTTCTCAATGGG - Intergenic
1174684187 20:52437850-52437872 CTAGTACAGTGGTTCTCAAGTGG - Intergenic
1174703782 20:52635422-52635444 CTAGTATACAGGTTCTCAACTGG - Intergenic
1174754872 20:53148231-53148253 CTAGAACAGTGGTTCTCAACTGG + Intronic
1175122048 20:56723308-56723330 CTAGTCCAAAGGTTCTCAACAGG - Intergenic
1175223973 20:57434071-57434093 CTAGGGCACTGGCTCTCCACTGG + Intergenic
1175721842 20:61292446-61292468 CTAGTCTAGTGGTTCTCAAAGGG + Intronic
1175792649 20:61751347-61751369 GTAGTTCAGTGGTTCTCAAAAGG - Intronic
1177888303 21:26773368-26773390 CTAATTCAGTGGTTCTCAACTGG - Intergenic
1177953403 21:27567206-27567228 CTGGAGCACTCTTTCTCAATTGG + Intergenic
1178083927 21:29094085-29094107 CTAGGGCAATGGTTCTCAACTGG + Intronic
1178754193 21:35332383-35332405 CGAGAGCAATGGTTCTCAAGAGG + Intronic
1178812494 21:35896872-35896894 CTAGTGCAGTGGCTCTCAACTGG + Intronic
1178847155 21:36183324-36183346 CTACAGCAGTGGTTCTCAACTGG - Intronic
1179653595 21:42831276-42831298 CTAGTGCCCTGGTTCTCATCGGG - Intergenic
1180643510 22:17318706-17318728 CTGGTGCAGTGGTTTTCAACTGG + Intergenic
1180692380 22:17727950-17727972 CTAAAGCAGTGGGTCTCAATAGG - Exonic
1182054228 22:27337354-27337376 CTAGTGCCATGGTTGTCAATTGG - Intergenic
1182243698 22:28937689-28937711 CTAGATCAGTGGTTCTCAAAGGG - Intronic
1182647600 22:31822916-31822938 ATAGAGCACTGTTTCTAAATAGG - Intronic
1182779430 22:32855815-32855837 CTAATACAGTGGTTCTCAACTGG - Intronic
1182886090 22:33775481-33775503 CTAAGTCAGTGGTTCTCAATAGG + Intronic
949348249 3:3097503-3097525 CTGGTGCAGTGATTCTCAACTGG + Intronic
949558141 3:5176817-5176839 CTACATCAGTGGTTCTCAATGGG + Intronic
950406100 3:12805955-12805977 CTATAGCACTGGTTCCCACTAGG - Intronic
951551278 3:23877615-23877637 TTAGAGCAGTGGTTCTCAACTGG - Intronic
951563457 3:23989880-23989902 CTAGTACAGTGGTTCTCAAAGGG + Intergenic
952223926 3:31354109-31354131 CTAGAGCAGTGGTTCTCAACTGG + Intergenic
952521870 3:34168942-34168964 CTAGGGCAGTGGTTCTGAACTGG + Intergenic
955531080 3:59873743-59873765 CTAGACCAGTGGTTCTCAGTTGG - Intronic
955761770 3:62292617-62292639 TTAGAGCAGTAGTTCTCAATTGG + Intronic
955804817 3:62722988-62723010 CTAGATCAGTGGTTCTCAACTGG - Intronic
955867700 3:63402360-63402382 TTAGAGCAGTGGTTCTCAACTGG - Intronic
955951159 3:64243436-64243458 CTAGACCACTGGTTCCCAAGGGG - Intronic
956001397 3:64733744-64733766 CTAGTACTGTGCTTCTCAATAGG - Intergenic
956452718 3:69390362-69390384 CTAGTTCAATGGTTCTCAACCGG + Intronic
956707930 3:72015385-72015407 CTAGTCCAGTGATTCTCAACTGG - Intergenic
956734714 3:72229385-72229407 CTAGGGCAGTGGTTTTCAACCGG - Intergenic
959425579 3:106183608-106183630 CTAGTGCACCATTTATCAATCGG + Intergenic
959983155 3:112541012-112541034 CTAATGCAGTGATTCTCAACTGG + Intronic
960170854 3:114459345-114459367 CTTGACCACTGGTTCTCAAAAGG - Intronic
960705076 3:120473873-120473895 CTAGACCAGTGGTTCTCAACCGG - Intergenic
962396875 3:135023522-135023544 CTATTGCACTGATTCTCAACAGG - Intronic
963574497 3:147042859-147042881 TTAATTCAGTGGTTCTCAATAGG - Intergenic
964107268 3:153052623-153052645 CTAAAGCAATGGTTCTCAAAGGG - Intergenic
964215763 3:154279684-154279706 CTTGGGCAGTGGTTCTCAACTGG - Intronic
964723867 3:159794463-159794485 CTAATGCAGTGATTCTCAACAGG + Intronic
964914786 3:161827592-161827614 CTAGTATAATGTTTCTCAATTGG - Intergenic
967664931 3:192159669-192159691 CTAGGGCAGTGGTTGTCAAGCGG + Intronic
967671618 3:192242457-192242479 CTACTTCAGTGGTTCTCAACTGG - Intronic
967706426 3:192656458-192656480 CTAGTGCAGTGGTTCTCAGCCGG + Intronic
969185740 4:5473034-5473056 CTAAAGCACTGGCTCTCAACTGG - Intronic
970560821 4:17280559-17280581 CTGGGACACTGGTTCTCAATGGG - Intergenic
971598690 4:28566120-28566142 GAAATGCACTGCTTCTCAATTGG - Intergenic
973283384 4:48386390-48386412 CTTGAGCACTGGATCTCAATAGG + Intronic
973980776 4:56306613-56306635 CTAGAGCAGTGGTTCTCAGCTGG + Intronic
974237743 4:59204214-59204236 AGAGTGCAGTGGTTCTCAAGAGG - Intergenic
974882163 4:67773366-67773388 CTAGTGTAGTGGTTCTCAATGGG + Intergenic
975540341 4:75503253-75503275 CCAGAGCACTGGTTCTCAACTGG - Intronic
977007627 4:91590991-91591013 TTAGGGCAGTGGTTCTCAACTGG + Intronic
977265962 4:94854831-94854853 CTAGAGCAGAGGTTCTCAAGGGG - Intronic
977595069 4:98870001-98870023 CTATAGGACTGGTTTTCAATGGG + Intergenic
979529262 4:121751501-121751523 CTTTTGCAGTGGTTCTCAAGGGG - Intergenic
980027923 4:127788613-127788635 CTAGGGCAGAGGTTCTCAACTGG + Intronic
981435064 4:144710622-144710644 CTAGAACAGTGATTCTCAATGGG + Intronic
981715501 4:147747890-147747912 CTAGACCAGTGGTTCTCAAATGG + Intronic
982653556 4:158118254-158118276 CTAAAGCAGTGGTTCTCAACTGG + Intergenic
983620314 4:169754687-169754709 CTAGAGCAGTGGTTCTCAACCGG + Intronic
984597200 4:181683579-181683601 CTAGTGCATAGGTTCTCAAAGGG - Intergenic
986130816 5:4928309-4928331 CTGGAGCACTTGTTCTCAACCGG - Intergenic
986445037 5:7814300-7814322 TTAGTGCAGTGATTCTCAACTGG + Intronic
986770481 5:10968408-10968430 CTAGAGTAGTGGTTCTCAACTGG + Intergenic
986813915 5:11387193-11387215 CTAGAGCAGTGGTTTTCAAAGGG + Intronic
986888195 5:12266397-12266419 CTAAAGCATTGGTTCTCAACTGG + Intergenic
987076593 5:14388207-14388229 CTAATCCAGTGGTTCTTAATTGG + Intronic
990166881 5:53004190-53004212 TTAGTGCAGTGGTGCTCAACTGG - Intronic
990609694 5:57444805-57444827 CTAGAGCAGTGGTTCTCAGCTGG - Intergenic
992028556 5:72696589-72696611 CTAGGTCAGTGGTTCTCAATGGG - Intergenic
993493816 5:88585682-88585704 CTATTGCATTGGGTCTCAAAGGG + Intergenic
998843174 5:146277964-146277986 CTAAAGCAGTGGTTCTCAATTGG - Intronic
998880149 5:146637253-146637275 CTAGATCAGTGGTTCTCAACTGG + Intronic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
999486307 5:152000211-152000233 CTATGGCAATGGTTCTCAACTGG + Intergenic
999626386 5:153525181-153525203 CTAGTGCAGTGATTCTCAGCTGG + Intronic
1000253276 5:159514896-159514918 CTAGGGCAGTGGTTCTGAGTTGG + Intergenic
1000307601 5:160009545-160009567 CTACAGCAGTGGTTCGCAATTGG + Intronic
1000363763 5:160472268-160472290 CCAGAGCAGTGGTTCTCAACTGG - Intergenic
1000599859 5:163259611-163259633 CTGTGGCAGTGGTTCTCAATGGG + Intergenic
1000904850 5:166952667-166952689 ATAGAGCAGTGGTTCTCAACTGG - Intergenic
1001127064 5:169029329-169029351 CTAGTTCATTTGTTCTCAAAGGG + Intronic
1001218342 5:169876692-169876714 CTATGTAACTGGTTCTCAATGGG - Intronic
1001454538 5:171850650-171850672 TTAAAGCAGTGGTTCTCAATGGG + Intergenic
1001461480 5:171918900-171918922 CTAGAGCACTGGTTTTCAAGTGG - Intronic
1001693728 5:173653839-173653861 TTAGTGCACTGGTTTTGAGTTGG + Intergenic
1002618920 5:180472706-180472728 ATAGTGCAGTGGTTCTCAGTTGG + Intergenic
1003030547 6:2597023-2597045 CTGGTGCAGTGGTTCTCAGCCGG - Intergenic
1004119240 6:12803891-12803913 TTAGAGCACAGGTTCTCAAATGG - Intronic
1005244160 6:23862384-23862406 CTAGTGCACTGGTTTTGTGTTGG - Intergenic
1006028988 6:31165461-31165483 TTGGTGCAGTGGTTCTCAGTGGG - Intronic
1007914906 6:45552374-45552396 CTAGCTAAGTGGTTCTCAATCGG - Intronic
1008158615 6:48049093-48049115 CCAGAGCAGTGGTTCTCAACAGG + Intronic
1008418235 6:51267876-51267898 CTAGTTCAGTGGTTCTGAATTGG - Intergenic
1008762403 6:54868386-54868408 CAAGTTCAGTGGTTCTCAAAAGG - Intronic
1008968681 6:57341205-57341227 CTAGTTCAGTGATTCTCAGTGGG + Intronic
1009157663 6:60243023-60243045 CTAGTTCAGTGATTCTCAGTGGG + Intergenic
1009821656 6:68810333-68810355 CCAGGGCAATGGTTCTCATTTGG - Intronic
1009892281 6:69700581-69700603 CTAGAGCAGTGGTTCTTAAATGG - Intronic
1010374490 6:75150899-75150921 CTAATGCAGTGATTCTCAACTGG + Intronic
1010392773 6:75356075-75356097 CTAGAACAGTGGTTCTCAATTGG - Intronic
1010625502 6:78132961-78132983 CCATTGCAGTGGTCCTCAATGGG - Intergenic
1011388095 6:86819499-86819521 CTAAATCAGTGGTTCTCAATTGG + Intergenic
1011552817 6:88545492-88545514 CTAGCTCAGTGGTTCTCAACAGG + Intergenic
1012195751 6:96340029-96340051 CTAATGCAGTGGTTCTTAACTGG - Intergenic
1012272181 6:97226964-97226986 CTAGTTCAGTAGTTCTCAACTGG - Intronic
1013109944 6:107056918-107056940 CTAATGCAGTGGTTCTCAACTGG - Intergenic
1013152225 6:107457631-107457653 CTAGAGCACTGGTTCTCAACTGG - Intronic
1013221891 6:108085020-108085042 ATAGGCCAATGGTTCTCAATGGG + Intronic
1014119769 6:117711503-117711525 CTAGTGCAGTGGTTCTCACCTGG + Intergenic
1014125471 6:117772046-117772068 CTAGGGCAATTGTTCTCAACAGG - Intergenic
1014491168 6:122063933-122063955 CTAGACCAGTGCTTCTCAATAGG + Intergenic
1015252336 6:131140126-131140148 CTGGAGCAGTGGTTTTCAATTGG + Intronic
1015891541 6:137974762-137974784 CTAAAACACTGGTTCTCAAATGG + Intergenic
1016592478 6:145761852-145761874 CTAGAGCAGTGATTCTCAATAGG - Intergenic
1017256619 6:152340596-152340618 CTAGCGCAGTGGTTCACAACTGG - Intronic
1018047052 6:159974792-159974814 GTAGGCCAGTGGTTCTCAATTGG - Intronic
1018431808 6:163728820-163728842 CTAGCCCAGTGGTTCTCAACTGG + Intergenic
1018591089 6:165423523-165423545 CTAGGTCAGTGCTTCTCAATAGG - Intronic
1018740369 6:166723577-166723599 CGAGGGCACTGTTTCTCAGTTGG + Intronic
1019653904 7:2177275-2177297 CTAGGCCACTGGTTCTCAAGTGG + Intronic
1020555171 7:9662012-9662034 CTAGTTCACTAGTTCACTATTGG - Intergenic
1021936245 7:25635046-25635068 CTAAAGCAGTGGTTCTCAACCGG + Intergenic
1022419557 7:30207599-30207621 CGAGTGCACTGCTGCTCATTTGG + Intergenic
1022524907 7:31030622-31030644 CTAGAACAATGATTCTCAATCGG + Intergenic
1022769959 7:33459268-33459290 CTAGAGCTGTGGTTCTCAATTGG + Intronic
1022828321 7:34039355-34039377 CTAGTACTCTAGTTCTCAACTGG + Intronic
1023082423 7:36537886-36537908 CTAGGCCAGTGGTTCTCAACTGG - Intronic
1023225493 7:37964783-37964805 CTAGAGCAGTGGATCTCAAACGG + Intronic
1023583709 7:41707291-41707313 CTACAGCAGTGGTTCTCAACCGG + Intergenic
1024924551 7:54599329-54599351 TTAGAGCAGTGGTTCTCAACTGG + Intergenic
1024935270 7:54705739-54705761 TCAGAGCACTGGTTCTCAAATGG + Intergenic
1027546505 7:79533319-79533341 CTAGTTCTGTGGTTCTCAATTGG - Intergenic
1027777854 7:82488817-82488839 CTATTGTACTGGTTTTCAAAGGG + Intergenic
1028088624 7:86669308-86669330 TTAGTGTAGTGTTTCTCAATTGG - Intronic
1028710552 7:93902996-93903018 ATAGATCCCTGGTTCTCAATGGG - Intronic
1030014621 7:105206236-105206258 CTAGTGCACTGGTTCTCAATGGG - Intronic
1030045417 7:105490794-105490816 CTAGACCAGTGGTTCCCAATCGG + Intronic
1030979307 7:116167362-116167384 CCACTGCTCTGGCTCTCAATGGG + Intergenic
1032935749 7:136729490-136729512 TTAGTGCACTGGTTTTATATTGG - Intergenic
1033166711 7:139045249-139045271 CTAGTTCAGTGGTTTTCAATGGG - Exonic
1033677819 7:143561184-143561206 CTAGTGCACTGGCTAAAAATAGG + Intergenic
1033694017 7:143768253-143768275 CTAGTGCACTGGCTAAAAATAGG - Intergenic
1034109709 7:148524833-148524855 CAAGTCCACTGGCTCTCAAGAGG - Intergenic
1034111640 7:148543022-148543044 CTAGAGCTCTGGCTCTCACTGGG + Intergenic
1036616101 8:10388947-10388969 CTAGTTCAGTGATTCTCAACTGG - Intronic
1036616314 8:10390380-10390402 CTAGGTCAGTGGTTCTCAACTGG - Intronic
1036920103 8:12844237-12844259 CTAGAGCAGTGGTTCTCAGAGGG - Intergenic
1037408149 8:18565779-18565801 CTAAAGCAGTGGTTCTCAATAGG + Intronic
1037853224 8:22349957-22349979 TTAGTGAAGTGGTTCTCAACTGG + Intronic
1043000959 8:74759098-74759120 CTAGGTCACTGGGTCTCACTTGG + Intronic
1045061578 8:98415969-98415991 CTAGGGCACTTGTACTCCATGGG + Intronic
1045492904 8:102683912-102683934 CTACGGCAGTGGGTCTCAATTGG + Intergenic
1046608864 8:116402254-116402276 CTTGACCAGTGGTTCTCAATTGG - Intergenic
1046779840 8:118203302-118203324 TTAGAGCACTGGTTCTCAACTGG + Intronic
1047206068 8:122803649-122803671 TTAGTCCACGGGTTCTCCATGGG - Intronic
1047564747 8:126031767-126031789 CTAGAGCAGTGGTTATCAACCGG - Intergenic
1049928713 9:434999-435021 TTAGAGCAGTGGTTCTCAACTGG + Intronic
1051235696 9:14996289-14996311 CTAGAGCAGTGGTTCTCAACTGG - Intergenic
1051553868 9:18360695-18360717 TAAGTGCAGTGTTTCTCAATAGG - Intergenic
1052303883 9:26983380-26983402 CTAGAGCAGTGGTTCTCAACTGG + Intronic
1053256687 9:36623221-36623243 GTAGGGCACTGGTGCTCAACTGG - Intronic
1056261287 9:84851199-84851221 CTAGGTCAGTGGTTCTCAAACGG - Intronic
1057401801 9:94729798-94729820 CTATGGCAGTGGTTCTCAATTGG - Intronic
1057423560 9:94930613-94930635 CTAGTGCCCTGGTTTTCTCTGGG - Intronic
1057431499 9:94998745-94998767 CTAGTGCTCTGTTTCACAGTAGG + Intronic
1057998743 9:99844221-99844243 CTGGGGCAGTAGTTCTCAATTGG + Intronic
1058428324 9:104895539-104895561 CTAGAGCAGTGGTTCTCGACCGG - Intronic
1058807555 9:108606973-108606995 CTGGAGCACTGGTTCTTAACTGG - Intergenic
1059135491 9:111802883-111802905 CTAGACCAGTGGTTCTCAATTGG + Intergenic
1059396456 9:114037018-114037040 CTAGAGCAGTGGTTCTCAAAGGG - Intronic
1060955340 9:127634881-127634903 CTAGTCCAGTGGTTCTCAACAGG - Intronic
1186273433 X:7915224-7915246 CTACAGCACTTGTTCTCAACTGG + Intronic
1186522385 X:10217528-10217550 TTAGAGCAATGGTTCTCAACTGG - Intronic
1186601284 X:11040495-11040517 CTAGCTCAGTGGTTCTCAACTGG + Intergenic
1186732537 X:12425552-12425574 CTCATGCATTGGTTCTCAACCGG + Intronic
1186876619 X:13824251-13824273 CTAAGGCAATGGTTCTCAACTGG - Intronic
1187007168 X:15243828-15243850 CTAGTTCAGTGGTTCTCCACTGG - Intronic
1187861612 X:23688919-23688941 CTGGAGCAGTGCTTCTCAATGGG + Intergenic
1188024358 X:25193335-25193357 CTAGAGCAGCGGTTCTCAACTGG - Intergenic
1189719031 X:43896004-43896026 CTAGAGCAGTGGTTCTCAATAGG - Intergenic
1190363632 X:49671614-49671636 CTAAGGCAATGGTTCTCAAAGGG - Intergenic
1194446847 X:93998442-93998464 GTCTTGCACTGGTTTTCAATGGG + Intergenic
1195574302 X:106432555-106432577 CTAGAGCAATGGTTCTCAACTGG - Intergenic
1196165079 X:112529875-112529897 CTAGAGCAGTAGTTCTCAATGGG + Intergenic
1197393301 X:125895346-125895368 TTAGTGCACTGGTTTTGTATTGG + Intergenic
1198675112 X:139123072-139123094 TTAGGGCAGTGGTTCTCAACGGG - Intronic
1199778424 X:151036060-151036082 CTAATGCAGTGGTTCTCAAGGGG - Intergenic