ID: 1030015767

View in Genome Browser
Species Human (GRCh38)
Location 7:105219154-105219176
Sequence CACTGGAGGTGTGGGAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 353}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030015767_1030015775 13 Left 1030015767 7:105219154-105219176 CCCACACTCCCACACCTCCAGTG 0: 1
1: 0
2: 2
3: 35
4: 353
Right 1030015775 7:105219190-105219212 ATCTTTTCCAAGGCAGAAGACGG No data
1030015767_1030015774 3 Left 1030015767 7:105219154-105219176 CCCACACTCCCACACCTCCAGTG 0: 1
1: 0
2: 2
3: 35
4: 353
Right 1030015774 7:105219180-105219202 CCAGATCACAATCTTTTCCAAGG No data
1030015767_1030015777 23 Left 1030015767 7:105219154-105219176 CCCACACTCCCACACCTCCAGTG 0: 1
1: 0
2: 2
3: 35
4: 353
Right 1030015777 7:105219200-105219222 AGGCAGAAGACGGAACATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030015767 Original CRISPR CACTGGAGGTGTGGGAGTGT GGG (reversed) Intronic
901439262 1:9267594-9267616 CAGAGTGGGTGTGGGAGTGTGGG + Exonic
903137147 1:21317056-21317078 GACTGGGGGTGTGGGGGTATGGG + Intronic
903786957 1:25867753-25867775 CTCTGGAGATGTGGGCTTGTGGG - Intronic
904365375 1:30007799-30007821 CACTGAAGGTGAGGCAGTGCTGG - Intergenic
904611918 1:31730785-31730807 CCCTGGAGGTGAGGGGCTGTAGG - Exonic
904659786 1:32075801-32075823 CCAGGGAGGTGTGGGAGGGTGGG - Exonic
907396853 1:54196956-54196978 GACTAGATGTGAGGGAGTGTGGG + Intronic
909089644 1:71209230-71209252 CCCTGAAGGTGAGGGAGTGCAGG - Intergenic
909415628 1:75402717-75402739 CCCTGGTGGTGTGGTGGTGTAGG - Intronic
910313584 1:85856679-85856701 CAGTGGAGGTGGGGAAGAGTAGG - Intronic
910546571 1:88425404-88425426 GCCTGGAGTTGTGGGAGTGATGG - Intergenic
915099380 1:153487876-153487898 CAGGGGATGTGGGGGAGTGTGGG + Intergenic
915590196 1:156866365-156866387 GGCTGGGGGTGTGGGGGTGTGGG + Intronic
915951070 1:160190336-160190358 CACTGGAGGAGGGGGAGGGAAGG + Intergenic
916482339 1:165225842-165225864 ACCTGCAGGGGTGGGAGTGTAGG - Intronic
916653455 1:166851607-166851629 CTCTGGAGGTGTAGGTGGGTGGG - Exonic
917441690 1:175074150-175074172 CACTGGAGGTTTGGGGGTTGGGG - Intronic
919775793 1:201193175-201193197 CACTGATGGTGTGGGAGGGGTGG + Intronic
919937813 1:202266191-202266213 GCCTGGAGGTGGGGGAGTGGGGG + Intronic
920038993 1:203083972-203083994 CGATGGAGGTGAGGGAGTGCAGG + Exonic
920108733 1:203572513-203572535 GATTGGAGGTGCGGGTGTGTGGG - Intergenic
921830318 1:219721291-219721313 ACTTGGAGGTGTGGGAGGGTGGG + Intronic
922483475 1:225955664-225955686 CATTAGAGGTATGGGAGTGGGGG + Intergenic
924302857 1:242657593-242657615 CCCTGGAGGTCAGGGAGTTTGGG - Intergenic
1063152914 10:3353090-3353112 CACTGAAGCTGTGTGCGTGTGGG + Intergenic
1064374766 10:14785431-14785453 ATCTGGAGGTCTGGGGGTGTGGG + Intergenic
1065765838 10:29028546-29028568 CAATGGTGGTGTGGTAGTGATGG - Intergenic
1065963194 10:30750737-30750759 TCCTGGGGGTGTGGGGGTGTTGG + Intergenic
1067197451 10:44134461-44134483 CACTGGAGGTGAAGGAGTGAGGG - Intergenic
1067809786 10:49417865-49417887 GTCTGGAGGTGGGGGCGTGTCGG - Intergenic
1067816031 10:49477446-49477468 GACTGGAGGTGAGGAAGTGGAGG - Intronic
1068092614 10:52451400-52451422 CACTGGAGTTGTCTCAGTGTAGG + Intergenic
1068551907 10:58416232-58416254 CACTGAAGGTATGGGAGAGAAGG - Intergenic
1069782717 10:70966919-70966941 TGCTGGAGGTCTGGGAGTGATGG + Intergenic
1070801928 10:79248901-79248923 CACTGGAGCCCTGGGAGGGTGGG - Intronic
1071295534 10:84216819-84216841 CACTGGTAGGGTGGGAGAGTGGG - Exonic
1071525099 10:86353918-86353940 CACTGGAGATGGGGCACTGTTGG + Intronic
1075276815 10:121101362-121101384 TACTGGATGAGTGGGAGTCTAGG - Intergenic
1075639413 10:124054072-124054094 ATCAGGAGGTGGGGGAGTGTGGG - Intronic
1076046344 10:127297073-127297095 CAGAGGAGGGGTGGGAGTGAGGG + Intronic
1076291671 10:129350133-129350155 CAGTGGAGGTGGGGTAGTGGGGG - Intergenic
1076383563 10:130041004-130041026 TCCTGGAGGTCTGGGAGTGCCGG - Intergenic
1076537160 10:131187041-131187063 CATTGGAGGGGTGAGAGAGTGGG - Intronic
1076685495 10:132196764-132196786 CACTGGAGGGTTGGGGGTCTTGG - Intronic
1076697749 10:132255339-132255361 CACCTGAGGAGTGGGAGTGGGGG - Intronic
1076725148 10:132409644-132409666 CAGTAGAGGTGTGGGTGGGTGGG - Intronic
1077861434 11:6184424-6184446 CACTGGAGGTGTAGGAAGGAAGG + Intergenic
1078142364 11:8701761-8701783 CACTGGACGTGAGGCAGTTTAGG - Intronic
1080253352 11:30260949-30260971 TACTGGAGGTGTGAGAGAGTAGG + Intergenic
1080434404 11:32226299-32226321 CCTTGAAGGTGTGAGAGTGTGGG - Intergenic
1081234833 11:40635095-40635117 GCCTGGAGGTATAGGAGTGTTGG - Intronic
1083037802 11:59656655-59656677 TACTTGAGGGGAGGGAGTGTAGG - Intronic
1083661992 11:64255700-64255722 CTCTGGAGGTCGAGGAGTGTGGG - Exonic
1083691405 11:64411149-64411171 CAAGGAAGGGGTGGGAGTGTTGG + Intergenic
1083835056 11:65261272-65261294 GACTGGAGGCTTGGGAGTGAAGG - Intergenic
1084456245 11:69269746-69269768 GAGTGGAGGTGTGGGGGTGTAGG + Intergenic
1084656551 11:70523049-70523071 CATTGCAGGTGTGGGCCTGTGGG - Intronic
1084725347 11:70938225-70938247 CACTGTATGTGTGGGTGTGGTGG + Intronic
1085324123 11:75593696-75593718 CAGGGAAAGTGTGGGAGTGTGGG + Intronic
1085382673 11:76134475-76134497 AAGTGGAGGTGTGGGAAGGTAGG + Intronic
1086162153 11:83733927-83733949 CACTGGAGACTTGGGAGGGTGGG - Intronic
1086643423 11:89188493-89188515 CAATGGAGGAGTGGGAAAGTAGG + Intronic
1086781237 11:90908767-90908789 CACTGGAGCTGGGGAAGTGGAGG + Intergenic
1087235428 11:95712814-95712836 CTCTGGAGGGGTGGGAAGGTGGG - Intergenic
1090049307 11:123363306-123363328 CACTGGTTGTGTGGGTGTGCTGG - Intergenic
1091131848 11:133153172-133153194 TACTGGAGCTGTGGGAGAGACGG + Intronic
1091199393 11:133762431-133762453 CACTGGAGGTGTGTGGGTGAGGG - Intergenic
1091825832 12:3511997-3512019 CACTGGGGCCTTGGGAGTGTGGG + Intronic
1091846448 12:3659740-3659762 CTCTGGAGCTGTGGGTGTGGGGG + Intronic
1093105470 12:15081042-15081064 CACTGGAGAATTGAGAGTGTTGG - Intergenic
1095254270 12:40015612-40015634 CAGTGGAGGAGGGAGAGTGTTGG - Intronic
1097146393 12:56942292-56942314 CACTGGAGGAGGGGGTGTGTTGG + Intergenic
1097147280 12:56950582-56950604 CACTGGAGGGGTGGGTGTGTTGG + Intergenic
1097151147 12:56980905-56980927 CACTGGAGGAGGGGGTGTGTTGG + Intergenic
1098450700 12:70615368-70615390 CAAGGGAGGGGTGGGAGTGCCGG + Intronic
1099797283 12:87415331-87415353 CACCGGGGCTGTCGGAGTGTCGG - Intergenic
1102229130 12:111250246-111250268 CACTTCAGGTGTGGGGGTGGGGG + Intronic
1102814627 12:115854684-115854706 CACTGGAGATTTGGAAGGGTGGG - Intergenic
1103937295 12:124483396-124483418 CTCTGGAGGTGCCAGAGTGTGGG - Intronic
1104768774 12:131346881-131346903 CACTGGAGGTGCCTGAGTCTGGG + Intergenic
1104835369 12:131786713-131786735 CACTGGGGGTGGGGGGGTGGTGG - Intronic
1104879360 12:132059439-132059461 CACTTGATGTGAGGGAGTGCGGG - Intronic
1104996810 12:132663335-132663357 TTGTGGTGGTGTGGGAGTGTGGG - Intronic
1105423356 13:20272598-20272620 CAGTGGAGTTCTGGGAGTGAAGG - Intergenic
1105475709 13:20726629-20726651 CACAGGAGGTGAGGGAGAGAAGG - Intergenic
1105889216 13:24670109-24670131 AAAGGGGGGTGTGGGAGTGTGGG - Intergenic
1107290925 13:38852139-38852161 CACTGAAGGCTTGGGAGGGTGGG - Intronic
1107347446 13:39477114-39477136 CACTAGAGATGGGGGAGGGTTGG - Intronic
1108058075 13:46505105-46505127 CACTGCCGCTGCGGGAGTGTGGG + Intergenic
1108722665 13:53148188-53148210 AACTGGAGGTGTAGGAGTAGGGG + Intergenic
1111784166 13:92766288-92766310 CAGTGGTGGTGTGGGTGGGTGGG - Intronic
1111978100 13:94988638-94988660 CACTGGAGGAGTTGGAGTGAGGG + Intergenic
1112148447 13:96729158-96729180 CATTAGTGGGGTGGGAGTGTGGG + Intronic
1113338523 13:109399849-109399871 GACTGGAGGTAGGGGAGTGAGGG + Intergenic
1114399336 14:22395079-22395101 CAGTGGAGTGGTGGGAGTGGTGG + Intergenic
1114499092 14:23154744-23154766 GCCTGGAGGTGTGGGGGAGTGGG + Intronic
1117349392 14:54866676-54866698 CACTGAAGGTCAGGCAGTGTGGG - Intronic
1117873132 14:60221354-60221376 AACTGGAGGTGGGAAAGTGTGGG - Intergenic
1117875622 14:60248585-60248607 CTCTGGAGGAGTGGGACTCTGGG + Intronic
1118750661 14:68805897-68805919 CATTGGAGGTATGTGTGTGTGGG - Intergenic
1118842596 14:69524315-69524337 CACTGGAGGTGAGGGGCTGCTGG + Exonic
1119914292 14:78382902-78382924 CACTGCAGGAGTGTGTGTGTGGG + Intronic
1120038812 14:79729167-79729189 CACTGGTGGTGTGGGAGACAAGG - Intronic
1120740805 14:88106578-88106600 CACTGGGGATGTGGGCCTGTGGG + Intergenic
1121328263 14:93034264-93034286 GACAGGGGGTGGGGGAGTGTTGG - Intronic
1121683913 14:95817485-95817507 CACTGGAGGCTTAGGAGTGTGGG - Intergenic
1121833884 14:97074861-97074883 TACTGGAGGTGTGGAGTTGTGGG - Intergenic
1123044925 14:105507320-105507342 CACTGGACGTGTGCGGGAGTTGG - Intergenic
1123054856 14:105564490-105564512 GTGTGGATGTGTGGGAGTGTGGG + Intergenic
1123582119 15:21725146-21725168 CACTGCATCTGTGGGTGTGTGGG + Intergenic
1123618769 15:22167742-22167764 CACTGCATCTGTGGGTGTGTGGG + Intergenic
1125549107 15:40531153-40531175 CACTGGAGACTTGGGAGGGTAGG + Intronic
1126183644 15:45810256-45810278 CGCTGGAGGTGGAGGAGGGTTGG - Intergenic
1126215799 15:46153556-46153578 CTCTAGAGGTGTGTGAGTGGGGG - Intergenic
1126679088 15:51186854-51186876 GAATGGAGGTGGGGGTGTGTGGG - Intergenic
1127472065 15:59298967-59298989 CACTGTAGTTGTGGAAGTGGTGG - Intronic
1127862248 15:63004041-63004063 CACTGAAAGTGTGGGAGTGTTGG + Intergenic
1128240988 15:66100846-66100868 CACTGGATGGGTGGGTGGGTGGG + Intronic
1128984051 15:72206512-72206534 AAATGGAGGGGTGGGGGTGTGGG + Intronic
1129265670 15:74391986-74392008 GGCTGGAGGTGTGGGGGTGTGGG - Intergenic
1130912489 15:88280695-88280717 CACTGGGGGTATGGGAGTACTGG - Intergenic
1132085911 15:98908101-98908123 CCCTGGAGGTGTGGGGGAGGAGG - Intronic
1132949031 16:2549991-2550013 CATGGGAGGGCTGGGAGTGTGGG + Intronic
1132965557 16:2652136-2652158 CATGGGAGGGCTGGGAGTGTGGG - Intergenic
1133436269 16:5782638-5782660 TACTGAATGTGTGAGAGTGTGGG + Intergenic
1133745062 16:8680081-8680103 GGCTGGAGGTGGGGGAGGGTCGG - Intronic
1134604082 16:15556309-15556331 CACAGGCAGTGTGGGTGTGTAGG - Intronic
1135665334 16:24330881-24330903 CACTGGAGATCTGTGAGGGTAGG - Intronic
1137365264 16:47854385-47854407 CATTGGAGGTGTGTGTGTGTTGG - Intergenic
1137365272 16:47854457-47854479 CATTGGAGGTGTGTGTGTGTTGG - Intergenic
1137365317 16:47854784-47854806 TGCTGGAGGTGTGTGTGTGTTGG - Intergenic
1137600978 16:49756073-49756095 CACTGGAGGTTTGTGAGTGAGGG + Intronic
1138237123 16:55393568-55393590 CACTGTAGGTGTGGGACTCTTGG + Intronic
1139846104 16:69922645-69922667 CATTGGAGGTGTGGGGTTTTTGG + Intronic
1140359180 16:74330349-74330371 CACGTGAGGTGTTGGAGTTTGGG + Intergenic
1141036854 16:80633995-80634017 CGATGGAGGTTTGGGGGTGTTGG - Intronic
1141733913 16:85839887-85839909 CTGGGGTGGTGTGGGAGTGTGGG + Intergenic
1142638473 17:1271647-1271669 GGCAGGAGGTGTGGGAGCGTGGG + Intergenic
1142673393 17:1498029-1498051 CGCCGGCGGTATGGGAGTGTCGG + Exonic
1143572707 17:7770424-7770446 CGCAGGAGGTGTGGGAGCATGGG - Intronic
1143576846 17:7798813-7798835 CAGTGGGGGTGTGGCAGTGGGGG - Intronic
1143722552 17:8822889-8822911 CACTGAGGGTGTGGGCGTGCAGG + Intronic
1143724908 17:8838057-8838079 CAGTGAGGGTGTGGGAGCGTGGG + Intronic
1145273657 17:21417733-21417755 CAGTGGAGGTATGGGAGGGGTGG - Exonic
1145276984 17:21437398-21437420 CACTGCAGGTTTGGGAGGGAGGG + Intergenic
1145314814 17:21723291-21723313 CACTGCAGGTGTGGGAGGGAGGG + Intergenic
1145389066 17:22441913-22441935 CACTGCAGCTGTGGGACTGAGGG + Intergenic
1145713256 17:26995228-26995250 CACTGCAGGTGTGGGAGGGAGGG + Intergenic
1147320128 17:39640958-39640980 CCCTGGAGAAGTGGGAGTGTAGG - Intronic
1148165509 17:45481654-45481676 CACTGGGGGTGGGAGAGTGGGGG + Intronic
1148713002 17:49695472-49695494 CTCTGGCTGGGTGGGAGTGTGGG + Intergenic
1148857239 17:50585462-50585484 CAGTGGAGAGGTGGGAGTGGGGG + Intronic
1150396736 17:64828370-64828392 CACTGGGGGTGGGAGAGTGGGGG + Intergenic
1150632148 17:66887304-66887326 CATTGGAGTTGTGGGTGGGTGGG - Intergenic
1151952981 17:77365525-77365547 AACTGGAGGTGTTCAAGTGTAGG + Intronic
1152073339 17:78144852-78144874 CACCGGAGGCCTGGGTGTGTTGG - Intergenic
1152302500 17:79503587-79503609 AGCTGGAGATGTGGGAGTTTGGG - Intronic
1152924762 17:83081692-83081714 CTCTGCAGGTGTGTGTGTGTTGG - Intronic
1155082813 18:22427588-22427610 GACTGGAGCTGTGGGTGTTTTGG + Intergenic
1157396435 18:47345579-47345601 CAATGGATGTGTGGGAGAGGTGG + Intergenic
1158506943 18:58055007-58055029 TACTGCAGCTGTGGGAGTGATGG + Intronic
1160844818 19:1161531-1161553 CACTGGGGGGGTGGAAGTGGGGG + Intronic
1160904822 19:1447126-1447148 CACCGGAGGTGGGGGAGGGTGGG - Intronic
1161132527 19:2599528-2599550 CACAGGAGCTGGGGGAGTTTGGG + Intronic
1161275095 19:3411605-3411627 CACTGGAGGGCCGGGAGTGGTGG - Intronic
1163260812 19:16188791-16188813 CACAGGAGGTGAGGGAATGAAGG + Intronic
1163689425 19:18730622-18730644 AACTGCAGGGGTGGGAGTGGAGG - Intronic
1165138430 19:33685192-33685214 CACTGGAGGTGCGTGTGTTTTGG + Exonic
1165596440 19:37014115-37014137 CAATGGAGGGGTGGGGGTGAAGG - Intronic
1165790116 19:38486242-38486264 CTCTGGAGTTTTGGGAATGTGGG - Intronic
1166065608 19:40356654-40356676 CATAGTAGGTGTGGGAGTCTGGG + Intronic
1166666305 19:44682573-44682595 GCCTGCAGGTGTGGGGGTGTGGG - Exonic
1166678606 19:44754336-44754358 CCCTTGAGGTGTGTGTGTGTAGG - Intronic
925435987 2:3837894-3837916 CCCGGGAGGTGAGGAAGTGTGGG + Intronic
926629051 2:15120103-15120125 AACAGGAAGTGTGGGAGGGTGGG + Intergenic
928828636 2:35451178-35451200 CACTGCAGGGGTGTGCGTGTAGG + Intergenic
928993796 2:37264515-37264537 GAGTGGAGGGGTGGGAGGGTGGG + Intronic
930887925 2:56349359-56349381 CACGAGTGGTGTGGGTGTGTTGG + Intronic
932025655 2:68129669-68129691 CAATGGAGGTGGGGGAGGGTAGG + Intronic
932120813 2:69098066-69098088 CAGTGGTTGTGTGGGAGTGGAGG + Intronic
933689464 2:85168481-85168503 CTCAGGTGGTGTGGGGGTGTCGG + Intronic
934473158 2:94574040-94574062 CTCTGGAGGTGGGGAAGTGGGGG + Intergenic
934613366 2:95756505-95756527 GGCAGGAGCTGTGGGAGTGTGGG - Intergenic
934924140 2:98369993-98370015 TCCTGGAGGGGTGGGAGTATTGG - Exonic
936033114 2:109087782-109087804 CCCTGGAGGAGTGGGAGAGCAGG + Intergenic
938310640 2:130286329-130286351 CATTGGAGCTCTGGAAGTGTGGG - Intergenic
939940706 2:148347593-148347615 CACTGGAGGTGGGGAAGTTTGGG - Intronic
940670235 2:156658756-156658778 AACTGGAGGGCTGGGAGTGGTGG - Intergenic
940747756 2:157588588-157588610 CTCAGGAGGTGGGGGAGGGTGGG - Intronic
941161837 2:162044390-162044412 CAGTGTTGGTGTGTGAGTGTTGG + Intronic
941618575 2:167751667-167751689 CAGTGGAGGTGAGGGAGTGGTGG + Intergenic
941701896 2:168612689-168612711 CACTGGGGGATTAGGAGTGTTGG + Intronic
944512108 2:200475092-200475114 CGCTGGAAGGGTGGGAGTGGAGG + Intronic
944793436 2:203157703-203157725 CACTGGAAGGCTGTGAGTGTTGG - Exonic
945067186 2:205957239-205957261 CCCTGCAGGTGTGTGTGTGTGGG + Intergenic
946528667 2:220547795-220547817 CTTTGGAGGTGTGGGGATGTGGG - Intergenic
946725444 2:222657039-222657061 CACTGGGGGTGAGGGGGTGGAGG + Intergenic
946908164 2:224435974-224435996 CCCTGGGGGTGTGGGGGTGGGGG - Intergenic
947548180 2:231027102-231027124 CTCTGGAGGTGGGGGTGTTTGGG - Intergenic
948254873 2:236559671-236559693 CACTGGAGGAGTGGTTATGTGGG - Intergenic
948378505 2:237537813-237537835 CACTGGAGGGCTGGGAGGGAGGG - Intronic
948661019 2:239506431-239506453 CACTCTAGGTCTGGGACTGTGGG - Intergenic
1168796051 20:610553-610575 TGCTGGAGGTCTGGGAGGGTCGG + Intergenic
1169020821 20:2329576-2329598 GGCTGGAGGTGTGGGGATGTAGG + Intronic
1169074834 20:2754129-2754151 CACTGGACTTGAGGGAGGGTTGG + Intronic
1169207712 20:3749487-3749509 CCCTGGAGGAGTGGGAGTTAGGG - Intronic
1170581527 20:17703051-17703073 CACAGGAGGTCTGGGAGTGAAGG - Intronic
1170937493 20:20822871-20822893 CACTGGAGGTGATGGTGAGTAGG + Intergenic
1172515173 20:35528294-35528316 AATTGGAGGTGGGGGAGTTTGGG + Intronic
1173409027 20:42793340-42793362 CACTGGAGGCTTGGAAGAGTTGG - Intronic
1173836005 20:46126206-46126228 TACTGGGGGTGTGGGGGTGGGGG - Intronic
1174525063 20:51164024-51164046 CCCTGGAGGTCTGAGAGTGAGGG - Intergenic
1175106359 20:56617744-56617766 CCCTGGAGGCCTGGGGGTGTGGG + Intergenic
1175159222 20:56995542-56995564 CACTGGGGGTGTGGGGCTGTGGG + Intergenic
1175176849 20:57117667-57117689 TGCTGCAGGTGTGGGAGAGTGGG - Intergenic
1175176963 20:57118010-57118032 TGCTGCAGGTGTGGGAGAGTGGG - Intergenic
1175487650 20:59356850-59356872 CACTGGCAGTGTGGCAGTGCTGG + Intergenic
1176302615 21:5105662-5105684 CTCTGCTGGTGTGGGGGTGTGGG + Intergenic
1176599501 21:8778848-8778870 CACTGCAGCTGTGTGTGTGTTGG - Intergenic
1178246979 21:30962419-30962441 CACTGAAGTTTTGGGATTGTTGG + Intergenic
1179586117 21:42375228-42375250 CATTGGTGGTGTGGGGGGGTGGG - Intronic
1179854410 21:44156261-44156283 CTCTGCTGGTGTGGGGGTGTGGG - Intergenic
1180467293 22:15624124-15624146 CACTGAAGGTGTGTGTGTGGGGG - Intergenic
1180749540 22:18114726-18114748 CACAGGTGGTCAGGGAGTGTGGG + Intronic
1180995744 22:19964427-19964449 CACCTGAGGTCTGGGAGTGTGGG + Intronic
1181487675 22:23241769-23241791 CACTGGAGGTGGGGCAGGGCTGG - Intronic
1182043287 22:27254962-27254984 GCCTGGAGGTGTGGGAAGGTGGG - Intergenic
1182281523 22:29220257-29220279 CACTGGGGATGTGGGAGTAATGG - Intronic
1183083383 22:35471613-35471635 CAGTGGGGGTGGGGGTGTGTGGG - Intergenic
1183677709 22:39309087-39309109 CACGGGGGGTGTCGGAGGGTAGG + Intergenic
1183706195 22:39476179-39476201 GACTGGAGGTGGGGGAGGGGTGG + Intronic
1183988728 22:41584057-41584079 CACTGGTGGTGAGGGAGGGCGGG + Exonic
1184120703 22:42448108-42448130 CACAGGAGTTCTGGGAGTGACGG - Intergenic
1184132468 22:42525296-42525318 CACGGGAGTTCTGGGAGTGACGG - Intergenic
1184308828 22:43628092-43628114 CACTGGAGATGTGAGGCTGTGGG - Intronic
1184676383 22:46045420-46045442 CACAGGAGGTGAGGGCCTGTGGG + Intergenic
1184900978 22:47446236-47446258 CACTTCAGGGGTGGGAGTGAGGG - Intergenic
1185278525 22:49960279-49960301 TCCTGGGGGTGTGGGAGTGCGGG - Intergenic
950938339 3:16866473-16866495 CACTGGAGGTGGGGAGGTGGGGG - Intronic
953785278 3:45906768-45906790 CACCGGAGGTGTGTGTGTGCAGG + Intronic
953903795 3:46858168-46858190 CACTGCAGCTGGTGGAGTGTGGG + Exonic
954609034 3:51934534-51934556 CACAGGAGCTGTGGGAGCCTGGG + Exonic
956603164 3:71045007-71045029 CACTTGAGGTGAGGGAGTGGGGG + Intronic
956731625 3:72201742-72201764 CACTTGAGCTGTGGGATTATAGG + Intergenic
959066455 3:101662262-101662284 CTCTCGAAGTGTTGGAGTGTTGG + Intronic
960995614 3:123338342-123338364 GACAGGAGGTGGGGGAATGTGGG - Intronic
961563167 3:127745531-127745553 CACTGGAGGCGTGGAAGGATGGG + Intronic
961677362 3:128575959-128575981 CACCGCAGGTGTGTGCGTGTGGG + Exonic
962855461 3:139340926-139340948 CACTGGGGGTTGGGGAGGGTTGG - Intronic
964542821 3:157798679-157798701 CACTGGGGGTGTTGGGGGGTGGG - Intergenic
965410773 3:168327710-168327732 CACTGGAGATAGGGGGGTGTGGG + Intergenic
966302931 3:178498805-178498827 CACTGGAAGTCTGGGATTGTTGG - Intronic
966891156 3:184408619-184408641 TTGTGGAGGTGTGGAAGTGTAGG + Intronic
967455180 3:189676986-189677008 CACTGGAGATTTGGGAGGGTGGG - Intronic
968480442 4:830788-830810 CACTGGAGGAGAGGGAGGGAGGG - Intergenic
968817675 4:2830128-2830150 CACTGGAGGTGCGGGAGCTGCGG - Exonic
969058435 4:4416277-4416299 CACTGGATGCGGGGCAGTGTTGG + Intronic
969627685 4:8316144-8316166 ATCTGGAGGTGGGGGAGGGTGGG - Intergenic
970159615 4:13175717-13175739 CACTGGAGGCCTGGGAGTCAGGG - Intergenic
973157032 4:46968454-46968476 CACAGGAGGTGTGGGGATGTGGG - Intronic
973607471 4:52601915-52601937 CACTGGAGGTGTTGAAGAGCCGG + Exonic
973874085 4:55197645-55197667 GCCTGGAGAGGTGGGAGTGTTGG - Intergenic
977584245 4:98758200-98758222 CAGGGGAGGTGTAGGAGTGGAGG - Intergenic
981768780 4:148282643-148282665 CACAGGGTGTGTGGGAGTGGGGG + Intronic
982166437 4:152617735-152617757 CCCTGATGCTGTGGGAGTGTGGG + Intergenic
982308888 4:153963217-153963239 CAATGGAGAGGTGGGGGTGTAGG - Intergenic
986518473 5:8588017-8588039 TACTGGAGGTGAAGGAGTGGAGG + Intergenic
987078574 5:14406007-14406029 CACTGGAGGTTTGTGGATGTGGG + Intronic
988514322 5:31891635-31891657 CACTGGAGAAGTGGCATTGTGGG + Intronic
988945253 5:36190232-36190254 CACTGGGGGTGTCGGACAGTGGG - Intergenic
991631311 5:68658976-68658998 CCCTGGAGGCGTGTGTGTGTGGG - Intergenic
994091992 5:95817794-95817816 CACTGGAGGGGAGGGAGAGGTGG + Intronic
994169854 5:96647171-96647193 AAATGGAGCTGTGGGAGAGTTGG - Intronic
996255006 5:121389067-121389089 AACTGGGGGGGTGGGAGTGGGGG + Intergenic
996884867 5:128342699-128342721 CACCGGAGGAGAGGGAGTGGGGG + Intronic
998400741 5:141847671-141847693 AACTGGAGGTGGGGGAGGGGAGG - Intergenic
999318907 5:150601262-150601284 CAGTGGAGGAGTGGGGGTGGAGG + Intronic
1000243833 5:159432746-159432768 CCGTGGAGGGGTGGGAGTTTGGG + Intergenic
1001298102 5:170513299-170513321 CACTTGAGCTGTGTGATTGTGGG - Intronic
1001309975 5:170603608-170603630 CAGTGGAGGGATGGGAGGGTAGG + Intronic
1002908788 6:1472200-1472222 CACTAGAGGTGTGTCTGTGTGGG + Intergenic
1004210436 6:13636116-13636138 TACTGGAGGTGAGGGAGGGTAGG + Intronic
1004249371 6:14010787-14010809 CACTGGAGGTGTTCAAGGGTAGG + Intergenic
1004316512 6:14592898-14592920 GACTGGAGTTCGGGGAGTGTAGG - Intergenic
1005595494 6:27375017-27375039 CCCTGGAGAGGTGGGAGTGGAGG - Intronic
1005626090 6:27663731-27663753 CACTGCAGGACTGGGAGAGTGGG + Intergenic
1006377665 6:33680487-33680509 CCCAGGAGGTGTGGGAGTGGAGG + Intronic
1006572879 6:35019866-35019888 GACAGGAGGTGTGAGAGGGTGGG + Intronic
1006668913 6:35717583-35717605 CAGGGGAGCTGTGGGAGCGTGGG + Intronic
1008842270 6:55917581-55917603 CAATGTATGTGTGGGTGTGTAGG - Intergenic
1008960174 6:57258583-57258605 CAGTGGAGGGGTGGGTGGGTTGG - Intergenic
1009303128 6:62052595-62052617 CACTGGTGGGGTGGGGGTGGAGG + Intronic
1010158772 6:72826881-72826903 AACTGGAGGCTTGGGAGGGTAGG - Intronic
1011555272 6:88566665-88566687 CACGGGAGGCATGGGAGTGGAGG - Intergenic
1015246907 6:131085164-131085186 CAATGCAGCTGTGGGAGTGCAGG - Intergenic
1016485147 6:144529163-144529185 CAGTGGGGGTGTGGGGGTGGCGG - Intronic
1017102220 6:150858735-150858757 AACTTGAGGTGTTGGATTGTGGG - Intergenic
1018730460 6:166646328-166646350 CAATGGCCGTGTGGGCGTGTGGG - Intronic
1019282221 7:206277-206299 CACTGGAGGTGGGAGAGGCTGGG - Intronic
1019410320 7:903940-903962 GCTTGGACGTGTGGGAGTGTGGG - Intronic
1019491164 7:1314285-1314307 GACAGCAGGTGTGGGAGGGTTGG - Intergenic
1019505990 7:1391674-1391696 CACTGGAGGTGTCTGAGGGTTGG + Intergenic
1019723427 7:2587235-2587257 CACGGGAGGTCTGAGTGTGTGGG + Intronic
1019835013 7:3374717-3374739 GACCGGGGGTGTGGGGGTGTGGG - Intronic
1023161110 7:37296617-37296639 CACTAGGGGTGTGGGAATCTTGG + Intronic
1023846599 7:44124165-44124187 CACTGGAGATTGGGGAGTGTTGG - Intronic
1024049706 7:45610768-45610790 TAGTGGAGGTGTGGGGGTGATGG + Intronic
1024049775 7:45611067-45611089 TAGTGGAGGTGTGGGGGTGATGG + Intronic
1024248191 7:47486032-47486054 GAGTGCAGGTGTGTGAGTGTGGG + Intronic
1024266198 7:47608490-47608512 CACTGCAGATCTGGAAGTGTGGG + Intergenic
1024411334 7:49045852-49045874 CACTGGAGATTTGGAAGAGTTGG + Intergenic
1024758893 7:52569919-52569941 CACTGGAGTGGTGGCAGGGTGGG + Intergenic
1027318593 7:76998803-76998825 GTGTGGAGGTGTGGGGGTGTGGG + Intergenic
1027387310 7:77671447-77671469 CACTGGATGTGAGGCACTGTGGG - Intergenic
1028082742 7:86598949-86598971 CCCTGGAGGTGGGGGAGTAGGGG + Intergenic
1028106931 7:86889401-86889423 CACTGGAGCTGGGGGGGAGTTGG - Intronic
1028958499 7:96721704-96721726 CACTGGAGGGGAGTGAGTGTGGG - Intergenic
1029541106 7:101182563-101182585 AACTGGAAGTGTGTGAGGGTTGG - Intergenic
1029611305 7:101627915-101627937 CTCTGGAGCTGTGGGACTCTGGG + Intronic
1030015767 7:105219154-105219176 CACTGGAGGTGTGGGAGTGTGGG - Intronic
1030530048 7:110700592-110700614 CACTGGAGATGCCAGAGTGTTGG - Intronic
1030619729 7:111775736-111775758 CACTGTAGGGGTGGCAGTGGGGG + Intronic
1030685691 7:112485011-112485033 GACTGGATGTGTGGGTGTGGTGG + Intronic
1031598717 7:123677478-123677500 CACTGGTTGTGTGTGTGTGTGGG - Intergenic
1032863832 7:135906049-135906071 GACCGGGGGTGTGGGGGTGTAGG + Intergenic
1033227431 7:139572903-139572925 CACTGGAGGGGAGGGAGGGAGGG - Exonic
1034221684 7:149451267-149451289 CACTGTGGGTGTGGGGGTGTGGG + Intronic
1034469633 7:151248376-151248398 CACTAGAGGGGTGGGAGAGCGGG + Intronic
1034968766 7:155406953-155406975 GTGTGGGGGTGTGGGAGTGTGGG + Intergenic
1034968914 7:155407545-155407567 AATGTGAGGTGTGGGAGTGTGGG + Intergenic
1035760603 8:2066036-2066058 TACTCGAGGAGCGGGAGTGTGGG - Intronic
1036054786 8:5239386-5239408 TACTGGAGGTGGTGGAGTGGTGG - Intergenic
1036629009 8:10497234-10497256 CTCTGGGAGGGTGGGAGTGTTGG - Intergenic
1036663003 8:10720377-10720399 GAATGGAGGTGTGGGTGGGTAGG + Intergenic
1037754113 8:21700446-21700468 CAGTGGGGCTGTGGGAGTCTTGG - Intronic
1038256643 8:25956581-25956603 CATTGGAGATTTGGGAGGGTGGG - Intronic
1039764518 8:40613854-40613876 AGCTGGAAGTGTGGGAGAGTTGG + Intronic
1039891512 8:41688745-41688767 CATGGGAGGAGTGGGAGTGAAGG + Intronic
1040578939 8:48679534-48679556 CAGTGGAGGAGTGGCACTGTGGG - Intergenic
1040585221 8:48734847-48734869 AAATGCATGTGTGGGAGTGTAGG + Intronic
1041214507 8:55586317-55586339 CACTGAAGGAGTGGAAGAGTGGG - Intergenic
1042101944 8:65283735-65283757 TAATGGAGGTATGGGGGTGTTGG - Intergenic
1042847948 8:73186943-73186965 CACTGCAGGGGTGGCACTGTGGG + Intergenic
1043034583 8:75179560-75179582 CCCTGGTGGTGTGGGAGACTGGG - Intergenic
1047297173 8:123581397-123581419 GACTGGAGGTGGGGGAGGGAGGG - Intergenic
1047999093 8:130362226-130362248 AACCAGAGGTGGGGGAGTGTGGG + Intronic
1053276650 9:36788296-36788318 CCCTGCAGGTGAGGGAGTGGTGG + Intergenic
1053496601 9:38552833-38552855 CAGTGGTGGGGTGGGGGTGTTGG - Intronic
1053685178 9:40514471-40514493 CTCTGGAGGTGGGGAAGTGGGGG - Intergenic
1053935139 9:43142761-43142783 CTCTGGAGGTGGGGAAGTGGGGG - Intergenic
1054278551 9:63110492-63110514 CTCTGGAGGTGGGGAAGTGGGGG + Intergenic
1054298270 9:63349928-63349950 CTCTGGAGGTGGGGAAGTGGGGG - Intergenic
1054396287 9:64654445-64654467 CTCTGGAGGTGGGGAAGTGGGGG - Intergenic
1054430930 9:65159640-65159662 CTCTGGAGGTGGGGAAGTGGGGG - Intergenic
1054489459 9:65762705-65762727 CACCGGGGGGGTGGGGGTGTGGG - Intergenic
1054499451 9:65861881-65861903 CTCTGGAGGTGGGGAAGTGGGGG + Intergenic
1055440391 9:76331131-76331153 CCCTGGTGGTGTGGTGGTGTGGG - Intronic
1055865244 9:80805420-80805442 AGCTGGAGGTTTGGGACTGTAGG - Intergenic
1059044925 9:110856009-110856031 CCCTGGAGGTCTGGGGGTGAGGG + Intergenic
1059287456 9:113187194-113187216 TAATGGAGGTGTGGGAATGATGG - Intronic
1060828046 9:126697453-126697475 CACTGGAGGTATGTGAGGGGAGG - Exonic
1062246026 9:135566582-135566604 CTCTGGAGGTGTGGAAGGGTGGG - Exonic
1186819945 X:13277411-13277433 CCTTGGTGGTGTGGGAGTGGGGG + Intergenic
1187485599 X:19700064-19700086 CACTGGAGGGGTGGGTTTGAGGG + Intronic
1187668963 X:21649700-21649722 CACTGTGTGTGGGGGAGTGTGGG + Intronic
1188013597 X:25083797-25083819 CACTGGCAGTGTGGGAGGATGGG - Intergenic
1188469033 X:30516572-30516594 CACTGGAGACGTGGGAGAGTGGG + Intergenic
1188880076 X:35481703-35481725 CACTTGAGGGCTGGGAGTGGTGG + Intergenic
1189309915 X:40011955-40011977 CAGTGAAGGGGTGGGAGTGGAGG - Intergenic
1189834782 X:45008497-45008519 CAATGGGGGTGTGGGGGTGAGGG - Intronic
1190168560 X:48093195-48093217 CTCTGGAGGAATGGGAGTGGAGG - Intergenic
1190439204 X:50460439-50460461 CTCTGGATGTGTGGGTGGGTGGG + Intronic
1190908603 X:54751379-54751401 CCCTGGAGGGAGGGGAGTGTGGG + Exonic
1191085770 X:56565301-56565323 CACTCCAGGTGTGGGGGTGGGGG + Exonic
1192179503 X:68907540-68907562 CATTGGAGGTGTGGGATGGGGGG + Intergenic
1192492818 X:71591121-71591143 CATTGGAGGAGTGGCAGTGGCGG + Intronic
1192493071 X:71593332-71593354 CATTGGAGGAGTGGCAGTGGCGG + Intronic
1194915513 X:99702811-99702833 AACTTGAGCTGTGGGAGTCTGGG - Intergenic
1195011984 X:100741536-100741558 CACTGGAGGTTGGGGACTGGAGG + Intergenic
1195284104 X:103366713-103366735 CACTGGGGGCGTGGGGGTGGTGG - Intergenic
1195618557 X:106931549-106931571 CTCTGAAGGTGTGGCAGTTTGGG + Intronic
1195771029 X:108351532-108351554 CACTCGAGGTGTGGCTGTGAGGG - Intronic
1196603606 X:117629738-117629760 TACTTCAGGTGTGGGTGTGTGGG - Intergenic
1196856957 X:119993253-119993275 CACTGGGGGTGTGGGGGGGCAGG + Intergenic
1197424862 X:126283325-126283347 CATTTGAGGTGGGGGAGAGTGGG + Intergenic
1197897823 X:131334561-131334583 GACTGGAGGTCTGGGATTGGAGG - Intronic
1198278189 X:135117231-135117253 CACTGGAAGTCTGGGTGGGTTGG - Intergenic
1198292773 X:135255285-135255307 CACTGGAAGTCTGGGTGGGTTGG + Intronic
1198307939 X:135401045-135401067 CACTGGAAGTCTGGGTGGGTTGG + Intergenic
1199503732 X:148537960-148537982 CACAGGACGTGCGGGGGTGTAGG + Intronic
1200139591 X:153892751-153892773 CAGTTCAGGGGTGGGAGTGTGGG - Intronic