ID: 1030045164

View in Genome Browser
Species Human (GRCh38)
Location 7:105488837-105488859
Sequence TTTTCAACACAGAAAGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 587
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 541}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030045164_1030045169 26 Left 1030045164 7:105488837-105488859 CCTAGTTCTTTCTGTGTTGAAAA 0: 1
1: 0
2: 3
3: 42
4: 541
Right 1030045169 7:105488886-105488908 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
1030045164_1030045170 27 Left 1030045164 7:105488837-105488859 CCTAGTTCTTTCTGTGTTGAAAA 0: 1
1: 0
2: 3
3: 42
4: 541
Right 1030045170 7:105488887-105488909 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
1030045164_1030045166 -1 Left 1030045164 7:105488837-105488859 CCTAGTTCTTTCTGTGTTGAAAA 0: 1
1: 0
2: 3
3: 42
4: 541
Right 1030045166 7:105488859-105488881 ACAAAATAGGCAGAGCCCAGTGG 0: 1
1: 0
2: 7
3: 96
4: 1131
1030045164_1030045172 30 Left 1030045164 7:105488837-105488859 CCTAGTTCTTTCTGTGTTGAAAA 0: 1
1: 0
2: 3
3: 42
4: 541
Right 1030045172 7:105488890-105488912 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030045164 Original CRISPR TTTTCAACACAGAAAGAACT AGG (reversed) Intronic
900886690 1:5420260-5420282 TATTAAGCACAGGAAGAACTTGG - Intergenic
903059433 1:20659542-20659564 TTTCAAACACAGCAAAAACTTGG + Intronic
903514456 1:23901300-23901322 TTTTCCACACAGCCAGAGCTGGG - Intronic
903858864 1:26353435-26353457 ATTTCAACACAAATAAAACTAGG + Intronic
904408659 1:30311665-30311687 TTTTAAAAAGAAAAAGAACTGGG - Intergenic
904444927 1:30563074-30563096 TGTTCAACACACCAAGAACCTGG + Intergenic
904490240 1:30854138-30854160 TTAACAAGACAGAAGGAACTTGG - Intergenic
904950580 1:34235291-34235313 TTCTTAACAAAGAAAGAACAAGG + Intergenic
905988022 1:42305560-42305582 TTTTCAACATGGATGGAACTGGG + Intronic
906801369 1:48740150-48740172 TTTAGAACACAGAAAGAAATGGG + Intronic
906933434 1:50191191-50191213 TTGGCAACACAGCAAGAACAAGG - Intronic
907130278 1:52091577-52091599 TTTTAAACACAGAAAAAATATGG - Intergenic
909531745 1:76689836-76689858 TTTTTAAATCAGAGAGAACTGGG - Intergenic
909968080 1:81943230-81943252 TCTTTAACAAAGAAAGAACGAGG + Exonic
910741019 1:90516568-90516590 GATGCAACACAGAAAGAACAGGG + Intergenic
911286405 1:95999042-95999064 CTTTCAAAACAGAAAGCATTAGG + Intergenic
911702887 1:100975320-100975342 TTTTAAAAAAAGAAAGAAATTGG + Exonic
912876755 1:113367718-113367740 TGTTCAACACACAACAAACTAGG + Intergenic
913029181 1:114881298-114881320 TCTTCAAAACAGAAAGAAAATGG - Intronic
913601298 1:120423908-120423930 ATTTCAACATGGAAAGAGCTAGG - Intergenic
913977130 1:143469236-143469258 TTTTAAAAACAGGAATAACTAGG + Intergenic
914071533 1:144294863-144294885 TTTTAAAAACAGGAATAACTAGG + Intergenic
914085746 1:144452687-144452709 ATTTCAACATGGAAAGAGCTAGG + Intronic
914107622 1:144671493-144671515 TTTTAAAAACAGGAATAACTAGG - Intergenic
914191641 1:145416668-145416690 ATTTCAACATGGAAAGAGCTAGG + Intergenic
914362486 1:146947466-146947488 ATTTCAACATGGAAAGAGCTAGG - Intronic
914489184 1:148139631-148139653 ATTTCAACATGGAAAGAGCTAGG + Intronic
914589568 1:149094670-149094692 ATTTCAACATGGAAAGAGCTAGG + Intronic
914897523 1:151690157-151690179 TTTTAAATACATAAAGAAGTTGG + Intronic
915302689 1:154960501-154960523 TTTTAAAAACAGGCAGAACTAGG + Intronic
918370418 1:183855603-183855625 TTGTCAACAGAGAGAGCACTGGG + Intronic
919028841 1:192212902-192212924 TTTTCAAAATACAAAGAACCAGG + Intergenic
919333464 1:196202450-196202472 CTTTCTCCACAGAAACAACTGGG - Intergenic
920189435 1:204183291-204183313 TTTTCAATACTGAAACAACCAGG - Intergenic
921239098 1:213158735-213158757 ATTTTAGCACAGAAAAAACTTGG - Intronic
921806214 1:219458563-219458585 TTTTAAGTACAGAAAGAAGTTGG - Intergenic
922181515 1:223237973-223237995 TTTTCCAAACAGAAAGCACTAGG - Intronic
922305246 1:224338839-224338861 TGTTCAACACACCAAGAACCTGG + Intergenic
922682055 1:227607011-227607033 TTTTCCCCACAGAAAGTATTTGG + Intronic
923354667 1:233142525-233142547 TTTTCCACACAGAGAAGACTGGG - Intronic
923891974 1:238226192-238226214 TATTCTACAAAGAAAAAACTTGG - Intergenic
924364743 1:243280027-243280049 CTTTCAAAACAGAAAGCACCAGG - Intronic
924634404 1:245772071-245772093 TTTCCAAAAGAAAAAGAACTTGG + Intronic
1062876129 10:944330-944352 TTTTCACCACAGGGAGAACCTGG + Intergenic
1063744257 10:8861937-8861959 TATTAAACTCAGAAAGATCTTGG - Intergenic
1063860856 10:10306333-10306355 TTGTTACCACAGAAATAACTTGG + Intergenic
1064275231 10:13899470-13899492 TTTTCTACAGACAAGGAACTTGG + Intronic
1064704184 10:18054422-18054444 CTTCCAAAACAGAAAGTACTGGG + Intergenic
1065332240 10:24614427-24614449 TTTTCAACATTAAAGGAACTAGG + Intronic
1065659955 10:27995713-27995735 TTTTTAACTCAGAATGCACTTGG - Intronic
1066485692 10:35841944-35841966 CTTACAAAACAGAAAGCACTAGG - Intergenic
1066562224 10:36682318-36682340 TTATTAATACACAAAGAACTGGG + Intergenic
1068274585 10:54776911-54776933 GTTTATACAAAGAAAGAACTAGG + Intronic
1069046929 10:63752811-63752833 TGTTCAACACACCAAGAACCTGG + Intergenic
1069111324 10:64450782-64450804 TCTTCAAGACAGAACGCACTGGG + Intergenic
1069253454 10:66301188-66301210 CTTCCAAAACAGAAAGAACCAGG + Intronic
1069437474 10:68398339-68398361 TTTTAATAACAGATAGAACTTGG - Intronic
1070272887 10:74975242-74975264 TTTCCAACAGAGAAACATCTAGG + Intronic
1071340653 10:84644263-84644285 TTTTCAACAAAGAAAAAAACAGG - Intergenic
1071606045 10:86990819-86990841 CTTCCAAAACAGAAAGCACTTGG + Intergenic
1071728710 10:88225922-88225944 TTTTCATCTCACTAAGAACTAGG + Intergenic
1071944464 10:90627003-90627025 TTTTAAAAACAGGAAGAAATTGG + Intergenic
1074232820 10:111554815-111554837 CTTTGAACTCAGAAAGATCTGGG - Intergenic
1074393266 10:113075541-113075563 TTTTAAACACATAAAGTAATTGG - Intronic
1074894678 10:117764953-117764975 TTTTCAAAACAGAGATAAATAGG - Intergenic
1076311541 10:129511303-129511325 TTCTCATCACAGAAAGCACGTGG - Intronic
1077842492 11:5990852-5990874 ACTGCAACACAGAGAGAACTAGG + Intergenic
1078088151 11:8247083-8247105 ATTTCAACAAAGAGAGACCTGGG - Intronic
1078293917 11:10045824-10045846 TTTCCAAAACAGAAAGCACCAGG + Intronic
1078425064 11:11243254-11243276 TCTAAAACACAGAAAGAAATAGG + Intergenic
1078591612 11:12645790-12645812 TTTCCAAAACAGAAAGGACCAGG + Intergenic
1078953419 11:16162196-16162218 CCTTCAAAACAGAAAGAATTAGG + Intronic
1079430491 11:20385023-20385045 TTGTCAACACTGAATGGACTGGG + Intergenic
1080777907 11:35403296-35403318 TTTTATACTCAGAAAGACCTAGG - Intronic
1081057264 11:38425693-38425715 TTATCAAGACAAAAATAACTGGG + Intergenic
1081137633 11:39458773-39458795 ACGTCAACACAGAAATAACTGGG + Intergenic
1081372125 11:42316904-42316926 TTTGGAACACAGAGAGAAATGGG - Intergenic
1083093633 11:60226162-60226184 TTTTCAAAACAGAAAGCACCAGG + Intronic
1084470894 11:69358456-69358478 TTTTCTTCAAGGAAAGAACTGGG - Intronic
1086046935 11:82543881-82543903 AGTTCAACAAAGAAAGAACAGGG + Intergenic
1086891819 11:92267186-92267208 TATTCAAGACAGAAAAAAATGGG + Intergenic
1087047179 11:93851798-93851820 TTTTCAAGGCAGAAAGAAAGGGG - Intergenic
1088278748 11:108116226-108116248 TGTTCAATACACCAAGAACTTGG + Intergenic
1088465504 11:110132592-110132614 TCTTGAACACAAAAGGAACTGGG - Intronic
1088680141 11:112233582-112233604 TTTCAAACACAGAAAGAAACTGG - Exonic
1088843145 11:113643504-113643526 TTTTCAGCACATAAAGAAGGGGG + Intergenic
1089229410 11:116958670-116958692 ATTTCACTACAGAGAGAACTGGG + Intronic
1090102208 11:123810886-123810908 TTTTCAACAGGGAAAGGACAGGG - Intergenic
1090841554 11:130493115-130493137 CTTTCAAAACAGAAAGAACCAGG - Intergenic
1091421986 12:349631-349653 ATTTTATAACAGAAAGAACTAGG + Intronic
1091506277 12:1072666-1072688 ATTAAAACACAGAAAGGACTTGG - Intronic
1092527971 12:9321271-9321293 ATTTTAACATAGAAAGAAATAGG - Intergenic
1093111101 12:15153217-15153239 TTTTCCTAAAAGAAAGAACTGGG + Intronic
1093133960 12:15427182-15427204 TTTTCCAGATAGAAAGAACAGGG - Intronic
1093567547 12:20626309-20626331 GTTTAAAAACAGAAAGAATTAGG - Intronic
1093610164 12:21146076-21146098 TTTCCAAAACAGAAAGAAACAGG - Intronic
1093665474 12:21807721-21807743 TTTGGAAGACAGAAAGATCTTGG + Intronic
1093784332 12:23175169-23175191 TTTTAAAAAGAGAAAGGACTGGG - Intergenic
1094101859 12:26773104-26773126 TTTTCAACACTGTAAGATCTTGG - Intronic
1094288495 12:28819552-28819574 TGTTCAAAACACCAAGAACTTGG - Intergenic
1095166835 12:38983011-38983033 TGTTCAAAACACCAAGAACTTGG - Intergenic
1097869869 12:64592637-64592659 ATCTCAAAACAGAAAAAACTTGG - Intergenic
1098131002 12:67349668-67349690 TTTTAAGCACAGAAATTACTAGG + Intergenic
1098215222 12:68209071-68209093 TTTTGAACACATAAGGAAATTGG - Intronic
1098360835 12:69653156-69653178 TTTTCATGACAGAAAAAAGTTGG - Intronic
1098414858 12:70221290-70221312 CTTTGAAGTCAGAAAGAACTGGG + Intergenic
1098555097 12:71809757-71809779 TTTTCCACAAAGCAACAACTAGG + Intergenic
1098915725 12:76255008-76255030 TTTTCAACATGGAAAGAAACAGG - Intergenic
1099465939 12:82988217-82988239 TTTGCAACTCAGAAAGCAGTTGG + Intronic
1099889665 12:88575428-88575450 TTTTCTATAGAGAAAGAAATAGG + Intronic
1100088899 12:90946373-90946395 TTTCAAACACAAAAAGGACTTGG - Intronic
1100769715 12:97908483-97908505 ATTACAAGATAGAAAGAACTAGG - Intergenic
1101924948 12:108963839-108963861 TATTTAACACAGAAGGCACTGGG + Intronic
1102258798 12:111430955-111430977 TTTTCCATTCACAAAGAACTGGG - Intronic
1103235133 12:119366378-119366400 TTTTGAAGACAGACAGAGCTGGG - Intronic
1103483908 12:121269746-121269768 ATTTAAAAACAGAAAGATCTGGG + Intronic
1104809019 12:131609313-131609335 TTTTCCAAACAAAAAGAAGTTGG + Intergenic
1105020632 12:132814333-132814355 TTTTAACAACAGAAAGAACTGGG + Intronic
1105410358 13:20166788-20166810 AGTGCTACACAGAAAGAACTAGG - Intergenic
1105503982 13:20994386-20994408 TTTTAAACACTGAAGGAAATGGG + Intronic
1106107104 13:26742512-26742534 TTTTCAAAACAGAGAGAAATAGG + Intergenic
1106466946 13:30021945-30021967 TTTTAAACAGAGTAAGATCTAGG + Intergenic
1106877733 13:34093008-34093030 AATTCAGCACAGAAAGAAATGGG + Intergenic
1107070090 13:36259366-36259388 TGTTCAATACACCAAGAACTTGG - Intronic
1107077990 13:36344548-36344570 ATCTCAACACAGAAAGAAAAAGG + Intronic
1107094535 13:36520669-36520691 TTTTAAAGACAGAAAGATTTGGG + Intergenic
1107488697 13:40858463-40858485 TTTTAGACACTGAGAGAACTAGG - Intergenic
1107607898 13:42079928-42079950 TTTTTAATACACAAATAACTTGG + Intronic
1108220758 13:48231689-48231711 ATTTTAACACAGAACGAAGTAGG + Intergenic
1108245035 13:48505521-48505543 TTTTCAACAAATAAAGAAAATGG + Intronic
1108338923 13:49476894-49476916 ATTTCATTACAGAAAGAAATGGG - Exonic
1109109463 13:58297666-58297688 ATTTCAAGACTGTAAGAACTTGG - Intergenic
1109734207 13:66459980-66460002 TTTTCAAGACAAAAAGAATGAGG + Intronic
1109810213 13:67503555-67503577 TTTACATGACAGAAAGAAATTGG - Intergenic
1109978069 13:69868149-69868171 TATTTAACACATAAAGAAATTGG - Intronic
1110025224 13:70529320-70529342 TGTTCCACACAAAGAGAACTAGG - Intergenic
1110054000 13:70941588-70941610 TATACAACACTGAAAGACCTTGG + Intergenic
1110214832 13:73013983-73014005 TTTTCAAAACAGAAAGCACTAGG + Intronic
1110418064 13:75273771-75273793 TGTTCAAGACACCAAGAACTGGG - Intergenic
1110431723 13:75432040-75432062 TTTTCACCAAAGAATGGACTTGG - Intronic
1110897929 13:80779739-80779761 TTTTTAAGACTGAAAGCACTGGG - Intergenic
1111224651 13:85253614-85253636 TTTTCACAACAGCAAAAACTTGG + Intergenic
1111433485 13:88176209-88176231 CTCTCAGCAAAGAAAGAACTGGG + Intergenic
1111994369 13:95149757-95149779 TGCGGAACACAGAAAGAACTGGG + Intronic
1112079503 13:95953722-95953744 TTTTCTACAAAAAAAAAACTTGG + Intronic
1112798918 13:103089153-103089175 TTTTCAACTATGAAAGAAATAGG + Intergenic
1114886002 14:26852120-26852142 TTTTGTACACTGAAAGAATTAGG - Intergenic
1114918680 14:27298212-27298234 TGTTCAGCACAGATAGAAGTTGG - Intergenic
1115214265 14:30998953-30998975 TTTTCAACAAAAAAATAACTAGG + Intronic
1115782819 14:36788575-36788597 TTTTCAACACACACAGATCTAGG - Intronic
1115878237 14:37885472-37885494 CTTTCAACACAGAGAGCACCAGG - Intronic
1116089139 14:40281694-40281716 GTTTCAAAATATAAAGAACTTGG - Intergenic
1116152799 14:41163714-41163736 TTGCCAACACAGGAAGAAATAGG - Intergenic
1116723584 14:48532227-48532249 TTTTCAAAACAGAAAGCACAAGG - Intergenic
1117426616 14:55605163-55605185 ATTTCAACACAGAAATACTTGGG - Intronic
1118986098 14:70756109-70756131 TTTTCTCCACCGAAAGAACAAGG - Intronic
1119051380 14:71372737-71372759 TTTTAAACACAGAATGGCCTGGG + Intronic
1119329276 14:73782133-73782155 TTTTCAAAAAAGAAAGAATCTGG + Intronic
1119711945 14:76828774-76828796 TTTTCAACAGAAGAGGAACTGGG + Intronic
1120191319 14:81442598-81442620 TTTTCATCAAAGAAAGAGCAGGG - Intergenic
1120432165 14:84432976-84432998 TTGTCAAAAAAGAGAGAACTTGG - Intergenic
1120837165 14:89050812-89050834 CTTCCAAAACAGAAAGCACTGGG + Intergenic
1121118578 14:91360954-91360976 TGGGCAACACAGAAAAAACTCGG + Intronic
1122170753 14:99872728-99872750 TTTTGAAAACAGAAAGAAGCAGG + Intronic
1122380688 14:101304481-101304503 CCTTCCAAACAGAAAGAACTAGG + Intergenic
1122473212 14:101986375-101986397 TTTTCACCATCGAAAGTACTCGG + Exonic
1122764838 14:104060506-104060528 TTTACAAAAAAGAAAGCACTAGG - Intergenic
1122808353 14:104273649-104273671 TCTTCAAAAAAGAAAGCACTAGG - Intergenic
1124041256 15:26106560-26106582 TGTTCAACACACCAAGAACCTGG - Intergenic
1124685634 15:31779577-31779599 TTTTCAACACACAAAGGCCACGG - Intronic
1125144532 15:36451419-36451441 GTCACAAAACAGAAAGAACTGGG + Intergenic
1126068334 15:44843528-44843550 CTTTCAACACAAAAAGACTTAGG - Intergenic
1126090499 15:45047277-45047299 CTTTCAACACAAAAAGACTTAGG + Intronic
1126173262 15:45711999-45712021 TTTTCAACACATAAACTTCTGGG + Intergenic
1126596286 15:50387270-50387292 TTTCCAAAACAAAAAAAACTGGG - Intergenic
1126834522 15:52646296-52646318 TCTTGAACAAAGATAGAACTGGG + Intronic
1128106453 15:65049090-65049112 TTTACAAAACAAAAAGAAATAGG - Intronic
1129040715 15:72684091-72684113 TTTTCAAGACACCAAGAACCTGG - Intronic
1131784128 15:95892928-95892950 TTTTCAACACCCAAAGAGCTTGG - Intergenic
1131810872 15:96171428-96171450 TATTCAACTCACAAAGAAGTAGG - Intergenic
1132068017 15:98749095-98749117 TTTTAAACAAGGAAAGAAATAGG - Intronic
1132094017 15:98968829-98968851 GTTTCACCTCAGAAAGAACATGG + Intronic
1132253330 15:100350642-100350664 TCTTGAGCAAAGAAAGAACTAGG - Intergenic
1132402797 15:101523706-101523728 CTGTCAACACAACAAGAACTTGG + Intronic
1132412010 15:101587448-101587470 TTTTCAAAACTGAAAGTACCAGG + Intergenic
1133986820 16:10675190-10675212 ATTTATACACAGAAAGAACTTGG - Intronic
1137329802 16:47481843-47481865 TTTTGAAAACAGGAAGAACTGGG - Intronic
1137540217 16:49356689-49356711 TTTTCAACACAGTAAGCATGTGG - Intergenic
1137771751 16:51021498-51021520 TTTCCAACCCAGACAGAGCTAGG + Intergenic
1138654958 16:58485879-58485901 TTTATAACACAGAAAAAAATTGG - Intronic
1138684392 16:58711969-58711991 TTTTCATCACGAAAACAACTTGG + Intronic
1139766347 16:69233630-69233652 TTTTCAGCAGAGAAATTACTGGG - Intronic
1140275962 16:73509255-73509277 TTTTCAAAACAGAGGGATCTGGG - Intergenic
1143565854 17:7720101-7720123 ATTTTAAGACAGAAAGAACAAGG - Intronic
1144039799 17:11400330-11400352 TTTTCATCACAAAAAGAAGTTGG - Intronic
1145094273 17:20010444-20010466 TCTTCAACACTGAAATAACACGG - Intronic
1146193385 17:30790424-30790446 TTTCCATTACAGAAAGAAATGGG + Intronic
1146846408 17:36184038-36184060 ATTTACACAGAGAAAGAACTGGG - Intronic
1148197209 17:45722599-45722621 ATTTCAACACATATAGAACTTGG - Intergenic
1148597893 17:48871583-48871605 TTTTTAACACAAACAGAACTAGG + Intergenic
1148657501 17:49298670-49298692 TGTTCACCACAGAAGGAACTGGG + Exonic
1149286481 17:55171059-55171081 TTTTCAAGGCAGAAAAAAATAGG - Intergenic
1149412614 17:56424351-56424373 TTTTGAACCCAGACAGACCTGGG + Intronic
1150183405 17:63152428-63152450 TTTTGAATACTGAAAGACCTTGG + Intronic
1150363089 17:64555129-64555151 TTTTCTGTCCAGAAAGAACTAGG - Intronic
1150518463 17:65839637-65839659 TATTCAACACAGATAGTATTGGG + Intronic
1150994549 17:70301231-70301253 TTTCCCACACAGAAAGCTCTAGG - Intergenic
1152982052 18:287695-287717 TTTTGAACACAGAATTAACTAGG - Intergenic
1153255870 18:3170642-3170664 TTTTCACCAAAGAAAGGACTTGG + Intronic
1153378205 18:4405848-4405870 TGTTCAAAACGCAAAGAACTTGG - Intronic
1153892011 18:9526054-9526076 TATTCTTAACAGAAAGAACTTGG - Intronic
1153942843 18:9992152-9992174 ATTTCAAGACAGAAAGACCTAGG - Intergenic
1153989583 18:10384654-10384676 TTCTCATCACTGAAAGAAGTGGG - Intergenic
1154088540 18:11333220-11333242 TTTCCAAAACAGAAAACACTAGG - Intergenic
1154093740 18:11390174-11390196 TCTTCAAGTCAGAGAGAACTTGG - Intergenic
1156388568 18:36628858-36628880 TTGTCAACAGAGGAAGAACCAGG - Intronic
1156805669 18:41176979-41177001 TTAGCAAGATAGAAAGAACTTGG - Intergenic
1157044809 18:44088689-44088711 TTTTCTAAACAGGAAGAAATGGG - Intergenic
1157175894 18:45451832-45451854 CTTTCAAAACAGAATGTACTTGG - Intronic
1157518799 18:48330635-48330657 TTTTAAATACAGAAACCACTGGG - Intronic
1157963310 18:52181066-52181088 TTCAGAACACAGAAAGAACCAGG - Intergenic
1158017263 18:52798564-52798586 CTTTCAACTCAGAAAGTATTTGG - Intronic
1158163580 18:54513949-54513971 ATTTCATCTCAGAAAGAGCTTGG + Intergenic
1158977373 18:62723640-62723662 TTTTAAATACAGCAAGAGCTTGG + Intronic
1159931776 18:74319603-74319625 TTCCCAAGCCAGAAAGAACTGGG - Intronic
1162674514 19:12288832-12288854 TGTCCAGAACAGAAAGAACTGGG - Intronic
1163239547 19:16051951-16051973 TGTTCAACACTCCAAGAACTTGG + Intergenic
1163697135 19:18769631-18769653 TTTCCACCAAAGAAAGGACTTGG - Intronic
1163786808 19:19279019-19279041 TTTTCACCACGGAGAAAACTAGG + Intronic
1163880274 19:19914128-19914150 TGTTGAACACAGAAAGATGTGGG + Intronic
1164023984 19:21333474-21333496 TTTTCATCATAGAAAAAATTTGG + Intergenic
1164479262 19:28598784-28598806 TTTTCAAGAGAGAAAGGACATGG - Intergenic
1164900266 19:31913999-31914021 TTTTCAAAACAAAAATAAATAGG - Intergenic
1165241225 19:34469952-34469974 TTTTCATTAAAAAAAGAACTCGG + Exonic
1165266777 19:34667720-34667742 TGTTCAAAACAGCAAGAACCTGG + Intronic
1165283980 19:34822931-34822953 CTTCCAAAACAGAAAGCACTAGG + Intergenic
1165478210 19:36044791-36044813 TTTTCAACAAAGAGAGAGCAGGG - Intronic
1165656217 19:37534423-37534445 TTTTTGACACACAAAGAACAGGG - Intronic
1166345159 19:42161195-42161217 TTTTAATCAGAGAAAGAACCAGG + Intronic
1166519027 19:43467143-43467165 TTTTAAAAAAAGAAAAAACTTGG + Intergenic
1166713041 19:44949216-44949238 CCTTCAGCACAGAAAGAACTTGG - Exonic
1167003985 19:46763477-46763499 TTTTAAAAAAGGAAAGAACTGGG + Intronic
925447699 2:3942076-3942098 ATTTCAAAACAGAGAGAAATGGG - Intergenic
925502452 2:4521310-4521332 TTTTCAACACTCAAAAACCTTGG + Intergenic
925696822 2:6589367-6589389 TATTCAACAGAGTAAGAACCAGG - Intergenic
925937719 2:8782537-8782559 TTTTCAAAACAGAAAGCACCAGG + Intronic
925994312 2:9279407-9279429 TTTTCCACACAGAAACCTCTAGG - Intronic
927625769 2:24716764-24716786 CTTTCAAAACAGAAATCACTAGG + Intronic
927627672 2:24740004-24740026 CTTTAAACATAAAAAGAACTAGG + Intronic
927727958 2:25442545-25442567 TTGTCAAAACAGACAGAACTGGG + Intronic
927926893 2:27019764-27019786 TTTTCAAAGGAGGAAGAACTAGG + Intronic
928009741 2:27595938-27595960 TATGCAACACATAAAGAACCAGG - Intronic
928049240 2:27972181-27972203 TATTAACCACTGAAAGAACTAGG + Intronic
928262665 2:29781886-29781908 TCCTCTAGACAGAAAGAACTGGG + Intronic
928806211 2:35159688-35159710 TTATTAACACACAAAGAATTAGG - Intergenic
928922840 2:36543067-36543089 CTTTAAACATAAAAAGAACTGGG - Intronic
929900422 2:45996945-45996967 CTTCCAAAACAGAAAGCACTAGG - Intronic
930176211 2:48303810-48303832 TTTTCAACTCAGAAATAAAGCGG - Intergenic
930718838 2:54619383-54619405 TTATCAAAGCACAAAGAACTAGG - Intronic
931299934 2:60969666-60969688 TTTTCAACCCAGAATGAACTAGG + Intronic
931463629 2:62468613-62468635 TGTTCACCATAGAGAGAACTTGG + Intergenic
931786349 2:65622529-65622551 TTTTAAGCAAAGAAACAACTTGG + Intergenic
932838593 2:75060672-75060694 TTTTAAACAGAGAATGAACATGG + Intronic
933079787 2:77971708-77971730 TGTTCAAAACACCAAGAACTTGG - Intergenic
933247073 2:79987380-79987402 TTTTGAATTCAGAAAGAACTGGG + Intronic
933896580 2:86815834-86815856 AATTCAACACAGAAAGAGCCAGG + Intronic
934181832 2:89630214-89630236 TTTTAAAAACAGGAATAACTAGG + Intergenic
934292135 2:91704433-91704455 TTTTAAAAACAGGAATAACTAGG + Intergenic
935166776 2:100576259-100576281 TTTTCTACTTAGAAAAAACTAGG + Intronic
935300852 2:101692850-101692872 TTTTCAACAAAGTAAAACCTAGG + Intergenic
935883852 2:107594491-107594513 TTGGTAACACAGAAATAACTTGG - Intergenic
936069985 2:109361438-109361460 CTTTCAAAACAGAAAGAACCAGG - Intronic
937298471 2:120824025-120824047 TATTTAACAAAGAAAGAACCAGG + Intronic
937567071 2:123307407-123307429 TTGACAACACAGAAAGAAGCTGG + Intergenic
937721729 2:125105276-125105298 TTTTTAAAACAGAAAGCACCTGG - Intergenic
938016975 2:127875277-127875299 TTGTCAACATTGAAATAACTAGG - Intronic
938626487 2:133114690-133114712 TTTTCAACAAATAAAGTACAAGG - Intronic
938899141 2:135784431-135784453 TTTTCTACATAGATAGTACTAGG + Exonic
938943926 2:136193394-136193416 GTTTTTACACAGAAAGAAGTGGG - Intergenic
939027920 2:137035694-137035716 TTAAGAACACAGAAAGCACTGGG - Intronic
939557475 2:143693216-143693238 TTTTAAACACACAAAGCAATGGG + Intronic
939682386 2:145154308-145154330 TTTTCACAACATGAAGAACTTGG + Intergenic
941402793 2:165051915-165051937 CTTTCAAAATAGAAAGAACCAGG + Intergenic
942530131 2:176900996-176901018 TTTTCAACAGAGGAAGCACTAGG + Intergenic
943169137 2:184373259-184373281 TTTTCAAATCAGAAAGTACTAGG + Intergenic
943246858 2:185465072-185465094 TTTTCAAAACAGAAAGAACCAGG + Intergenic
943839090 2:192554711-192554733 TTTTCAACACAGACAGTCCCCGG + Intergenic
943982724 2:194575463-194575485 TTTTCAAGAAAGAACAAACTGGG + Intergenic
944266879 2:197737447-197737469 TTTTTTACTCATAAAGAACTAGG - Intronic
944870252 2:203903965-203903987 TGGTCAAAATAGAAAGAACTGGG + Intergenic
944894828 2:204153177-204153199 TTATCAACTCAGAATAAACTAGG - Intergenic
945309265 2:208291599-208291621 TTTCCAAAACAGAAAGCACCAGG - Intronic
946277762 2:218643824-218643846 TGTTCTACTCAGAAAGAACAAGG - Exonic
946822401 2:223643813-223643835 TTTTCAAAAAAGAAAGAAAGAGG - Intergenic
946866251 2:224043567-224043589 TTTTCAAGATTCAAAGAACTGGG - Intergenic
947030803 2:225791602-225791624 TTTCCAAAAAAGAAAGAACCAGG - Intergenic
947452115 2:230218210-230218232 TGTTCAACACAAAATGAAGTTGG - Intronic
947919397 2:233856082-233856104 TGTTCAACACACCAAGAACCTGG - Intergenic
948736528 2:240011107-240011129 CTTTCAACAAAGAAAGAAAGGGG + Intronic
1169885815 20:10395913-10395935 TTTTGAAGACAGAAAGACCCAGG - Intergenic
1169988356 20:11472053-11472075 TTTTCTTCACAGAAAGAACAAGG + Intergenic
1170356770 20:15500715-15500737 TTTTCAAATGAGAAAGCACTTGG + Intronic
1170445034 20:16417537-16417559 TCCTCAGCACAGAAAGAACCAGG + Intronic
1170536439 20:17345704-17345726 ATTTCAAGTAAGAAAGAACTGGG - Intronic
1170751468 20:19151166-19151188 TTTTCAAAACAGAAAACACCAGG + Intergenic
1171064608 20:22002324-22002346 CTTGCAACACAGAAGGATCTCGG - Intergenic
1172115160 20:32569363-32569385 TTTTGAACAGAGAAGGAACATGG + Intronic
1172233585 20:33353939-33353961 TTTCCAACAGAGAAATAACCTGG + Intergenic
1174191937 20:48747166-48747188 TTTACAGCACACAAAGGACTCGG - Intronic
1174651103 20:52126352-52126374 TTCTGAAGTCAGAAAGAACTGGG - Intronic
1174969722 20:55261065-55261087 TTTTCATTACACAAAGCACTTGG - Intergenic
1175369440 20:58477913-58477935 TAATCAACTCAGAAAGAGCTGGG - Intronic
1175789428 20:61732155-61732177 TTTTGTACACAGAAAAATCTTGG - Intronic
1175830149 20:61960220-61960242 TGTTCAACACACCAAGAACCTGG + Intronic
1176153593 20:63606660-63606682 TTTTAAGAAAAGAAAGAACTTGG + Intronic
1176312757 21:5162227-5162249 ATTTCAATACAGATAGAACCAGG + Intergenic
1176312783 21:5162383-5162405 ATTTCAATACAGATAGAACCAGG + Intergenic
1176312794 21:5162461-5162483 ATTTCAATACAGATAGAACCAGG + Intergenic
1176730645 21:10493003-10493025 TTTTAAAAACAGGAATAACTAGG - Intergenic
1177412614 21:20749938-20749960 TTTCCAGCAAAGAAAGAACCAGG + Intergenic
1178109886 21:29359555-29359577 TTTTAAGCAAAGAAAGAAATGGG + Intronic
1179797297 21:43792660-43792682 TTTCCTACACAGGAAGAATTAGG + Exonic
1179844254 21:44099569-44099591 ATTTCAATACAGATAGAACCAGG - Intronic
1179844265 21:44099647-44099669 ATTTCAATACAGATAGAACCAGG - Intronic
1179844291 21:44099803-44099825 ATTTCAATACAGATAGAACCAGG - Intronic
1182056733 22:27362665-27362687 CTTCCAAAACAGAAAGCACTAGG - Intergenic
1182585776 22:31343694-31343716 TTTTCAGGACAGAAAGGAATGGG - Intronic
1184211390 22:43037694-43037716 TTTTCAACACAAATGGTACTTGG - Intergenic
1185006484 22:48279718-48279740 TCTCCAACACAAAAAGAGCTTGG + Intergenic
949133218 3:530702-530724 TTTACAAGACAAAAAGAAATAGG + Intergenic
951154761 3:19337546-19337568 TTTTCATCACTGAAAGAAAAAGG + Intronic
951357886 3:21691207-21691229 TTGGCAACACAGAAACAACCTGG - Intronic
951465331 3:22994675-22994697 TTTTGAAAACAGAAATAACAAGG + Intergenic
952239463 3:31515526-31515548 TTTTGAAGACAGAAAGAGCTGGG + Intergenic
952545150 3:34411066-34411088 TTTTCACCACAGAGAGTAATGGG + Intergenic
952735411 3:36686184-36686206 CTTCCAAAACAGAAAGAACCAGG + Intergenic
952770698 3:36997395-36997417 TTTTCCACACAGAAAGACAAAGG - Intronic
953943928 3:47128892-47128914 TTTTCAAGACAGAAGGTACCAGG + Intronic
954783704 3:53078183-53078205 TTTACAACATAGAAAGTGCTGGG + Intronic
955048235 3:55381280-55381302 TTTGCAACACAGAACCAACAGGG + Intergenic
955456905 3:59132034-59132056 TCTTCAAAACAGGAAGAAGTGGG - Intergenic
956472712 3:69584774-69584796 TTCTCAACAAAGTAAGAAGTTGG + Intergenic
956619972 3:71212056-71212078 TATTTAACAAAGAAAGAACATGG - Intronic
957016875 3:75075911-75075933 CTTTCAAAAAAGAAAGCACTAGG - Intergenic
957867788 3:86046836-86046858 CTTTCAAAACAGAAATATCTTGG + Intronic
959194004 3:103154031-103154053 TTTTCAAATCAGAAAAAGCTGGG - Intergenic
959731942 3:109614050-109614072 TTAGCAACATAGAAGGAACTGGG + Intergenic
959887922 3:111523926-111523948 TTTTCATCAAGGAAAGAATTAGG + Intronic
960026474 3:113016616-113016638 ATTTCATCAAAGAAAGATCTGGG - Intronic
960158305 3:114320634-114320656 TTTTAAAGATATAAAGAACTAGG - Intergenic
960185502 3:114633025-114633047 TTTACTACATAGAAAGAATTAGG + Intronic
960769716 3:121180251-121180273 TTTACAAGCCAGAAGGAACTGGG + Intronic
961911887 3:130326400-130326422 TTTCCATCACAGGAAGAAATGGG + Intergenic
962479484 3:135786066-135786088 ATTTCACCACAGCAAGAAGTGGG - Intergenic
962820357 3:139043264-139043286 TTTGCAAAACAGACCGAACTGGG - Exonic
962825219 3:139095002-139095024 TCCTGAAGACAGAAAGAACTTGG + Intronic
963014878 3:140813312-140813334 CTTTCAAAACAGAAAGTACCAGG + Intergenic
963276707 3:143338628-143338650 TTTTCACCACAGCAACCACTGGG + Intronic
963402856 3:144823365-144823387 TTTTCAAACCAGATAGAACATGG - Intergenic
963574030 3:147036942-147036964 GTTTCAAAACAGAAAGCACCAGG + Intergenic
963686234 3:148437940-148437962 TTTTCACCACAGATAGTACTAGG - Intergenic
964554840 3:157925664-157925686 TGTTCAACACACCAAGAACCTGG - Intergenic
965376336 3:167928615-167928637 TTTTCAACATAGAAAATACTTGG - Intergenic
965526021 3:169719210-169719232 TTCTCAAGACAGAAATAACAAGG + Intergenic
965600385 3:170448332-170448354 TTTTCAGCAAAGAAATCACTGGG + Intronic
965932429 3:174061276-174061298 TTTTCAGCAGAGTAATAACTGGG + Intronic
965958294 3:174397858-174397880 CTTTGAACACATAAAGAATTTGG - Intergenic
966431282 3:179833585-179833607 ATTTCTAAACAGAATGAACTTGG - Intronic
966545744 3:181145564-181145586 TTTCCAAAACAGAAAGCACCAGG + Intergenic
966612489 3:181881453-181881475 TTTTAAGCAAAGAAAAAACTGGG - Intergenic
966745532 3:183272257-183272279 CCTTCACTACAGAAAGAACTAGG + Exonic
966995185 3:185272993-185273015 TTTTCAACACGAAATGAAATTGG - Intronic
967086898 3:186103570-186103592 TTGTCAACACAGAACAAAGTTGG + Intronic
967618405 3:191601846-191601868 TGTGCAAGACAGAAAGAAATGGG + Intergenic
968143154 3:196274921-196274943 TCATCATCACTGAAAGAACTCGG - Intronic
968778250 4:2558683-2558705 TTTTAAAGACAGAAACAGCTAGG - Intronic
970226878 4:13868060-13868082 TTTTCAAGTCAGATAGAACTGGG - Intergenic
971864786 4:32155504-32155526 TCTTCAACACAGAACTATCTTGG + Intergenic
972054994 4:34790448-34790470 TCCTCCAGACAGAAAGAACTGGG - Intergenic
972549768 4:40120284-40120306 TTTTCACTACAGCAAGTACTAGG - Exonic
972802244 4:42489173-42489195 TTTTCAGCTCAGAAATCACTTGG - Intronic
973210661 4:47611865-47611887 GGTTCAATACAAAAAGAACTAGG - Intronic
973342876 4:49024254-49024276 TTTTGAAGACAGCAGGAACTTGG + Intronic
973931454 4:55796647-55796669 CTTTCAACTCAGAGAGACCTGGG + Intergenic
974279285 4:59770854-59770876 ATTTCCACACTGAAAGATCTTGG + Intergenic
974656611 4:64831879-64831901 TGTTCAACAGTGAAAGGACTTGG - Intergenic
974734410 4:65911246-65911268 TTTTCAACACATAAAGTTTTGGG + Intergenic
974967661 4:68782397-68782419 TTTTCAAGACAAATAAAACTAGG - Intergenic
975198541 4:71556120-71556142 TTTTAAAGTCAGATAGAACTGGG + Intronic
975815568 4:78213212-78213234 TCTACAAAACAGAAGGAACTTGG - Intronic
976018484 4:80590341-80590363 TTTAGAACACAGAATGAGCTGGG + Intronic
976198463 4:82556874-82556896 TCTTCAACACAGAGATAATTTGG + Intronic
977090338 4:92666471-92666493 TTTTCAACACAAAAATCACAAGG - Intronic
977755325 4:100663927-100663949 TTGACAACCCAGAAAGAATTTGG + Intronic
977952083 4:102983515-102983537 TTTCCAAAACAGAATGTACTGGG - Intronic
977964548 4:103129227-103129249 TTTCCAAAACAGAAAGCACCAGG + Intronic
978526103 4:109667216-109667238 TTTCCAAAACAGAAAGCACCAGG - Intronic
978539496 4:109802099-109802121 TTTTGAACTCTGAAAGAATTTGG + Exonic
980099197 4:128524379-128524401 TTTTAAAAAAAGAAAGAACGGGG + Intergenic
980827543 4:138090450-138090472 GTTTTAACTCACAAAGAACTGGG + Intergenic
981259414 4:142701968-142701990 AGTTCAACACAAAATGAACTAGG + Intronic
981555944 4:145993969-145993991 TTTGCAATACAGAAAGCACCAGG - Intergenic
981963612 4:150573878-150573900 CTTTTAACACAGTAGGAACTTGG + Intronic
982309814 4:153973178-153973200 TTTTCAACACATATTAAACTTGG + Intergenic
982666209 4:158267296-158267318 TTTCCAAAACAGAAAGCACCAGG - Intergenic
982873984 4:160621870-160621892 CTTCCAAAACAGAAAGAACTAGG + Intergenic
983258978 4:165434569-165434591 CTTTCAGCACCTAAAGAACTCGG + Intronic
983565189 4:169143216-169143238 TTTAAAAGACAGAAAGAAATAGG + Intronic
983579687 4:169295381-169295403 TTTTCAAAATAGAAAGCACCAGG + Intergenic
983641774 4:169950054-169950076 TTGTCAACATAGAAAAAGCTAGG - Intergenic
983869509 4:172808944-172808966 TTTTCAATACACAAAATACTAGG + Intronic
983985050 4:174049443-174049465 TTTCCAAAACAGAAAGCACCAGG - Intergenic
984104270 4:175525456-175525478 ATGTCAACTCAGAAAGAACATGG - Intergenic
984108898 4:175583987-175584009 TATAAAACACAGAAAGAATTAGG + Intergenic
984311961 4:178072803-178072825 TTTTCCACACACAGAGTACTAGG - Intergenic
986222938 5:5786691-5786713 AATTCATCATAGAAAGAACTAGG + Intergenic
986538710 5:8820489-8820511 TTTACAAAACAGAAAGCACCAGG - Intergenic
986834977 5:11627139-11627161 TTATTAACACTGGAAGAACTAGG + Intronic
987476485 5:18398604-18398626 TTATGATGACAGAAAGAACTAGG - Intergenic
987872404 5:23637846-23637868 TTTTCAACAAAGGAATTACTTGG + Intergenic
988368266 5:30331324-30331346 TTTGCAATACAAAATGAACTAGG - Intergenic
988598187 5:32614631-32614653 ATTTCAAAACAAAAAGAACTTGG - Intergenic
988935171 5:36074773-36074795 TTTTATACATAGAAAGAAGTAGG + Intergenic
989568056 5:42920843-42920865 TTGTTAACAAAGAAATAACTTGG - Intergenic
989839306 5:46041421-46041443 TTTTCACCATAGGAAAAACTGGG - Intergenic
990190561 5:53255454-53255476 TTTAAAACACAGAAAGAAAATGG - Intergenic
991007291 5:61842129-61842151 TTTTCAACAGAGAAACAAACTGG + Intergenic
991193649 5:63905997-63906019 TTTTCAAGAAAGAAATAACAAGG - Intergenic
991196382 5:63938531-63938553 CTTTCAACAAAGAAAAACCTAGG + Intergenic
992544621 5:77800009-77800031 CTTTCAAAACAGAAAGCACAAGG + Intronic
992628530 5:78657915-78657937 TTATCACCCTAGAAAGAACTGGG - Intronic
993504553 5:88693876-88693898 TTGTCAACAGGGAAATAACTCGG - Intergenic
993600012 5:89910789-89910811 CTTTTAACACACATAGAACTAGG - Intergenic
993805687 5:92406099-92406121 TTTTCTAAACTGAAAGTACTTGG - Intergenic
994346978 5:98698237-98698259 TTTTCAATAAAGAAAGAATCAGG - Intergenic
996081551 5:119263307-119263329 TTAGAAACACACAAAGAACTTGG + Intergenic
996415435 5:123205360-123205382 TCTTTTATACAGAAAGAACTGGG - Intergenic
999045362 5:148462530-148462552 CTTTCAAAACAGAAAGTACCAGG + Intronic
999046447 5:148474732-148474754 TTCTCAACATAGACAGATCTAGG + Intronic
999518070 5:152320920-152320942 TTATCAAAAGAGAAATAACTGGG - Intergenic
999580047 5:153028306-153028328 CTTTCAAAACAGAAAGCACCAGG + Intergenic
999772901 5:154788783-154788805 TTTTCAACAAAGACAGACATGGG - Intronic
1000066985 5:157702388-157702410 TTTTCTACAAAGAAAAATCTAGG - Intergenic
1000078996 5:157826524-157826546 TTTTTAATACAGAAATAATTTGG + Intronic
1000153582 5:158528217-158528239 TTTGCCACACAGAAAAGACTAGG + Intergenic
1000197746 5:158976087-158976109 TTGTCAAGACAGAATGAAATTGG + Intronic
1000347652 5:160328251-160328273 TTTTAAACACAGGAGGAACAGGG + Intronic
1000495165 5:161973251-161973273 TGTTAAACACAGAGAGAATTTGG + Intergenic
1002316813 5:178349100-178349122 TTCTCAGCACAGCGAGAACTCGG + Intronic
1004139453 6:13002539-13002561 TTTCCAACAGAGAAAGAGTTTGG - Intronic
1005457844 6:26038554-26038576 TTTAGATCACAGAAAGAATTGGG - Intergenic
1006808539 6:36805170-36805192 TTTTCAAGCCAGAAGGGACTTGG + Intronic
1007082426 6:39117185-39117207 TTTTGGACATACAAAGAACTTGG + Intergenic
1008549158 6:52611090-52611112 TTTGCAACACAGAAACTTCTGGG - Intergenic
1009441503 6:63685432-63685454 TTTTCAGTACAGAATGAGCTTGG - Exonic
1009767264 6:68095928-68095950 TTTTCAACAAAGATAGTAATAGG + Intergenic
1010190449 6:73190019-73190041 TGTTTAAAACAAAAAGAACTTGG + Intronic
1011837329 6:91449669-91449691 ATCTCAGCACAGAAAGAAGTAGG - Intergenic
1012595512 6:101033381-101033403 TTTTCAGGACAGAGAAAACTAGG - Intergenic
1012649192 6:101732415-101732437 TTTTCAAAAGAGAAAAGACTTGG + Intronic
1012695146 6:102371576-102371598 TTATAAATACAGTAAGAACTTGG + Intergenic
1012891866 6:104906127-104906149 CTTTCAAAACAGAAAGCACTAGG - Intergenic
1013245220 6:108279954-108279976 TTATCAAGAAAGAAAGAACATGG + Intergenic
1013743344 6:113315529-113315551 TGTCAAAGACAGAAAGAACTTGG - Intergenic
1014497863 6:122149393-122149415 TTTTCAAAACAGAAAGCAACAGG - Intergenic
1014654710 6:124086795-124086817 CTTTCAAAACAGAAAGCACCAGG + Intronic
1014829311 6:126082792-126082814 TTTTCAACAGATAAAGAAGCAGG + Intergenic
1015430636 6:133126994-133127016 ATTTCAACACTGAAAGGACAAGG + Intergenic
1015789673 6:136953799-136953821 TTTTAAGCACAGAAAATACTAGG - Intergenic
1015890971 6:137969596-137969618 TTTTAAAGACAGAAACAACTTGG + Intergenic
1016567318 6:145471167-145471189 TTTTCAACAAAGAAAACAATAGG - Intergenic
1016860394 6:148712297-148712319 TTTTGAACACTGAAAAAACCTGG + Intergenic
1016970666 6:149759209-149759231 TTTTCAGTACAGAAAGTACCTGG + Intronic
1018097517 6:160403411-160403433 TTTTCAAAACAGGAAGCACCAGG + Intronic
1018919666 6:168162675-168162697 TTTCCAACACAGAATGAAAGTGG + Intergenic
1019137990 6:169923252-169923274 TTTTACACAAAGAAAGTACTTGG + Intergenic
1019377432 7:700468-700490 TATTCAACATATCAAGAACTAGG + Intronic
1020916221 7:14197065-14197087 TTTTCAACACTGAAAAACCAAGG + Intronic
1021548778 7:21846830-21846852 CTTTCAAAACAGAAAGCACCAGG - Intronic
1022764972 7:33401769-33401791 TTTTCTAGACAGAATCAACTGGG - Intronic
1023037416 7:36144603-36144625 TTTCCAAAACAGAAAGCACCAGG + Intergenic
1023878129 7:44302264-44302286 TTTCCAAAACAGAAAGCACCAGG + Intronic
1024285703 7:47755843-47755865 CTTTCAGCACATCAAGAACTGGG - Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1025242472 7:57289361-57289383 TTCTCCAGACAAAAAGAACTGGG - Intergenic
1025899488 7:65732272-65732294 TTTTTGAAACAGAAAGAAATAGG - Intergenic
1026109704 7:67449308-67449330 ATATCAACACAGAAAGATCAGGG - Intergenic
1027839006 7:83283084-83283106 TTTTAAAAACAGAAATGACTTGG + Intergenic
1028068919 7:86425250-86425272 TTCTCTACATAGAAATAACTTGG + Intergenic
1028422007 7:90643616-90643638 GGTTCGACACAGAAAGAGCTTGG - Intronic
1028500612 7:91515107-91515129 TTTTCCCCCCAGAAAGCACTTGG - Intergenic
1029503434 7:100948116-100948138 GTTTCAACCCAGAAAGAAGATGG - Intergenic
1030045164 7:105488837-105488859 TTTTCAACACAGAAAGAACTAGG - Intronic
1030734259 7:113026724-113026746 TTCTCAGCACAGAAAAAAATAGG - Intergenic
1031599588 7:123690455-123690477 TTTTCAAAAAATAACGAACTCGG + Intronic
1032017244 7:128388076-128388098 TTCTCTACACAGAAAGAAAGAGG + Intergenic
1033085533 7:138338177-138338199 TTTTCAAAATAGAAAGATCAAGG - Intergenic
1033448295 7:141440720-141440742 TTAGCATCACAGAAAGATCTGGG + Intronic
1034019719 7:147628295-147628317 CTTACAAGACAGAAAGAATTGGG + Intronic
1034134564 7:148754468-148754490 TTTAAAAAACAGAAAGAGCTGGG - Intronic
1035888497 8:3319349-3319371 TTTGCAATACACAAAGAATTTGG + Intronic
1036414000 8:8529953-8529975 TTTCCAACACAGCAAGGACTTGG + Intergenic
1036826878 8:11983777-11983799 TTTTCTACACCTTAAGAACTGGG - Intronic
1037226241 8:16594654-16594676 TTTTTAACAAAAAAACAACTAGG + Intergenic
1037441854 8:18924479-18924501 TTTTCACCACGGATAGAAGTTGG - Intronic
1038103617 8:24408599-24408621 TCTTCAACACTCAAAGCACTTGG - Intergenic
1038157859 8:25007764-25007786 CTTCCAACACAGAGGGAACTTGG - Intergenic
1038281813 8:26172525-26172547 TTTTAAACACATACAGAAGTAGG - Intergenic
1038842067 8:31193712-31193734 TTTTCAAAACAAAAAAAAGTAGG - Intergenic
1038972417 8:32650721-32650743 GTTTAGTCACAGAAAGAACTGGG + Intronic
1039010923 8:33091695-33091717 TGTTTAATTCAGAAAGAACTTGG - Intergenic
1039216571 8:35278413-35278435 TTTTCACAACAAAAAGAACAAGG - Intronic
1039320332 8:36423258-36423280 ATTACGAAACAGAAAGAACTTGG - Intergenic
1039422733 8:37457741-37457763 TATTCAACACAGAAAGATCCAGG - Intergenic
1039703170 8:39981608-39981630 TTTTCAGCTCAGAAAGTACCTGG + Intronic
1040654924 8:49496549-49496571 TTATCAGCACAGAAACAACAAGG - Intergenic
1040698103 8:50027112-50027134 TTTTAAACACAGAAATAACATGG - Intronic
1040829047 8:51657424-51657446 TTGTCTACACATAAAGGACTAGG + Intronic
1040829187 8:51658804-51658826 TTGTCTACACATAAAGGACTAGG + Intronic
1041007043 8:53505414-53505436 TATTGAAAACAGAAAGGACTTGG - Intergenic
1041033425 8:53761596-53761618 TTTTAACAACAGAAAGAGCTTGG - Intronic
1042399132 8:68326127-68326149 TTTTCCACACAGTTAGAACCAGG + Intronic
1042409585 8:68447584-68447606 GTTTCAACAGAGAAAGGAGTAGG + Intronic
1043074529 8:75681126-75681148 TTTTCATCACAGAAAAAAATTGG + Intergenic
1043516035 8:80996019-80996041 TTTTGTCCACAGTAAGAACTTGG - Intronic
1043527112 8:81109353-81109375 GTTTCAACACAGACAGACGTGGG + Intronic
1043711013 8:83419251-83419273 TTTTCCACACTGAAGCAACTAGG - Intergenic
1044089282 8:87979140-87979162 TATACAACACGGAAATAACTAGG - Intergenic
1044120516 8:88388580-88388602 TAATAAACACAAAAAGAACTAGG - Intergenic
1044245682 8:89942149-89942171 CTTACAACACAGAAGGAGCTAGG + Intronic
1044761440 8:95521601-95521623 ATTTCAACACAGAATTAAATCGG - Intergenic
1045206340 8:100044928-100044950 TTGTCAACACACAAAAAATTCGG + Intronic
1045714661 8:105027011-105027033 TTTTCAACACAGAATTATTTGGG + Intronic
1045981208 8:108190370-108190392 TTTTCCACCCAGCAATAACTTGG - Intergenic
1046164937 8:110420246-110420268 TTTTCAACTCAAAAATAACAAGG + Intergenic
1046676056 8:117109977-117109999 TTTTCAAAACAGAGAGGGCTTGG - Intronic
1047403286 8:124563646-124563668 ATTTTAACACAGAAACAGCTGGG - Intronic
1048108127 8:131434652-131434674 TTCTCTAAACAGAAAGAAATTGG + Intergenic
1048299439 8:133240423-133240445 TTTTGAATTCAGAAAGAATTGGG + Intronic
1048480620 8:134788750-134788772 TTTTCAACACATACAGATTTAGG + Intergenic
1048502326 8:134989447-134989469 GTTCCCACACAGAAAGAACAGGG - Intergenic
1049491794 8:142908071-142908093 ATTTCAACACAGAAATTTCTGGG + Intronic
1050243553 9:3662880-3662902 ATAACAAGACAGAAAGAACTCGG - Intergenic
1051572562 9:18576933-18576955 TTTTGAACTCAGACAGAGCTGGG - Intronic
1051771074 9:20580428-20580450 TATTCAAGACTGAAAGAAGTTGG - Intronic
1051983220 9:23049481-23049503 TTTTCAAAACAGAAACCACCAGG + Intergenic
1052385706 9:27821476-27821498 TTTTCAGCAGAGGAATAACTTGG + Intergenic
1052504568 9:29336471-29336493 TTTAAAATTCAGAAAGAACTGGG + Intergenic
1052786050 9:32829474-32829496 TTTCCAAGACAGAAATAACCAGG - Intergenic
1055539029 9:77281514-77281536 TTTTAAATACAGGAAGAATTAGG + Intronic
1056385620 9:86094584-86094606 ATTTCAAAACAGGAAGAATTTGG - Intronic
1056417066 9:86387192-86387214 TATTCAACGCTGCAAGAACTGGG - Intergenic
1056855902 9:90129418-90129440 TTATCACTGCAGAAAGAACTTGG - Intergenic
1056983114 9:91335200-91335222 CTTTCCACACAGAAAGCACCGGG - Intronic
1057974748 9:99593534-99593556 CTGTGAACACAGAAAGAATTAGG + Intergenic
1058186023 9:101856028-101856050 TTTCCAACAGAGAAAAACCTTGG + Intergenic
1058490870 9:105497491-105497513 TTTCCAAAACAGAAAGCACCAGG - Intronic
1058942561 9:109827184-109827206 TTTCCAAAAAAGAAAGAAGTAGG + Intronic
1059379800 9:113914174-113914196 TTCTCATCACAGAAAGAACCGGG - Intronic
1059745351 9:117195045-117195067 TTTTAAGCACAGAACAAACTTGG + Intronic
1060104451 9:120865110-120865132 TTTTCATCAAAGAAAGATTTGGG + Intronic
1060572013 9:124650752-124650774 TTTCCAAAACAGAAAGCAGTAGG + Intronic
1060659838 9:125398624-125398646 TTTTCAAAACATAGAGAAGTTGG - Intergenic
1060879875 9:127110668-127110690 TTATGAACACAGGAAAAACTGGG - Intronic
1185659771 X:1718282-1718304 TTTTCAACATAAGCAGAACTTGG + Intergenic
1186787774 X:12969544-12969566 TTTTTAACACAGAAAGCCATTGG + Intergenic
1187739079 X:22335661-22335683 TTTTGAACAAAGAAAGAATGGGG - Intergenic
1188590835 X:31833063-31833085 TTTTCCACACAGTAATAACTAGG - Intronic
1188895136 X:35658640-35658662 TTTTCAACCCAGATGGACCTGGG + Intergenic
1189711097 X:43812857-43812879 TTGTCCACATAGAAAGAAATGGG + Intronic
1189740204 X:44110069-44110091 TATTCAACATATAAAGAACCAGG - Intergenic
1190018410 X:46849548-46849570 TTTTCAAAACAAAAAGCATTAGG - Intronic
1190938379 X:55016918-55016940 TTTTCAAGTCAGAGAGACCTGGG - Intronic
1192093452 X:68184923-68184945 TGGTCAACACAGGAAGCACTGGG + Intronic
1192939454 X:75897840-75897862 TTTGCAACACAATAAGAAATTGG - Intergenic
1193200317 X:78682137-78682159 TTTTCAACCTAGGCAGAACTGGG - Intergenic
1193689854 X:84628211-84628233 TTTACAAGCCAGAAAGAATTGGG - Intergenic
1194046690 X:89014935-89014957 TTTTAAAAAAAGAAAGAATTTGG - Intergenic
1194822039 X:98521714-98521736 AATTCACCACAGAAATAACTTGG - Intergenic
1195775491 X:108399607-108399629 TTTTCAACACACAAAATGCTAGG + Intronic
1197030861 X:121813296-121813318 TTTTCGACATAGAAAGCACCAGG - Intergenic
1197781422 X:130164461-130164483 TTTACAATACAGAAACACCTGGG - Intronic
1198432796 X:136584629-136584651 GTTTGGACACAGAAAGAACAGGG - Intergenic
1198540644 X:137635625-137635647 TTATCAGCACTCAAAGAACTTGG - Intergenic
1198589782 X:138164912-138164934 TTTTCAATACATAAATAAATGGG - Intergenic
1199541148 X:148959244-148959266 TTTATAAGACAGAAATAACTTGG - Intronic
1202033931 Y:20611773-20611795 TTTTTAAAAAAGAAAAAACTTGG - Intergenic