ID: 1030050020

View in Genome Browser
Species Human (GRCh38)
Location 7:105529676-105529698
Sequence CTGGCCCCTAACTGTATTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030050020_1030050029 27 Left 1030050020 7:105529676-105529698 CCAAAAATACAGTTAGGGGCCAG No data
Right 1030050029 7:105529726-105529748 GCACTTTGGGAGGTCAAGACAGG 0: 103
1: 5382
2: 74204
3: 192477
4: 233134
1030050020_1030050027 17 Left 1030050020 7:105529676-105529698 CCAAAAATACAGTTAGGGGCCAG No data
Right 1030050027 7:105529716-105529738 TGTAATCCTAGCACTTTGGGAGG 0: 22138
1: 313177
2: 258607
3: 141974
4: 131406
1030050020_1030050023 -7 Left 1030050020 7:105529676-105529698 CCAAAAATACAGTTAGGGGCCAG No data
Right 1030050023 7:105529692-105529714 GGGCCAGGTGCAGTGGCTCATGG 0: 19
1: 111
2: 358
3: 778
4: 1501
1030050020_1030050025 13 Left 1030050020 7:105529676-105529698 CCAAAAATACAGTTAGGGGCCAG No data
Right 1030050025 7:105529712-105529734 TGGCTGTAATCCTAGCACTTTGG 0: 88
1: 9401
2: 115478
3: 250982
4: 245567
1030050020_1030050026 14 Left 1030050020 7:105529676-105529698 CCAAAAATACAGTTAGGGGCCAG No data
Right 1030050026 7:105529713-105529735 GGCTGTAATCCTAGCACTTTGGG 0: 139
1: 18607
2: 254738
3: 280632
4: 171031

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030050020 Original CRISPR CTGGCCCCTAACTGTATTTT TGG (reversed) Intergenic
No off target data available for this crispr