ID: 1030023283

View in Genome Browser
Species Human (GRCh38)
Location 7:105296949-105296971
Sequence GCAGTATGTATAGTTGCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 70}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030023283_1030023285 -1 Left 1030023283 7:105296949-105296971 CCAGAGGCAACTATACATACTGC 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1030023285 7:105296971-105296993 CCTCTCATAATATTTACAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 90
1030023283_1030023287 19 Left 1030023283 7:105296949-105296971 CCAGAGGCAACTATACATACTGC 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1030023287 7:105296991-105297013 AGGTTCAGAATAATGTGTGGTGG No data
1030023283_1030023288 20 Left 1030023283 7:105296949-105296971 CCAGAGGCAACTATACATACTGC 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1030023288 7:105296992-105297014 GGTTCAGAATAATGTGTGGTGGG 0: 1
1: 0
2: 0
3: 11
4: 139
1030023283_1030023286 16 Left 1030023283 7:105296949-105296971 CCAGAGGCAACTATACATACTGC 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1030023286 7:105296988-105297010 AGCAGGTTCAGAATAATGTGTGG No data
1030023283_1030023289 21 Left 1030023283 7:105296949-105296971 CCAGAGGCAACTATACATACTGC 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1030023289 7:105296993-105297015 GTTCAGAATAATGTGTGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030023283 Original CRISPR GCAGTATGTATAGTTGCCTC TGG (reversed) Intronic
904432990 1:30477105-30477127 CCAGTATGTATTGTGGCCTCTGG + Intergenic
905018930 1:34795203-34795225 GCAGTATGTATAGAGGCCTGTGG + Exonic
910837671 1:91532167-91532189 GCAGTAAGTATAATTGCAACTGG + Intergenic
920347073 1:205313404-205313426 GCAGTATGTGTGGTGGGCTCAGG + Intronic
1073488452 10:103837030-103837052 GCCTTATGTAGACTTGCCTCAGG - Intronic
1076113670 10:127880558-127880580 GCAGTCTGCAAAGTTGTCTCTGG + Intronic
1080475432 11:32585792-32585814 CAAGTATATTTAGTTGCCTCAGG - Intronic
1089432572 11:118436320-118436342 GCAATCTGTATAGCGGCCTCGGG - Intergenic
1091435302 12:467733-467755 GCAGGATACATAGTAGCCTCTGG + Intronic
1092265436 12:6977202-6977224 GCAATATGAATAGTAGGCTCAGG + Exonic
1097153823 12:56998233-56998255 GCAGTATGAATACTTCCCTAAGG + Intergenic
1103455999 12:121065930-121065952 GTAGTATGTATATTTTCCTTTGG + Intergenic
1108745891 13:53393255-53393277 GAAGTATTTATAGTATCCTCTGG + Intergenic
1114574799 14:23701967-23701989 GAGGAAGGTATAGTTGCCTCTGG - Intergenic
1115033359 14:28826667-28826689 GCAATATGTCTATTTTCCTCTGG + Intergenic
1117270156 14:54135311-54135333 GCAGTTTATATACTGGCCTCTGG - Intergenic
1124130268 15:26977867-26977889 GCAGTATGTTTAATTGCTTAAGG + Intronic
1127535984 15:59890335-59890357 GCAGGATGTAAAGGTGCTTCAGG + Intergenic
1150430160 17:65108850-65108872 GCAGTATGGATGGATGGCTCTGG + Intergenic
1156811915 18:41263106-41263128 TCAGGATGTAGAGTAGCCTCTGG - Intergenic
1158131233 18:54154681-54154703 GCAGTATGAACTATTGCCTCTGG - Exonic
1165897644 19:39152826-39152848 GCTGTATATATAGTTGGCCCTGG + Intronic
1166485164 19:43206178-43206200 CCAGGATGGATAGTTTCCTCTGG - Intronic
931746756 2:65297691-65297713 GCAGTAACGGTAGTTGCCTCTGG - Intergenic
934668697 2:96193058-96193080 GCGGTATGTATGGCTGCCTGTGG - Exonic
937354263 2:121188117-121188139 GCAGAATTTATAGCTGACTCAGG - Intergenic
939727402 2:145739784-145739806 GAATTGTGTATAGTTGTCTCCGG + Intergenic
941430529 2:165408905-165408927 GAAGTATTAATAGTAGCCTCAGG - Intergenic
944201021 2:197107684-197107706 GTAGCATGTTTAGTTGCTTCAGG + Intronic
945489396 2:210437366-210437388 GCATTATTTATAATTGCCACAGG - Intronic
948750827 2:240131940-240131962 GCAGTATCCAGAGATGCCTCAGG - Intronic
1173543214 20:43869875-43869897 GCAGTAAGTAGAGGTCCCTCAGG + Intergenic
1181904276 22:26181141-26181163 GCAGTATAAATAGCTCCCTCTGG - Intronic
1184377716 22:44124956-44124978 GCAGCATCTGTAGCTGCCTCTGG + Intronic
956669091 3:71669880-71669902 GCAGTATGAATAGTTTCTACTGG - Intergenic
959838133 3:110944484-110944506 TCAGTTTGTATAGCTGCCTTGGG - Intergenic
960235791 3:115280590-115280612 GCCGTATTTTTAGATGCCTCTGG + Intergenic
961178392 3:124855388-124855410 GCAAAATGCATATTTGCCTCAGG - Intronic
961428868 3:126865711-126865733 GCAGTATGCAGAGTAGACTCAGG - Intronic
962400760 3:135056993-135057015 GCAGTATGGAGAGTCCCCTCTGG + Intronic
965417865 3:168419911-168419933 GCAGTATTTATAGTCACCTGGGG + Intergenic
970999517 4:22306322-22306344 CAAGAATGTATAGTTGCTTCAGG - Intergenic
982298182 4:153851855-153851877 GCAATATGTTTAGTTTCCACTGG + Intergenic
984172375 4:176375253-176375275 GCAGTATGGATAGTTGGAACTGG + Intergenic
990182185 5:53173860-53173882 CCAGTACTTAAAGTTGCCTCTGG + Intergenic
994401997 5:99292127-99292149 GCACTATGTATGTTTTCCTCTGG - Intergenic
995119964 5:108525765-108525787 GGAGGATGTATGTTTGCCTCAGG + Intergenic
1001136449 5:169106642-169106664 GCAGTATGTACAGTAGCATCAGG - Intronic
1003876113 6:10438692-10438714 ACAGTATGTATAGGTGTCTTTGG + Intergenic
1009612683 6:65966268-65966290 ACTGTATCTACAGTTGCCTCTGG - Intergenic
1011520248 6:88196859-88196881 GCAGTATGTAGAGTTTTCTATGG + Intergenic
1012217875 6:96610675-96610697 GCAGAATGGATAGTCGTCTCTGG - Exonic
1016085945 6:139914622-139914644 GCTCTATGTATAATTGCCTATGG - Intergenic
1017780685 6:157713197-157713219 GCAGTCAGCATATTTGCCTCAGG + Intronic
1023072812 7:36454270-36454292 GCAATATGTGTAGTGGCCTCTGG - Intergenic
1026532807 7:71214206-71214228 GCACTATGAATAGTTCCTTCAGG + Intronic
1028657273 7:93222988-93223010 GAAGTCTGTATAATTGCCTTGGG + Intronic
1028820581 7:95206606-95206628 GCAGACTGAATAGTTGTCTCAGG - Intronic
1029227783 7:99040650-99040672 TCAGTAGGTCTGGTTGCCTCTGG - Intronic
1030023283 7:105296949-105296971 GCAGTATGTATAGTTGCCTCTGG - Intronic
1032394662 7:131580999-131581021 GGGGTATGTGTAGTTGCCTTTGG + Intergenic
1033855007 7:145550079-145550101 GTAGTATGTATAGTAGCATATGG + Intergenic
1038106031 8:24435269-24435291 GCATTATGTATGGTTACCCCAGG - Intergenic
1047181310 8:122590839-122590861 GCAGTATGTATAGTAGAATAAGG + Intergenic
1049026799 8:139997129-139997151 GCAGGATGTATTGTTTGCTCTGG - Intronic
1053093899 9:35307436-35307458 GCAGTTTGAATAGCTGGCTCTGG - Intronic
1055392705 9:75840362-75840384 ACAGTATGTAGAATTGCTTCAGG + Intergenic
1055690002 9:78819776-78819798 TCAGCATTTATAGATGCCTCAGG + Intergenic
1060102298 9:120851297-120851319 GCAGTATTTAAAGTGGCTTCAGG + Intergenic
1203778865 EBV:89523-89545 GCAGTATGTACAGTTAGCTTTGG + Intergenic
1189602436 X:42641365-42641387 GCAGTAAGTTTAGTGGCCTGAGG - Intergenic
1192634401 X:72804166-72804188 GCAGTCTGTAGAATTACCTCAGG + Intronic
1192647309 X:72916635-72916657 GCAGTCTGTAGAATTACCTCAGG - Intronic
1196931577 X:120686857-120686879 TCAATATTTATTGTTGCCTCTGG - Intergenic
1201343641 Y:12959432-12959454 TCAGTAAGTATAGTAGCTTCTGG + Intergenic