ID: 1030025447

View in Genome Browser
Species Human (GRCh38)
Location 7:105319699-105319721
Sequence CTGTAAATACAGCTGAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 16, 3: 28, 4: 301}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030025443_1030025447 28 Left 1030025443 7:105319648-105319670 CCATAAGCTAACAGGTAGACAAG 0: 1
1: 0
2: 0
3: 6
4: 114
Right 1030025447 7:105319699-105319721 CTGTAAATACAGCTGAGTCCTGG 0: 1
1: 0
2: 16
3: 28
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030025447 Original CRISPR CTGTAAATACAGCTGAGTCC TGG Intronic
901900261 1:12355166-12355188 CTGTAACAACAGCTGAGTCTTGG - Intronic
901950004 1:12736747-12736769 CTGTAACAACAGCTGGGTCTTGG - Intergenic
902389099 1:16092424-16092446 CAGTAAATCCAGCTTTGTCCAGG + Intergenic
903102246 1:21040825-21040847 CTGTAAAAACAGCTGAGTCTTGG + Intronic
904441870 1:30537090-30537112 CTGTAACAACAGGTGAGTCTTGG + Intergenic
905052692 1:35065556-35065578 CTTTAAATACAGTTGACTCTTGG - Intronic
905246933 1:36621573-36621595 CTGTGAATACAGATGAGGCTTGG + Intergenic
905331035 1:37197569-37197591 CTGTTAATACAACTGAGCTCCGG - Intergenic
905536078 1:38722855-38722877 CTGAAAAGACAGCTGTGTCACGG - Intergenic
907581499 1:55576387-55576409 CTGGAAGAACAGCTGAGTCCAGG + Intergenic
907782977 1:57584074-57584096 CTGTAACAATAGCTGAGTCTTGG + Intronic
909585913 1:77287876-77287898 CTGTAACAATAGCTGAGTCTTGG - Intronic
910996524 1:93110304-93110326 CTGTAAAGACAGCTTGGTCAAGG - Exonic
911615752 1:100008985-100009007 CTGTAAGTACAGATGACTCCTGG + Intronic
915556430 1:156663423-156663445 CTGGAGACACAGCTGAGTCATGG + Intergenic
916545507 1:165800492-165800514 CTGTAACAATAGCTGAGTCTTGG + Intronic
920242086 1:204560296-204560318 CTGTAACAATAGCTGAGTCTTGG - Intergenic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
921059920 1:211577673-211577695 CTGTAAAGACAGCCAAGTGCGGG + Intronic
921423598 1:214976884-214976906 CTTTAAATCCAGCTGACACCTGG + Intergenic
921889303 1:220337717-220337739 CTGTAAATCCTGCTGTTTCCAGG - Intergenic
922157217 1:223049911-223049933 CTGTAAGAACTGCTGAGTCTTGG + Intergenic
922158242 1:223057169-223057191 CTGTAACAACTGCTGAGTCTTGG - Intergenic
922321388 1:224491018-224491040 CTGTAACAATAGCTGAGTCTTGG - Intronic
924500791 1:244636374-244636396 CTGTAAATATGACTGACTCCTGG + Intronic
924535161 1:244929254-244929276 CTCTAAATACAGATCAGGCCAGG - Intergenic
1064658858 10:17585104-17585126 CTGTAACAACAGCTGAGTCTTGG + Intergenic
1064719247 10:18212044-18212066 CTGTACAAACACCTGAGGCCTGG - Intronic
1067249895 10:44577294-44577316 TTGTGAATACAGCTGACCCCAGG - Intergenic
1068116841 10:52745405-52745427 CTGTAACAATAGCTGAGTCTTGG + Intergenic
1068526563 10:58137341-58137363 CTGTAACAATAGCTGAGTCTTGG + Intergenic
1068718622 10:60216876-60216898 CTGTAAATCCATCTGGGGCCTGG + Intronic
1068995552 10:63198526-63198548 CTGAAAAAACAGCTTTGTCCTGG - Exonic
1069099765 10:64305723-64305745 CAGTTAATGTAGCTGAGTCCAGG + Intergenic
1070201163 10:74207635-74207657 CTGTAAGTCTGGCTGAGTCCAGG + Intronic
1070219999 10:74431443-74431465 CTTTAAATGCATCTGAGGCCGGG + Intronic
1070634120 10:78110204-78110226 TGGTCAATACAGCTGAGCCCTGG + Intergenic
1071166768 10:82816465-82816487 CTGTGAGTCCAGCTGAGTCCAGG + Intronic
1072438322 10:95433265-95433287 CTGTGAAGACAGCTGAGGCTCGG - Intronic
1072529482 10:96305273-96305295 CTGTTAAGACAGCTCTGTCCAGG + Intronic
1077440664 11:2567268-2567290 CTGCAAATACAGATGAACCCAGG + Intronic
1080197002 11:29623114-29623136 CTGTAATTATAGCTGAGTCTTGG + Intergenic
1080197014 11:29623271-29623293 CTGTAATTATAGCTAAGTCTTGG + Intergenic
1080589286 11:33707571-33707593 CTGTAAATCCAGATGAGTGGAGG + Intronic
1081482911 11:43505793-43505815 CTGTAACAATAGCTGAGTCTTGG - Intergenic
1082066339 11:47903744-47903766 TTATAAAAGCAGCTGAGTCCAGG + Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1084969988 11:72766185-72766207 CTGCAAATGCAGCCTAGTCCTGG - Intronic
1085336024 11:75696497-75696519 CTGTGAATCCACCTGAGTCAGGG + Intergenic
1088331223 11:108654456-108654478 CTGTAACAATAGCTGAGTCTTGG - Intergenic
1089602532 11:119624362-119624384 CTCTAAACACAGCTGGGGCCAGG + Intronic
1090632138 11:128658577-128658599 CTGTAACAATAGCTGAGTCTTGG + Intergenic
1093070132 12:14699871-14699893 CTGCAAATGCAGCTGCTTCCAGG - Intergenic
1093070397 12:14702179-14702201 CTGCAAATACAGCTGCTTCTGGG + Intergenic
1093486340 12:19656944-19656966 CTCTAAATACAGTTAAGTTCTGG + Intronic
1093502782 12:19831646-19831668 CTAAAAATGCAGCTGAGGCCTGG - Intergenic
1093653101 12:21666235-21666257 CTGTAACTATAGCTAAGTCTTGG - Intronic
1093799188 12:23351460-23351482 CTGGAAAAACAGCTAAGTTCAGG + Intergenic
1094457262 12:30650439-30650461 ATGTAAATACAGTTGACTCTTGG - Intronic
1094541093 12:31363884-31363906 CTGTAAATCCAGCTCACTCAAGG + Intergenic
1095890551 12:47231768-47231790 CTGTTAATACAGTTCTGTCCCGG - Intronic
1097986634 12:65789298-65789320 CTGTAACAATAGCTGAGTCTTGG + Intergenic
1098502664 12:71211666-71211688 CTGTAACAATAGCTGAGTCTTGG + Intronic
1098976370 12:76906047-76906069 CTGTAACAATAGCTGAGTCTTGG + Intergenic
1099666688 12:85639595-85639617 CTGTAACAATAGCTGAGTCTTGG - Intergenic
1100916172 12:99424852-99424874 CTGTAACAATAGCTGAGTCTTGG + Intronic
1102248475 12:111369600-111369622 CAGAAAAAACAGCTGAATCCAGG + Intergenic
1102630784 12:114277421-114277443 CTGTAACAACAGCTGAGTCTTGG + Intergenic
1103403561 12:120659425-120659447 CTGCAAATAAAACAGAGTCCAGG - Intronic
1105636313 13:22218984-22219006 CTATAAATAGAGCCGAGTTCTGG + Intergenic
1107272472 13:38636111-38636133 CTGTAACAACAACTGAGTCTTGG + Intergenic
1107775829 13:43840077-43840099 CTGTAACAACAGCTGAGTGTTGG - Intronic
1107824383 13:44314488-44314510 CTGTAACAATAGCTGAGTCTTGG - Intergenic
1108390116 13:49938588-49938610 CTGTAACAATAGCTGAGTCTTGG - Intergenic
1108810116 13:54212164-54212186 CTGTAACAATAGCTGAGTCTTGG - Intergenic
1109108108 13:58280352-58280374 CTGTAACAACGGCTGAGTCTTGG + Intergenic
1110199987 13:72838676-72838698 CTGTAACAACAGCTGAGTCTGGG - Intronic
1110337258 13:74346748-74346770 CTGGAAAGACAGCTGAAGCCAGG + Intergenic
1110696020 13:78490551-78490573 CTGTAACAACAGCTGAGTCTTGG - Intergenic
1110734713 13:78922824-78922846 CTGTAACAATAGCTGAGTCTTGG - Intergenic
1110964031 13:81668597-81668619 CTGTAAATAAAGCTAATTCAGGG - Intergenic
1111263683 13:85778145-85778167 CTGTAAAAACAGTTGAGTGAGGG + Intergenic
1112326692 13:98446461-98446483 CTTTATCTACAGCTCAGTCCTGG + Intronic
1112595139 13:100801050-100801072 CTGTAACAATAGCTGAGTCTTGG - Intergenic
1112673373 13:101668090-101668112 CTATAAATTCAGCTTAGGCCAGG + Intronic
1112683558 13:101795918-101795940 CTGAAAATACAGCTGAATTGAGG + Intronic
1113247220 13:108411092-108411114 CTGTAAATACAGATGACCCTTGG + Intergenic
1113291702 13:108913805-108913827 CTGTAACAATAGCTGAGTCTTGG + Intronic
1113968918 13:114173496-114173518 CTGTAACAACAGCTGAGTCTTGG - Intergenic
1114335222 14:21682303-21682325 CTGTAACAATAGCTGAGTCTTGG + Intergenic
1116483375 14:45417904-45417926 CTGTAACAATAGCTGAGTCTTGG + Intergenic
1117078500 14:52127866-52127888 CTGTAACAATAGCTGAGTCTTGG + Intergenic
1117410933 14:55450446-55450468 CTGTAACAATAGCTGAGTCTTGG - Intronic
1118298264 14:64590532-64590554 CTGAAAGGTCAGCTGAGTCCTGG + Intergenic
1118397157 14:65347467-65347489 CTGTTAATACAGCTGACAACAGG - Intergenic
1119346788 14:73931893-73931915 GTGAAAAGACAGCTGAGTCTGGG - Exonic
1119633469 14:76254623-76254645 CTGTAACAATAGCTGAGTCTTGG - Intergenic
1120052350 14:79881896-79881918 CTGTAACAAGAGCTTAGTCCAGG - Intergenic
1120711346 14:87796477-87796499 CTGTAACAATAGCTGAGTCTTGG - Intergenic
1121185984 14:91969877-91969899 CTTTAGATACAGCAGAATCCAGG - Exonic
1121907250 14:97757714-97757736 CTGTAACCACAGCTGCTTCCCGG + Intronic
1123146126 14:106132204-106132226 CTGTAACAACAGCGGAGTCTTGG + Intergenic
1202883840 14_KI270722v1_random:85575-85597 CTGTAACTATAGCTCAGTCCTGG - Intergenic
1124529667 15:30494205-30494227 CTGTAACAGCAGCTGAGTCTTGG - Intergenic
1124658504 15:31526987-31527009 CTGTTAAAATAGCAGAGTCCCGG - Intronic
1124768992 15:32513482-32513504 CTGTAACAGCAGCTGAGTCTTGG + Intergenic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1127147360 15:56038067-56038089 CTGTAACAAGAGCTGAGTCTTGG + Intergenic
1128148560 15:65346757-65346779 CTGTTAAAAGAGCTGAGTCTCGG - Intronic
1129361226 15:75025690-75025712 CTGTGAATTCAGCAGAGCCCGGG + Intronic
1130541434 15:84823106-84823128 CATTAAATGCAGCAGAGTCCAGG - Intronic
1130803613 15:87293650-87293672 CTGTAACCATAGCTGAGTCTTGG - Intergenic
1131078578 15:89514998-89515020 CCATAAATGCAGCTGAGTCAGGG - Intergenic
1131081715 15:89542124-89542146 CTGAAAATGCAACTGAGTCAGGG + Intergenic
1132343825 15:101095037-101095059 CTATAAAAACAGCTGGGCCCAGG - Intergenic
1133344216 16:5059531-5059553 CCGTGAATCCAGCTGTGTCCTGG + Intronic
1133480913 16:6169722-6169744 CTGTAACAACAACTGAGTCTTGG - Intronic
1133493644 16:6296034-6296056 CTGTAAAGGAAGCTGAGCCCAGG + Intronic
1133560215 16:6943736-6943758 CTGTAACAATAGCTGAGTCTTGG + Intronic
1133816598 16:9202406-9202428 CTGTAACAATAGCTGAGTCTTGG + Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1134518952 16:14909388-14909410 CTGTAACAATAGCTGAGTCTTGG - Intronic
1134554975 16:15156836-15156858 CTGTAACAATAGCTGAGTCTTGG + Intergenic
1134706623 16:16308043-16308065 CTGTAACAATAGCTGAGTCTTGG - Intergenic
1134960917 16:18404081-18404103 CTGTAACAATAGCTGAGTCTTGG + Intergenic
1134965219 16:18486684-18486706 CTGTAACAATAGCTGAGTCTTGG + Intronic
1135914698 16:26595368-26595390 CTGTAACAACAGCTGAGTCGTGG + Intergenic
1138015618 16:53425729-53425751 CTGGAACAACAGCTGAGTCTTGG - Intergenic
1138559414 16:57791674-57791696 TTGTGGTTACAGCTGAGTCCTGG - Intronic
1139508126 16:67409825-67409847 ATGTAAACACAGATGAGACCGGG + Intronic
1140906047 16:79410055-79410077 CTGTAACCACAGCAGAGTCTTGG + Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1142034780 16:87856201-87856223 CTGTCATTACAGATGACTCCTGG - Intronic
1143089944 17:4444117-4444139 GTATAAATGCAGCTGTGTCCAGG + Intronic
1144129344 17:12230776-12230798 CTGTACATACATGTGAGTCTCGG - Intergenic
1144381625 17:14704146-14704168 CTGTAACAACAGCTGAGTCTTGG - Intergenic
1144939937 17:18931929-18931951 CTCTAAAGACAGATGAGGCCGGG - Intergenic
1146444844 17:32925492-32925514 CTGTAAAAATAGCTGAGTCTTGG + Intergenic
1146448581 17:32953375-32953397 CTGTAACAATAGCTGAGTCTTGG - Intergenic
1146547744 17:33753765-33753787 CTGTAACAATAGCTGAGTCTTGG - Intronic
1147608864 17:41789696-41789718 CTGTGCAGACAGCTGAGTCTAGG - Intergenic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1151030551 17:70733065-70733087 CTGTAACAATAGCTGAGTCTTGG - Intergenic
1152936312 17:83139314-83139336 CTTAAAATTCAGCTGAGGCCAGG - Intergenic
1153660892 18:7325303-7325325 TGGATAATACAGCTGAGTCCTGG - Intergenic
1154365788 18:13707743-13707765 CTGTAACAACAGCTGAGTCTTGG + Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1157976064 18:52328199-52328221 CTGTAACAATAGCTTAGTCCTGG - Intergenic
1159280013 18:66273205-66273227 CTGTAACAATAGCTGAGTCTTGG + Intergenic
1162917100 19:13880531-13880553 CTGGAAATCCAGCCGAGCCCGGG - Intronic
1163745159 19:19042506-19042528 CTGCAAATACAGAAGAGGCCGGG - Intronic
1164573895 19:29394089-29394111 ATGTCATTACAGCTGAGCCCAGG - Intergenic
1165038657 19:33053342-33053364 CTGGAAATACAGTTGATTCATGG - Intronic
1165405108 19:35625483-35625505 TTGTGAAAACAGCTGATTCCAGG + Intergenic
1168225180 19:54989545-54989567 CTGTATTTCCAGCTGATTCCTGG + Intronic
1202632989 1_KI270706v1_random:17055-17077 CTGTAACTATAGCTGAGTCCTGG - Intergenic
1202652886 1_KI270707v1_random:22995-23017 CTGTAACTATAGCTGAGTCCTGG + Intergenic
1202659265 1_KI270708v1_random:52749-52771 CTGTAACTATAGCTGAGTCCTGG - Intergenic
926353485 2:12018838-12018860 CTGTAACAACAGCTGAGTCTTGG + Intergenic
927950304 2:27163537-27163559 CTGTAACAATAGCTGAGTCTTGG + Intergenic
928302569 2:30139212-30139234 CTGTAACAACAGCTGAGTCTTGG + Intergenic
930498075 2:52174476-52174498 CTGTAACAATAGCTGAGTCTTGG + Intergenic
931165872 2:59747151-59747173 CTCTAAATATATCTGTGTCCCGG - Intergenic
935131219 2:100262481-100262503 CTATTTATACAGCTGTGTCCAGG + Intergenic
935680301 2:105630292-105630314 CTGTAACAACGGCTGAGTCTTGG - Intergenic
936750039 2:115631014-115631036 CTGTAAATACATCTGATCCTGGG + Intronic
937244108 2:120481562-120481584 CTGTAAATCAAGCAGAGTCTTGG + Intergenic
937622025 2:123999562-123999584 CTGTAACAATAGCTGAGTCTTGG - Intergenic
938048078 2:128141026-128141048 CTGTAAAAACACTTGAGGCCAGG + Intronic
942861578 2:180619234-180619256 TTGTACATACATCTGAGTGCAGG + Intergenic
943969048 2:194379723-194379745 CTGTAACAATAGCTGAGTCTTGG - Intergenic
943969679 2:194387036-194387058 CTGTAACAACAGCTGAGTCTTGG - Intergenic
944354684 2:198773120-198773142 CGTTAGATACAGCTGAGGCCAGG - Intergenic
946566164 2:220967918-220967940 CTGTAACAATAGCTGAGTCTTGG - Intergenic
946888399 2:224247563-224247585 CTGTAACAATAGCTGAGTCTTGG - Intergenic
947068622 2:226260216-226260238 CTTTATTTACAGCTGAGACCAGG - Intergenic
947519400 2:230832388-230832410 CTGTAACAATAGCTGAGTCTTGG + Intergenic
947870401 2:233433860-233433882 CTGGAAATAAAGCTGTGACCTGG - Intronic
1172576327 20:36011560-36011582 CTGTAATCCCAGCTGAATCCAGG + Intronic
1173638749 20:44584180-44584202 ATGTAAATACAGTTTAGTTCAGG - Intronic
1174915010 20:54644755-54644777 CTGTAATCCCAGCTGAGTCAGGG + Intronic
1175053054 20:56172642-56172664 CTGTAACAATAGCTGAGTCTTGG + Intergenic
1175488101 20:59359843-59359865 CTGAAGCTACAGGTGAGTCCAGG + Intergenic
1176599266 21:8776656-8776678 CTGTAACTATAGCTGAGTCCTGG - Intergenic
1176645209 21:9342935-9342957 CTGTAACTATAGCTGAGTCCTGG - Intergenic
1177159675 21:17534388-17534410 CTTTAAATACTGCTAAGGCCGGG - Intronic
1177358851 21:20043637-20043659 CTGTAACAATAGCTGAGTCTTGG + Intergenic
1177643671 21:23875846-23875868 CTGTAACGATAGCTGAGTCTTGG - Intergenic
1177738445 21:25122141-25122163 CTGTAACAATAGCTGAGTCTTGG - Intergenic
1177940768 21:27408948-27408970 CTGTAACAATAGCTAAGTCCTGG + Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1179265414 21:39798411-39798433 GCGGAAATACAGCTGACTCCCGG - Intronic
1180326727 22:11436274-11436296 CTGTAACTATAGCTGAGTCCTGG - Intergenic
1180367742 22:11956299-11956321 CTGTAACTATAGCTGAGTCCTGG + Intergenic
1180419162 22:12798244-12798266 CTGTAACTATAGCTGAGTCCTGG + Intergenic
1180719698 22:17898367-17898389 CTGTATAAACAGCTTTGTCCTGG + Intronic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
954701083 3:52451217-52451239 CTCCAACTCCAGCTGAGTCCTGG - Exonic
955637557 3:61046521-61046543 CTGTGAATCCATCTGGGTCCTGG - Intronic
956118839 3:65945556-65945578 CTGTAACAATAGCTGAGTCTTGG + Intronic
957014447 3:75046521-75046543 CTGTAACAATAGCTGAGTCTTGG + Intergenic
957095109 3:75771109-75771131 CTGTAACAACAGCTGAGTCCTGG + Intronic
957604506 3:82379754-82379776 CTGTAAGAAGAGCTGAGTCTTGG - Intergenic
957913252 3:86650773-86650795 CTGTAACAACAGCTAAGTCTTGG + Intergenic
960756103 3:121014735-121014757 CTGCAAATACAGATAAGTACTGG - Intronic
961338200 3:126198090-126198112 CTGTAACAATCGCTGAGTCCTGG - Intergenic
965847903 3:172986300-172986322 ATGTAAATACATATGAGTACTGG + Intronic
966536108 3:181036014-181036036 CTGTAATAACAGCTAAGTCTTGG - Intergenic
966769011 3:183487248-183487270 CTGTAAGAAGAGCTGAGGCCAGG + Intergenic
967545710 3:190724643-190724665 CTGTAACTAAATCTGAGTCGTGG - Intergenic
967796061 3:193600016-193600038 CTGTAATAACAGCTGAGTGTTGG - Intronic
968195795 3:196705159-196705181 CAGTATATACAGCAAAGTCCTGG - Intronic
1202741681 3_GL000221v1_random:62133-62155 CTGTAACTATAGCTGAGTCCTGG + Intergenic
969502755 4:7563363-7563385 CTGGAAATAAAACTGAGGCCCGG + Intronic
970144830 4:13024512-13024534 CTGTAACAATAGCTGAGTCTTGG - Intergenic
970699621 4:18720249-18720271 CTGTAACAATAGCTGAGTCTTGG + Intergenic
971221845 4:24716106-24716128 CTGTAATCCCAGCTGATTCCAGG - Intergenic
971339781 4:25757544-25757566 CTGGAAATACTGCACAGTCCAGG + Exonic
971600588 4:28586592-28586614 CTGTAACAATAGCTGAGTCTTGG + Intergenic
973362629 4:49179029-49179051 CTGTAACTATAGCTGAGTCCTGG - Intergenic
973398474 4:49617824-49617846 CTGTAACTATAGCTGAGTCCTGG + Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
975811420 4:78174060-78174082 CTGAACACACAGCTGAATCCGGG + Intronic
977522669 4:98104987-98105009 CTGTAACAATAGCTGAGTCTTGG + Intronic
978255133 4:106683955-106683977 CTGTAACAATAGCTGAGTCTTGG + Intergenic
978581932 4:110240356-110240378 CTGTAGATATACCTGTGTCCAGG - Intergenic
978885165 4:113760590-113760612 CTGTAAATAGAGATGCCTCCTGG - Intronic
978984206 4:114989055-114989077 CTTTAAATAGGGCTGAGTCAAGG - Intronic
980856582 4:138447720-138447742 CTGTAACAATAGCTGAGTCTTGG + Intergenic
981101327 4:140832373-140832395 CTGTAACAATAGCTGAGTCTTGG + Intergenic
981104563 4:140865723-140865745 CTGTAAGTGCAGCTGTGGCCAGG + Exonic
981233387 4:142386526-142386548 CTGTAACAACAGCTGAGTCTTGG + Intronic
982219420 4:153112095-153112117 CTGTAAAGACAGCTGTGAGCTGG + Intergenic
982398965 4:154944844-154944866 CTGTAACAATAGCTGAGTCTTGG - Intergenic
982568208 4:157014058-157014080 CTGTAACAAAAGCTGAGTCTTGG - Intergenic
984596864 4:181679096-181679118 CTGTAACAAAAGCTGAGTCTTGG + Intergenic
985354877 4:189108114-189108136 CTGTAACTTTAGCTGAGTCTTGG + Intergenic
985779453 5:1862536-1862558 TTGGAAATTCAGCTGAGCCCAGG + Intergenic
986225907 5:5812444-5812466 CTGTAACAATAGCTGAGTCTTGG - Intergenic
988224805 5:28399376-28399398 CTGTAACAATAGCTGAGTCTTGG + Intergenic
989823651 5:45827306-45827328 CTGTAACTACAGCTGGGGCAGGG + Intergenic
990082104 5:51929631-51929653 CTGTAACAACAGCTGAGTCTTGG + Intergenic
990307774 5:54510001-54510023 CTGTAACAACAGCTGAGTTTTGG - Intergenic
990683663 5:58275582-58275604 CTGTAAAAGTAGCTGAGTCTTGG + Intergenic
992488570 5:77219091-77219113 CTGTAAATTCTGCTGAGTGCAGG - Intronic
993400643 5:87446150-87446172 ATGTAAATACGACAGAGTCCTGG + Intergenic
994352599 5:98764105-98764127 TTGTATATACAGGTGAGTGCGGG + Intergenic
994562449 5:101393731-101393753 CTGTAACAATAGCTGAGTCTTGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
994707677 5:103225059-103225081 CTGTAACAATAGCTGAGTCTTGG + Intergenic
996474855 5:123905292-123905314 CTGTAACAACAGCTGAGTCTTGG + Intergenic
996679763 5:126219245-126219267 CTGTAAATCCATCAGATTCCAGG - Intergenic
996848372 5:127926175-127926197 CTGTAACAATAGCTGAGTCTTGG - Intergenic
998427041 5:142037515-142037537 CTGTAACAATAGCTGAGTCTTGG - Intergenic
998543326 5:143004174-143004196 CTATAACAACAGCTGAGTCTTGG - Intronic
999504520 5:152181050-152181072 CTGTAAAGACATCTGAGACTGGG + Intergenic
1001510318 5:172316229-172316251 CTGTAACAATAGCTGAGTCCTGG + Intergenic
1002024192 5:176385578-176385600 TTGTAAATCCACCTGAGGCCCGG - Intronic
1002327552 5:178419773-178419795 CTGTAACAACAGCTGAGTCTTGG + Intronic
1003946711 6:11082815-11082837 CTGAAAATACACCTGAAGCCTGG - Intergenic
1004327268 6:14686698-14686720 CTGTAAAAACAGATGAAGCCTGG + Intergenic
1004548249 6:16620709-16620731 CTGTAAATACACCTGTGCCATGG - Intronic
1008095511 6:47335787-47335809 CTGTAACAATAGCTGAGTCTTGG - Intergenic
1008231616 6:48990282-48990304 CTGTGAATCTGGCTGAGTCCAGG - Intergenic
1009666340 6:66685887-66685909 CTGTAACAATAGCTGAGTCTTGG + Intergenic
1010720516 6:79278181-79278203 TGGAAATTACAGCTGAGTCCTGG - Intergenic
1011674960 6:89723798-89723820 TTCTAAATACAGCTGAGTAGAGG + Intronic
1011836161 6:91433859-91433881 CTGTGAAAGCATCTGAGTCCCGG + Intergenic
1012261204 6:97089654-97089676 CTGTAATCCCAGCTGAGGCCTGG + Intronic
1012470902 6:99571309-99571331 CTGTGAAGAAAGCTGAGGCCAGG + Intergenic
1013267324 6:108512520-108512542 CTGTAAAAACAGCAGCCTCCAGG - Intronic
1013375152 6:109507836-109507858 CTGTAACAATAACTGAGTCCTGG + Intronic
1013824530 6:114195523-114195545 CACTAAATACACCTGTGTCCAGG + Intronic
1014263275 6:119245537-119245559 CTGGAAGTACAGCTGATTCAAGG + Intronic
1014889317 6:126823337-126823359 CTATAAAGACAGCTCATTCCAGG - Intergenic
1016848985 6:148597474-148597496 CTGTAACAATAGCTGAGTCTTGG - Intergenic
1017263032 6:152409639-152409661 CTTTAGATACAGCTGATTTCAGG + Exonic
1018190623 6:161306527-161306549 CTGTATATAAAGCTGGGTCAGGG - Intergenic
1018197314 6:161366655-161366677 CTGTAACAACAGCTGGGTCTTGG + Intronic
1018816015 6:167331718-167331740 CTGTAACAATCGCTGAGTCCTGG + Intronic
1018968130 6:168504574-168504596 CTGTAAATACAGATGAATACAGG + Intronic
1019295878 7:274321-274343 CTGTAACAATAGCTGAGTCTTGG + Intergenic
1020104884 7:5418148-5418170 CTGTGAGGACAACTGAGTCCAGG + Intronic
1020836801 7:13163770-13163792 CTGTAATAATAGCTGAGTCTTGG + Intergenic
1020860089 7:13481691-13481713 CTGTAACAATAGCTGAGTCTTGG + Intergenic
1021786028 7:24153509-24153531 CTGTAACAATAGCTGAGTCTTGG + Intergenic
1023212097 7:37817270-37817292 CTGTAACAATAGCTGAGTCTTGG + Intronic
1023981384 7:45072640-45072662 CTGTAAATACAGCAGTGGGCTGG + Intronic
1024688737 7:51776425-51776447 CTGGAGATCCAGCTGATTCCAGG - Intergenic
1024997248 7:55281299-55281321 CTGTAACAATAGCTGAGACCTGG - Intergenic
1025959797 7:66209961-66209983 CTGAAAATACACCTGGGGCCAGG - Intronic
1027489763 7:78808549-78808571 ATGAAAATACAGCTGAGGCTGGG - Intronic
1027960605 7:84940901-84940923 CTGTAACAACAGCTGAGTGTTGG + Intergenic
1028539152 7:91923378-91923400 CTGTAACAATAGCTGAGTCTTGG - Intergenic
1028637327 7:93004282-93004304 CTGTAACAATAGCTGAGTCTTGG + Intergenic
1029047641 7:97646575-97646597 CTGTAAATACAGATGATACTTGG + Intergenic
1030025447 7:105319699-105319721 CTGTAAATACAGCTGAGTCCTGG + Intronic
1031198413 7:118646298-118646320 CTGTAACAATAGCTGAGTCTTGG - Intergenic
1031977418 7:128102969-128102991 CTAAAAGTGCAGCTGAGTCCTGG + Intergenic
1032671311 7:134085064-134085086 CTGTAACAATAGCTGAGTCTTGG - Intergenic
1033088430 7:138363518-138363540 CTGTAACAATCGCTGAGTCCTGG - Intergenic
1035558216 8:583504-583526 CTGTAACAATAGCTGAGTCTTGG - Intergenic
1036189774 8:6659705-6659727 CTGTAACAATAGCTGAGTCTCGG - Intergenic
1036623706 8:10446686-10446708 CTGTAACGATAGCTGAGTCTTGG - Intergenic
1037142407 8:15534932-15534954 CTGTAACAACAGCTGAGTATTGG - Intronic
1037249249 8:16873902-16873924 CTGTAAATCCATCTGATCCCAGG + Intergenic
1037396867 8:18452466-18452488 CTGTAACAATAGCTGAGTCTTGG + Intergenic
1038858819 8:31362973-31362995 CTGTAACAATAGCTGAGTCTTGG - Intergenic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1039301958 8:36219286-36219308 CTGTAACAATAGCTGAGTCTTGG - Intergenic
1042034262 8:64514017-64514039 CTGTAACAACAGCTGAGTCTTGG + Intergenic
1045007030 8:97925258-97925280 CTGTAACAATAGCTGAGTCTTGG - Intronic
1045044169 8:98258622-98258644 CTGTAAAAATAGGTGAGTCTTGG + Intronic
1045675346 8:104601283-104601305 CTTTAAATCAAGTTGAGTCCGGG - Intronic
1046898780 8:119501408-119501430 CTGTAACAACAGCTGAGTCTCGG - Intergenic
1047901651 8:129429715-129429737 CTGTAACAATAGCTGAGTGCTGG + Intergenic
1050548724 9:6730884-6730906 CTGTAACAAGAGCTGAGTCTTGG - Intronic
1050928247 9:11293341-11293363 CTGTAAATCCATCTGACCCCTGG + Intergenic
1051009731 9:12396765-12396787 CTTTAAGCACAGCTGAGTCTAGG + Intergenic
1055049712 9:71966024-71966046 CTGTAACAATAGCTGAGTCTTGG + Intronic
1055979253 9:81985764-81985786 CTGTAACAACAGCTGAGTGTTGG - Intergenic
1059266084 9:113032166-113032188 CTGTAACAATAGCTGAGTCTTGG - Intergenic
1059902643 9:118945401-118945423 CAGTAAATGGATCTGAGTCCTGG + Intergenic
1061567407 9:131451102-131451124 TAGAAAATACAGCTGAGGCCGGG + Intronic
1061575055 9:131501159-131501181 CTGTAAATACAGTTGCCTGCAGG + Intergenic
1203691757 Un_GL000214v1:48716-48738 CTGTAACTATAGCTGAGTCCTGG - Intergenic
1203710313 Un_KI270742v1:92057-92079 CTGTAACTATAGCTGAGTCCTGG + Intergenic
1203644538 Un_KI270751v1:55475-55497 CTGTAACTATAGCTGAGTCCTGG + Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186736866 X:12474842-12474864 CTGTGAATCCATCTGGGTCCTGG - Intronic
1186893548 X:13983815-13983837 CTGTAACAATAGCTGAGTCTCGG + Intergenic
1187121678 X:16413828-16413850 ATGTAAATACAGTTGACTCTTGG - Intergenic
1188842193 X:35030039-35030061 CAGTAAATAATGCTGAGTACAGG - Intergenic
1189622817 X:42861161-42861183 CTGTAACAATAGCTGAGTCTTGG + Intergenic
1190552497 X:51599227-51599249 CTGTAACAATAGCTGAGTCTTGG - Intergenic
1191084917 X:56555382-56555404 CTGTAACAATAGCTGAGTCTTGG + Intergenic
1191199858 X:57768841-57768863 CTGTAACAAAAGCTGTGTCCTGG + Intergenic
1191789749 X:64957112-64957134 CTGTAACAATAGCTGAGTCTTGG + Intronic
1193957014 X:87876157-87876179 CTGTAACAATAGCTGAGTCTTGG - Intergenic
1194806546 X:98335811-98335833 CTGTAACTACAGATGAGACCAGG - Intergenic
1196344423 X:114636259-114636281 CTGTGAATCCAGCTGATTCAAGG + Intronic
1198233255 X:134713804-134713826 GTGTAGACACACCTGAGTCCAGG - Intronic
1199173034 X:144753946-144753968 CTGTAAATACACCTGGTCCCGGG + Intergenic
1202262712 Y:22986243-22986265 CTGTCAATAAATCTGAGTGCTGG - Intronic
1202415702 Y:24619984-24620006 CTGTCAATAAATCTGAGTGCTGG - Intronic
1202455085 Y:25050102-25050124 CTGTCAATAAATCTGAGTGCTGG + Intronic