ID: 1030042866

View in Genome Browser
Species Human (GRCh38)
Location 7:105467725-105467747
Sequence CTGAGTAAGCACCTCTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 157}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030042866_1030042873 18 Left 1030042866 7:105467725-105467747 CCCAGAGAGAGGTGCTTACTCAG 0: 1
1: 0
2: 1
3: 8
4: 157
Right 1030042873 7:105467766-105467788 CACTTGTAATCCCAGCACTTTGG 0: 3259
1: 78498
2: 212768
3: 251853
4: 202767
1030042866_1030042871 -9 Left 1030042866 7:105467725-105467747 CCCAGAGAGAGGTGCTTACTCAG 0: 1
1: 0
2: 1
3: 8
4: 157
Right 1030042871 7:105467739-105467761 CTTACTCAGGCCGGGCACAGTGG No data
1030042866_1030042874 19 Left 1030042866 7:105467725-105467747 CCCAGAGAGAGGTGCTTACTCAG 0: 1
1: 0
2: 1
3: 8
4: 157
Right 1030042874 7:105467767-105467789 ACTTGTAATCCCAGCACTTTGGG 0: 3400
1: 85962
2: 310992
3: 242116
4: 148921
1030042866_1030042875 22 Left 1030042866 7:105467725-105467747 CCCAGAGAGAGGTGCTTACTCAG 0: 1
1: 0
2: 1
3: 8
4: 157
Right 1030042875 7:105467770-105467792 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
1030042866_1030042877 28 Left 1030042866 7:105467725-105467747 CCCAGAGAGAGGTGCTTACTCAG 0: 1
1: 0
2: 1
3: 8
4: 157
Right 1030042877 7:105467776-105467798 CCCAGCACTTTGGGAGGCCAAGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030042866 Original CRISPR CTGAGTAAGCACCTCTCTCT GGG (reversed) Intronic
903994138 1:27294788-27294810 CTGAGCTAGGACATCTCTCTGGG - Intronic
905392855 1:37649057-37649079 CTGAGTCACCACCCCTCACTGGG - Intergenic
906176119 1:43774437-43774459 CTGAGGGAGCTCCACTCTCTGGG + Intronic
906672431 1:47666091-47666113 CTGACTAGGCACCTGTCTCATGG - Intergenic
907818214 1:57940814-57940836 CTTGGTAAGCAACTGTCTCTAGG - Intronic
914680363 1:149934648-149934670 CTGAGGAAGCCCCCTTCTCTAGG - Intronic
914790039 1:150869560-150869582 CAGAGTGAGCCCCTGTCTCTAGG - Intronic
915921520 1:159979251-159979273 CTTCTTAATCACCTCTCTCTAGG + Intergenic
919448962 1:197747057-197747079 CTGAGTAAGCTCCTTCCACTGGG + Intronic
922977643 1:229798588-229798610 CTGGGTGGGCACCTCTCTCGGGG + Intergenic
924468601 1:244319862-244319884 CTGAGTCAGGGCCTCTCTCATGG - Intergenic
1064113716 10:12559957-12559979 GTGAGTTAGCACCTCTGTCATGG + Intronic
1067785366 10:49241906-49241928 CTGAGAAAGGGCCTCTCTCTAGG - Intergenic
1067841264 10:49681183-49681205 CTGATTCAGCACCTCTGTCTAGG - Intronic
1071853555 10:89600213-89600235 CTGTGTAAGCACCTCTTTCTTGG - Intronic
1072080202 10:92022436-92022458 CAGGGTAAGACCCTCTCTCTAGG - Intronic
1072251257 10:93584015-93584037 CTGAGTAAGGATATCGCTCTAGG - Intronic
1073629840 10:105137278-105137300 CTTAATAACCACCTCTCTATAGG - Intronic
1075346864 10:121688720-121688742 CTGGGTAAGTACCTCTCTGTGGG + Intergenic
1075861446 10:125680206-125680228 CTGAGTCAACACTTCCCTCTCGG + Intronic
1076599254 10:131646508-131646530 GTGGGTAAGCGCCTCTCACTGGG - Intergenic
1080744779 11:35098994-35099016 CAGAGCAAGCACCTCTGTCTGGG - Intergenic
1080925712 11:36753954-36753976 CTGTGTGAGCACCTAGCTCTGGG - Intergenic
1086113087 11:83219572-83219594 AGGAGTAAGCCCCTCTCTCAAGG + Intronic
1089659995 11:119979486-119979508 CTGAGTGAGCCCCTCCCTTTCGG - Intergenic
1089777360 11:120847775-120847797 CTGAGTTAGCACCTTTAGCTTGG + Intronic
1091846039 12:3657012-3657034 CTGCTTCAGCACCTCTCTGTGGG - Intronic
1092919927 12:13222228-13222250 ATGACTAAGCCCCTCTCCCTGGG - Intergenic
1098956785 12:76696435-76696457 AGGAGTAAGCTCCTCTCTCAAGG + Intergenic
1100479697 12:94966041-94966063 CAGAGTAAGAACCTGTGTCTGGG + Intronic
1102338636 12:112104085-112104107 CTGAGTTAGGACATTTCTCTTGG - Intronic
1104496180 12:129241577-129241599 CTGATTAAGCACCACTTCCTTGG + Intronic
1104946120 12:132415579-132415601 CTGAGGCAGCAGCTCCCTCTCGG + Intergenic
1105676850 13:22680935-22680957 CTGGCCAAGCACCTCTCTCCAGG - Intergenic
1106277625 13:28228099-28228121 CTGAGTAGGCACATTGCTCTGGG - Intronic
1106385569 13:29282234-29282256 CAGAGGCAGCACTTCTCTCTGGG - Intronic
1111896561 13:94149680-94149702 CTGACTAAGCATTTTTCTCTAGG - Intronic
1119763614 14:77173376-77173398 CTGAGTAAGCTCCTTCCACTGGG + Intronic
1120611519 14:86646847-86646869 CTGATTAAGAGCCTATCTCTTGG + Intergenic
1125202139 15:37109568-37109590 CTAAGTAAACACAGCTCTCTGGG - Intergenic
1125466748 15:39960690-39960712 TTCAGTCAGCCCCTCTCTCTGGG - Intronic
1128183358 15:65624105-65624127 CGGAGTAACCACCTCTCTTGCGG - Exonic
1130537359 15:84796978-84797000 CAGAGTGAGAACCTGTCTCTTGG - Intronic
1131102773 15:89706288-89706310 CTGAGTAATACCCTCTCTTTCGG - Intronic
1132486861 16:197729-197751 CTGAGTGAGCAGCTCTTTCCTGG + Intronic
1132591758 16:729165-729187 CTGAGTGAGCATCTCTGGCTTGG + Intronic
1133742014 16:8658901-8658923 CCGAGAATGCACCACTCTCTTGG + Intergenic
1135862240 16:26067274-26067296 CTGATTCAGAACTTCTCTCTAGG - Intronic
1137640472 16:50024735-50024757 TTAAGTAAACACTTCTCTCTTGG - Exonic
1141603541 16:85140302-85140324 CTGAGTTAGAACCCCTCTTTTGG - Intergenic
1142980289 17:3667679-3667701 CTGGCTGAGCACTTCTCTCTGGG + Intronic
1143205505 17:5137432-5137454 CTGGGCAAGCCCCTCTCTCCAGG + Intronic
1145111739 17:20169683-20169705 CAGAGCAAGCCCCTGTCTCTTGG - Intronic
1146456648 17:33014384-33014406 CTGAGTCCTGACCTCTCTCTTGG + Intronic
1146630815 17:34468031-34468053 ATGAGAGATCACCTCTCTCTAGG - Intergenic
1146843123 17:36168362-36168384 CTGGGCAAGCCCCTCTCTCCAGG - Intronic
1146855428 17:36256303-36256325 CTGGGCAAGCCCCTCTCTCCAGG - Intronic
1146865193 17:36332072-36332094 CTGGGCAAGCCCCTCTCTCCAGG + Intronic
1146871334 17:36380214-36380236 CTGGGCAAGCCCCTCTCTCCAGG - Intronic
1146878694 17:36431296-36431318 CTGGGCAAGCCCCTCTCTCCAGG - Intronic
1147068053 17:37932666-37932688 CTGGGCAAGCCCCTCTCTCCAGG + Intronic
1147074220 17:37980838-37980860 CTGGGCAAGCCCCTCTCTCCAGG - Intronic
1147079583 17:38012221-38012243 CTGGGCAAGCCCCTCTCTCCAGG + Intronic
1147085742 17:38060376-38060398 CTGGGCAAGCCCCTCTCTCCAGG - Intronic
1147095524 17:38136163-38136185 CTGGGCAAGCCCCTCTCTCCAGG + Intergenic
1147101689 17:38184342-38184364 CTGGGCAAGCCCCTCTCTCCAGG - Intergenic
1149846286 17:60010852-60010874 CTGGGCAAGCCCCTCTCTCCAGG - Intergenic
1149999643 17:61425755-61425777 TTGAGTAAGCATCTCCCACTGGG + Intergenic
1150084636 17:62267427-62267449 CTGGGCAAGCCCCTCTCTCCAGG - Intergenic
1151918653 17:77137870-77137892 CTGATGAATCAGCTCTCTCTAGG - Intronic
1153410095 18:4783168-4783190 CTGAGTTATCCCATCTCTCTAGG + Intergenic
1153915875 18:9743686-9743708 CTGAGTCACCACCACCCTCTGGG + Intronic
1158306008 18:56106326-56106348 CTGAGTTGGCAGCTCTCTGTGGG - Intergenic
1158837780 18:61349285-61349307 CTGGGAAAGCACCAATCTCTAGG - Intronic
1161577687 19:5063959-5063981 CTGAGACAGCAGCTCTCTGTTGG + Intronic
1162042683 19:7980058-7980080 CTCAGGGAGCACCTTTCTCTGGG + Intronic
1162502951 19:11064936-11064958 CTGAGTCAGCACCTCTGCCCGGG + Intronic
1162668013 19:12231381-12231403 CTGAGTAATCCTCTCTCTTTAGG - Intronic
1163417575 19:17195725-17195747 CTGAGGAGCCACCTCTCTCAAGG - Intronic
1166199854 19:41230290-41230312 ATGAGTATGTATCTCTCTCTGGG + Intronic
1166713086 19:44949439-44949461 CTGAGTCAGCCCCTCCATCTTGG - Exonic
925632242 2:5906522-5906544 CTGAGCAAGCAGCTCTCCCATGG + Intergenic
926532622 2:14069574-14069596 AGGAGAAAGCACCTCTATCTTGG + Intergenic
929369330 2:41202966-41202988 CTTACTAAACACCTTTCTCTCGG - Intergenic
930998583 2:57753434-57753456 CTCTGTAAGCACCTCTTTCTGGG - Intergenic
932357152 2:71076375-71076397 CTGAGTGAGCACCTCTGTACAGG + Intronic
932423498 2:71614824-71614846 CTGAGGAGGAATCTCTCTCTTGG + Intronic
933714658 2:85351131-85351153 CAGAGTGAGCAGCTCACTCTGGG - Intronic
946493528 2:220172669-220172691 ATTAGTAAGCCCCTCTCTCAAGG - Intergenic
947276780 2:228401203-228401225 CTGTGTAAGCACCTATCTGCTGG - Intergenic
947627557 2:231629831-231629853 CCGAGTAAGACCCTGTCTCTTGG - Intergenic
948188376 2:236039421-236039443 CAGAGCAAGACCCTCTCTCTAGG + Intronic
1172678115 20:36689685-36689707 CTGGGTCAGCACCTTTCCCTTGG + Intronic
1175331472 20:58167721-58167743 GGGAGCAAGCAGCTCTCTCTGGG - Intergenic
1178990699 21:37353212-37353234 CTGAGTTTACACCTCTGTCTTGG - Intergenic
1180181628 21:46120832-46120854 CTGCCTAAGCACCCCTATCTTGG - Intronic
1183732351 22:39625771-39625793 CTAAGTCACCGCCTCTCTCTGGG + Intronic
1183995994 22:41632804-41632826 CAGAGTAAGACCCTGTCTCTTGG + Intronic
1184325802 22:43783377-43783399 CTGAGCACACACCTCTCCCTGGG - Intronic
1184533097 22:45069508-45069530 CTGAGTCAGGGGCTCTCTCTGGG + Intergenic
949220677 3:1630141-1630163 CTGAGTAAATCTCTCTCTCTAGG - Intergenic
949496285 3:4635298-4635320 CTGAGTTAGCACCTTTCTAAAGG - Intronic
950330208 3:12150238-12150260 CAGAGGAAACACATCTCTCTAGG - Intronic
952675618 3:36026816-36026838 CTGAGTAATCACCCATCTCGAGG + Intergenic
952945198 3:38474291-38474313 CAGAGTAACCTCCTCTCTCCAGG - Intronic
954711441 3:52506920-52506942 CTGACTTAGCGCCTCTCCCTGGG - Intronic
956039112 3:65127697-65127719 CAGTGAAATCACCTCTCTCTAGG - Intergenic
957181563 3:76885725-76885747 CTGCCTAAGAATCTCTCTCTGGG + Intronic
957916689 3:86695428-86695450 AGGAGTAAGCCCCTCTCTCAAGG + Intergenic
960206189 3:114902533-114902555 CTGAGCAAACACCTATCTTTAGG + Intronic
962047568 3:131776794-131776816 TTGATTAAGGACCTCTCTTTAGG + Intronic
962326875 3:134441727-134441749 ATGAGTATGCACCTCTTGCTAGG - Intergenic
962667532 3:137670135-137670157 CTCAGTCAACACTTCTCTCTTGG - Intergenic
964990347 3:162803082-162803104 CTCAGCCAGCACCACTCTCTAGG + Intergenic
972565280 4:40264046-40264068 CTGAGAAATCAACTCTGTCTAGG - Intergenic
976244681 4:82995281-82995303 CTGGGTAAGATCCTGTCTCTGGG + Intronic
982904461 4:161050127-161050149 CTGAGAAACCAGCTCTGTCTAGG + Intergenic
985215468 4:187649042-187649064 CTCAATGATCACCTCTCTCTTGG + Intergenic
989802305 5:45558251-45558273 GAGAGTTAGCACCTCACTCTGGG - Intronic
990176456 5:53113925-53113947 CTGAGTAAACACCTCTGACGTGG - Intergenic
995835819 5:116398462-116398484 CTGGTTTAGCACCTCTCTCATGG + Intronic
996698986 5:126430108-126430130 CTGAGGAGGAACCTCTCTCAAGG - Intronic
997112898 5:131094772-131094794 CTGAGCCTGCACCTTTCTCTGGG + Intergenic
999366486 5:151027038-151027060 CTGAGAAAGCTCCTCTCACATGG + Intronic
1000936695 5:167310104-167310126 CTGAGTAAGCACTACGCTTTGGG - Intronic
1002440505 5:179262066-179262088 CTGGGAAAACACCTCCCTCTGGG + Intronic
1003950420 6:11110846-11110868 CTGAGTTAGCACCCCTTTGTGGG - Intronic
1004614708 6:17279708-17279730 CAGAGTATGCACCTCTCTAACGG + Intergenic
1005836552 6:29713841-29713863 CTCAGTCAGCACCACTCTCCAGG + Intergenic
1005845221 6:29771808-29771830 CTCAGCCAGCACCACTCTCTGGG + Intergenic
1006066258 6:31464498-31464520 CTCAGCCAGCACCACTCTCTGGG - Intergenic
1006864720 6:37200237-37200259 CTGAGTTTGCACTTTTCTCTGGG - Intergenic
1012234178 6:96793185-96793207 TTTAGTAAGCTCCTCTCACTAGG + Intergenic
1013318323 6:108962370-108962392 TTGAGTAATCACTTCTGTCTGGG + Intronic
1015893803 6:137997135-137997157 CTCAGTATGCAGCACTCTCTGGG - Intergenic
1015917833 6:138235748-138235770 CTGAGAAAGCATTTCTTTCTGGG + Intronic
1018559578 6:165087496-165087518 ATCAGTGAGCACCTCTCTGTGGG - Intergenic
1020375131 7:7477134-7477156 CCGGGTAAGCCCCTCTCTCCTGG + Exonic
1022838524 7:34139965-34139987 GAGAGTAAGAACCTTTCTCTGGG + Intronic
1028114420 7:86981640-86981662 CTCAGGAAGCACCTCCTTCTGGG + Intronic
1029618049 7:101672128-101672150 CTGTGTGCGCACCTCCCTCTGGG - Intergenic
1030042866 7:105467725-105467747 CTGAGTAAGCACCTCTCTCTGGG - Intronic
1033714723 7:143988282-143988304 CTGATTAAGCACTTCCCTCTAGG + Intergenic
1034323888 7:150211679-150211701 GTGGGTGGGCACCTCTCTCTGGG - Intergenic
1035174919 7:157043715-157043737 CTCAGCAGGCACCTCTGTCTGGG + Intergenic
1035389261 7:158494825-158494847 CTGTGTCAGCACCACTCACTTGG + Intronic
1036212758 8:6855443-6855465 CTCTGTATGCCCCTCTCTCTGGG + Intergenic
1037946760 8:22994443-22994465 CTGAGTAGGGCCCTCTATCTGGG + Intronic
1038647334 8:29372834-29372856 CTGGGTAACCAACTGTCTCTGGG - Intergenic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1039912640 8:41836901-41836923 CAGAGTAAGAAGCTATCTCTGGG + Intronic
1044365583 8:91341700-91341722 CAGAGTAAGAGCCTCTCTCATGG + Intronic
1046810760 8:118530856-118530878 CAGAGTAAGTCCCTGTCTCTAGG - Intronic
1048780088 8:137990623-137990645 GGGAGTAAGCCCCTCTCTCAAGG - Intergenic
1049419990 8:142512165-142512187 TTGAGCAAGGCCCTCTCTCTGGG - Intronic
1049529354 8:143146745-143146767 CTGGGCAGGCACCTTTCTCTGGG - Intergenic
1056513463 9:87328129-87328151 CTGAGAGACCACCTATCTCTGGG - Intergenic
1057357169 9:94341156-94341178 CTGAGTAAGACTCTGTCTCTGGG - Intergenic
1058774925 9:108273597-108273619 CTGACTAAGAACCTTTCTCTTGG + Intergenic
1058812879 9:108658332-108658354 CATAGTAAGACCCTCTCTCTAGG - Intergenic
1059280663 9:113130728-113130750 CTGAGAAAGCACCTATTTTTAGG - Intergenic
1061179356 9:129014616-129014638 CTGAGTGACCTCCTATCTCTGGG - Intronic
1187242769 X:17528621-17528643 CTGAGGAACCAAATCTCTCTGGG + Intronic
1189275810 X:39785163-39785185 TTGTGTAATCACCTCACTCTTGG - Intergenic
1190992352 X:55565549-55565571 CTGAGCATGCACCTATCTATAGG - Intergenic
1198111331 X:133505010-133505032 CTGAGTGACCACCTCTGTCCAGG + Intergenic
1201981953 Y:19917952-19917974 AGGAGTAAGCCCCTCTCTCAAGG + Intergenic