ID: 1030033359

View in Genome Browser
Species Human (GRCh38)
Location 7:105388584-105388606
Sequence GCGGCCGCGGGCGCCCCCGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 244}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030033343_1030033359 17 Left 1030033343 7:105388544-105388566 CCCGCCCGCCGGCCCGGGGACCC 0: 1
1: 0
2: 3
3: 58
4: 496
Right 1030033359 7:105388584-105388606 GCGGCCGCGGGCGCCCCCGACGG 0: 1
1: 0
2: 3
3: 20
4: 244
1030033344_1030033359 16 Left 1030033344 7:105388545-105388567 CCGCCCGCCGGCCCGGGGACCCG 0: 1
1: 0
2: 6
3: 61
4: 409
Right 1030033359 7:105388584-105388606 GCGGCCGCGGGCGCCCCCGACGG 0: 1
1: 0
2: 3
3: 20
4: 244
1030033337_1030033359 29 Left 1030033337 7:105388532-105388554 CCGGGGGACCAGCCCGCCCGCCG 0: 1
1: 0
2: 1
3: 20
4: 214
Right 1030033359 7:105388584-105388606 GCGGCCGCGGGCGCCCCCGACGG 0: 1
1: 0
2: 3
3: 20
4: 244
1030033349_1030033359 5 Left 1030033349 7:105388556-105388578 CCCGGGGACCCGGACAACTTTCC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1030033359 7:105388584-105388606 GCGGCCGCGGGCGCCCCCGACGG 0: 1
1: 0
2: 3
3: 20
4: 244
1030033336_1030033359 30 Left 1030033336 7:105388531-105388553 CCCGGGGGACCAGCCCGCCCGCC 0: 1
1: 0
2: 1
3: 24
4: 247
Right 1030033359 7:105388584-105388606 GCGGCCGCGGGCGCCCCCGACGG 0: 1
1: 0
2: 3
3: 20
4: 244
1030033352_1030033359 -4 Left 1030033352 7:105388565-105388587 CCGGACAACTTTCCCCTGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1030033359 7:105388584-105388606 GCGGCCGCGGGCGCCCCCGACGG 0: 1
1: 0
2: 3
3: 20
4: 244
1030033346_1030033359 13 Left 1030033346 7:105388548-105388570 CCCGCCGGCCCGGGGACCCGGAC 0: 1
1: 0
2: 4
3: 20
4: 183
Right 1030033359 7:105388584-105388606 GCGGCCGCGGGCGCCCCCGACGG 0: 1
1: 0
2: 3
3: 20
4: 244
1030033350_1030033359 4 Left 1030033350 7:105388557-105388579 CCGGGGACCCGGACAACTTTCCC 0: 1
1: 0
2: 1
3: 7
4: 94
Right 1030033359 7:105388584-105388606 GCGGCCGCGGGCGCCCCCGACGG 0: 1
1: 0
2: 3
3: 20
4: 244
1030033341_1030033359 21 Left 1030033341 7:105388540-105388562 CCAGCCCGCCCGCCGGCCCGGGG 0: 1
1: 2
2: 31
3: 165
4: 841
Right 1030033359 7:105388584-105388606 GCGGCCGCGGGCGCCCCCGACGG 0: 1
1: 0
2: 3
3: 20
4: 244
1030033348_1030033359 9 Left 1030033348 7:105388552-105388574 CCGGCCCGGGGACCCGGACAACT 0: 1
1: 0
2: 1
3: 9
4: 80
Right 1030033359 7:105388584-105388606 GCGGCCGCGGGCGCCCCCGACGG 0: 1
1: 0
2: 3
3: 20
4: 244
1030033347_1030033359 12 Left 1030033347 7:105388549-105388571 CCGCCGGCCCGGGGACCCGGACA 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1030033359 7:105388584-105388606 GCGGCCGCGGGCGCCCCCGACGG 0: 1
1: 0
2: 3
3: 20
4: 244
1030033351_1030033359 -3 Left 1030033351 7:105388564-105388586 CCCGGACAACTTTCCCCTGCGCG 0: 1
1: 0
2: 1
3: 6
4: 46
Right 1030033359 7:105388584-105388606 GCGGCCGCGGGCGCCCCCGACGG 0: 1
1: 0
2: 3
3: 20
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030033359 Original CRISPR GCGGCCGCGGGCGCCCCCGA CGG Intronic